Соединения пиразоло[3,4-b]пиридина в качестве ингибиторов киназ там и мет

Группа изобретений относится к фармацевтической химии и включает соединение формулы I или его стереоизомеры, таутомеры и фармацевтически приемлемые соли, (R)-N-(3-фтор-4-((3-((1-гидроксипропан-2-ил)амино)-1H-пиразоло[3,4-b]пиридин-4-ил)окси)фенил)-3-(4-фторфенил)-1-изопропил-2,4-диоксо-1,2,3,4-тетрагидропиримидин-5-карбоксамид, фармацевтическую композицию и способ лечения рака на их основе. В формуле I X1 представляет собой CH или N; R1 представляет собой водород или C1-C6 алкил; R2 и G выбраны из групп, указанных в формуле изобретения; R9 представляет собой водород или галоген. Технический результат – соединение формулы I, обладающее ингибирующей активностью в отношении киназ ТАМ и МЕТ, используемое для лечения TAM-ассоциированного c-Met-ассоциированного рака у пациента. 5 н. и 12 з.п. ф-лы, 9 табл., 201 пр.

 

Перекрестная ссылка на родственные заявки

Настоящая заявка испрашивает приоритет согласно предварительной заявке на патент США No. 62/724829, поданной 30 августа 2018, и 62/858686, поданной 7 июня 2019, содержания которых полностью включены в настоящую заявку посредством ссылки.

Уровень техники

В настоящем документе представлены новые ингибиторы киназ ТАМ и МЕТ, фармацевтические композиции, включающие соединения, способы получения соединений и применение соединений в терапии. Более конкретно, в настоящем документе представлены соединения пиразоло[3,4-b]пиридина, полезные для лечения и профилактики заболеваний, которые можно лечить с помощью ингибитора киназы ТАМ или ингибитора киназы МЕТ.

Рецепторные тирозинкиназы (RTK) представляют собой белки клеточной поверхности, которые передают сигналы из внеклеточной среды в цитоплазму и ядро клетки для регулирования таких клеточных событий, как выживание, рост, пролиферация, дифференцировка, адгезия и миграция.

Подсемейство TAM состоит из трех RTK, включая TYRO3, AXL и Mer (Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). Киназы ТАМ характеризуются внеклеточным лиганд-связывающим доменом, состоящим из двух иммуноглобулин-подобных доменов и двух доменов фибронектина типа III. Два лиганда, специфичный для остановки роста 6 (GAS6) и белок S (PROS1), были идентифицированы для киназ ТАМ. GAS6 может связываться со всеми тремя киназами ТАМ и активировать их, в то время как PROS1 является лигандом для Mer и TYRO3 (Graham et al., 2014, Nature Reviews Cancer 14, 769-785).

AXL (также известный как UFO, ARK, JTK11 и TYRO7) был первоначально идентифицирован как трансформирующий ген из ДНК пациентов с хроническим миелогенным лейкозом (O'Bryan et al., 1991, Mol Cell Biol 11, 5016-5031; Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). GAS6 связывается с AXL и вызывает последующее автофосфорилирование и активацию тирозинкиназы AXL. AXL активирует несколько нисходящих сигнальных путей, включая PI3K-Akt, Raf-MAPK, PLC-PKC (Feneyrolles et al., 2014, Molecular Cancer Therapeutics 13, 2141-2148; Linger et al., 2008, Advances in Cancer Research 100, 35-83).

MER (также известный как MERTK, EYK, RYK, RP38, NYK и TYRO 12) первоначально был идентифицирован как фосфопротеин из библиотеки экспрессии лимфобластоидов (Graham et al., 1995, Oncogene 10, 2349-2359; Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). И GAS6, и PROS1 могут связываться с Mer и индуцировать фосфорилирование и активацию Mer-киназы (Lew et al., 2014). Как и AXL, активация MER также передает нисходящие сигнальные пути, включая PI3K-Akt и Raf-MAPK (Linger et al., 2008, Advances in Cancer Research 100, 35-83).

TYRO3 (также известный как DTK, SKY, RSE, BRT, TIF, ETK2) был первоначально идентифицирован с помощью исследования клонирования на основе ПЦР (Lai et al., Neuron 6, 691-70, 1991; Graham et al., 2014, Nature Reviews Cancer 14, 769-785; Linger et al., 2008, Advances in Cancer Research 100, 35-83). Оба лиганда, GAS6 и PROS1, могут связываться с TYRO3 и активировать его. Хотя сигнальные пути ниже активации TYRO3 наименее изучены среди TAM RTK, похоже, что в них участвуют как PI3K-Akt, так и Raf-MAPK пути (Linger et al., 2008, Advances in Cancer Research 100, 35-83). Обнаружено, что AXL, MER и TYRO3 сверхэкспрессируются в раковых клетках.

Семейство MET включает мезенхимально-эпителиальный переходный фактор (c-Met), однопроходный тирозинкиназный рецептор, который экспрессируется на поверхности различных эпителиальных клеток; его лиганд представляет собой фактор роста гепатоцитов/фактор рассеяния (HGF/SF) (Nakamura et al., Nature 342:440-443, 1989). Связывание HFG с c-Met инициирует серию внутриклеточных сигналов, которые опосредуют эмброгенез и будут заживать в нормальных клетках (Organ, Ther. Adv. Med. Oncol. 3(1 Supply):S7-S19, 2011). Однако в раковых клетках аберрантная активация оси HGF/c-Met, которая тесно связана с мутациями гена c-Met, сверхэкспрессия и амплификация способствует развитию и прогрессированию опухоли, - например, путем стимуляции PI3K/AKT, Ras/MAPK, JAK/STAT, SRC и Wnt/β-катенин сигнальных путей (Zhang et al., Mol. Cancer 17:45, 2018; Mizuno et al., Int. J. Mol. Sci. 14:888-919, 2013). Конститутивная активация вышеупомянутых c-Met-зависимых сигнальных путей наделяет раковые клетки конкурентным преимуществом роста по сравнению с нормальными клетками и увеличивает вероятность метастазирования - например, обеспечивая доступ к кровоснабжению и наделяя способностью диссоциировать от тканей (Comoglio et al., Nat. Rev. Drug Discov. 7:504-516, 2008; Birchmeier et al., Nat. Rev. Mol. Cell. Biol. 4:915-925, 2003).

Соответственно, в данной области существует потребность в соединениях и способах их использования для модуляции киназ ТАМ и МЕТ при лечении рака.

Сущность изобретения

В настоящем документе предложено соединение формулы I:

и его стереоизомеры, таутомеры и фармацевтически приемлемые соли, где R1, R2, R9, X1 и G имеют значения, определенные в настоящем документе.

В настоящем документе также предложена фармацевтическая композиция, включающая соединение формулы I или его фармацевтически приемлемую соль в смеси с фармацевтически приемлемым разбавителем или носителем.

В настоящем документе также предложен способ ингибирования пролиферации клеток in vitro или in vivo, включающий приведение клетки в контакт с эффективным количеством соединения формулы I или его фармацевтически приемлемой соли, или их фармацевтической композиции, как определено в настоящем документе.

В настоящем документе также предложен способ лечения рака и/или ингибирования метастазов, связанных с конкретным раком, у пациента, нуждающегося в таком лечении, причем способ включает введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или их фармацевтической композиции, как определено в настоящем документе.

В настоящем документе также предложено соединение формулы I или его фармацевтически приемлемая соль, или их фармацевтическая композиция, как определено в настоящем документе, для применения в терапии.

В настоящем документе также предложено соединение формулы I или его фармацевтически приемлемая соль, или их фармацевтическая композиция, как определено в настоящем документе, для применения в лечении рака и/или ингибирования метастазов, связанных с конкретным раком.

В настоящем документе также предложено соединение формулы I или его фармацевтически приемлемая соль для применения для ингибирования активности киназы ТАМ.

В настоящем документе также предложено соединение формулы I или его фармацевтически приемлемая соль, или их фармацевтическая композиция, как определено в настоящем документе, для применения при лечении ТАМ-ассоциированного заболевания или расстройства, такого как рак. В некоторых вариантах осуществления TAM-ассоциированный рак представляет собой рак, имеющий хромосомную транслокацию, которая приводит к экспрессии слитого белка TMEM87B-MERTK (например, аминокислоты 1-55 TMEM87B и аминокислоты 433-1000 MERTK) или слитого белка AXL-MBIP.

В настоящем документе также предложено применение соединения формулы I или его фармацевтически приемлемой соли, как определено в настоящем документе, в получении лекарственного средства для лечения рака и/или ингибирования метастазов, связанных с конкретным раком.

В настоящем документе также предложено применение соединения формулы I или его фармацевтически приемлемой соли, как определено в настоящем документе, в получении лекарственного средства для ингибирования активности ТАМ-киназы.

В настоящем документе также предложено применение соединения формулы I или его фармацевтически приемлемой соли, как определено в настоящем документе, в получении лекарственного средства для лечения ТАМ-ассоциированного заболевания или расстройства, такого как рак.

В настоящем документе также предложена фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительное терапевтическое средство. В настоящем документе также предложена фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительное терапевтическое средство, для применения в терапии. В одном варианте осуществления соединение формулы I или его фармацевтически приемлемая соль и дополнительное терапевтическое средство формулируют в виде отдельных композиций или доз для одновременного, раздельного или последовательного применения в терапии, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного терапевтического средства вместе являются терапевтически эффективными. Также в настоящем документе предложена фармацевтическая композиция, включающая такую комбинацию. Также в настоящем документе предложена коммерческая упаковка или продукт, включающий такую комбинацию, как комбинированный препарат для одновременного, раздельного или последовательного применения.

В одном варианте осуществления, дополнительное терапевтическое средство представляет собой противораковое средство (например, любое из дополнительных противораковых средств, описанных в настоящем документе). Соответственно, в настоящем документе предложена фармацевтическая комбинация для лечения рака (например, ТАМ-ассоциированного рака) у пациента, нуждающегося в этом, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительное противораковое средство (например, любое из дополнительных противораковых средств, описанных в настоящем документе), где соединение формулы I или его фармацевтически приемлемая соль и дополнительное терапевтическое средство формулируют в виде отдельных композиций или доз для одновременного, раздельного или последовательного применения для лечения рака, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного противоракового средства вместе эффективны при лечении рака.

Также в настоящем документе предложена фармацевтическая комбинация для лечения рака (например, TAM-ассоциированный рак) у пациента, нуждающегося в этом, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительное противораковое средство (например, любое из дополнительных противораковых средств, описанных в настоящем документе), где соединение формулы I или его фармацевтически приемлемая соль и дополнительное терапевтическое средство формулироуют в виде отдельных композиций или доз для одновременного, раздельного или последовательного применения для лечения рака, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного противоракового средства вместе эффективны при лечении рака. Также в настоящем документе предложена фармацевтическая композиция, включающая такую комбинацию. В настоящем документе также предложено применение такой комбинации для получения лекарственного средства для лечения рака. Также в настоящем документе предложена коммерческая упаковка или продукт, включающий такую комбинацию, как комбинированный препарат для одновременного, раздельного или последовательного применения; и способ лечения рака у пациента, нуждающегося в этом.

Также предложены способы лечения индивидуума, страдающего раком, которые включают введение соединения формулы I или его фармацевтически приемлемой соли до, во время или после введения другого противоракового средства (например, другого противоракового средства, к которому у субъекта ранее развилась резистентность, например, любое из дополнительных противораковых средств, описанных в настоящем документе).

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован ТАМ-ассоциированный рак, которые включают введение пациенту, у которого определен или диагностирован ТАМ-ассоциированный рак, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы лечения пациента, страдающего раком, которые включают (а) идентификацию пациента как больного ТАМ-ассоциированным раком и (b) введение пациенту, у которого определен ТАМ-ассоциированный рак, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы снижения риска развития метастазов или дополнительных метастазов у пациента, у которого определен или диагностирован TAM-ассоциированный рак, которые включают введение пациенту, у которого определен или диагностирован TAM-ассоциированный рак, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы снижения риска развития метастазов или дополнительных метастазов у пациента, страдающего раком, которые включают: (а) определение у пациента TAM-ассоциированного рака, и (b) введение пациенту, у которого определили TAM-ассоциированный рак, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы уменьшения миграции и/или инвазии раковой клетки у пациента, у которого определен или диагностирован TAM-ассоциированный рак, которые включают введение пациенту, у которого определен или диагностирован TAM-ассоциированный рак, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы уменьшения миграции и/или инвазии раковой клетки у пациента, страдающего раком, которые включают (a) определение у пациента TAM-ассоциированного рака; и (b) введение пациенту, у которого определен ТАМ-ассоциированный рак, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы выбора лечения для пациента, у которого определен или диагностирован ТАМ-ассоциированный рак, которые включают выбор соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли, для пациента, у которого определен или диагностирован TAM-ассоциированный рак.

В настоящем документе также предложены способы выбора лечения для пациента, которые включают (a) определение у пациента TAM-ассоциированного рака, и (b) выбор соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли, для пациента, у которого определен TAM-ассоциированный рак.

В настоящем документе также предложены способы выбора лечения для пациента, у которого определен или диагностирован рак, которые включают (a) введение пациенту дополнительного противоракового средства, (b) после (a), выявление повышенной экспрессии и/или активности ТАМ-киназы в раковой клетке пациента и (c) после (b), выбор соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли, для пациента.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) введение пациенту, у которого определен или диагностирован рак, одной или нескольких доз по меньшей мере одного дополнительного противоракового средства; (b) после (a), определение увеличения экспрессии и/или активности киназы ТАМ в раковой клетке или иммунной клетке субъекта; и (c) после (b), введение пациенту соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления этих способов стадия (c) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

Также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) определение увеличения экспрессии и/или активности киназы ТАМ в раковой клетке или иммунной клетке пациента, у которого определен или диагностирован рак и ранее введена одна или несколько доз по меньшей мере одного дополнительного противоракового средства; и (b) после (a), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления этих способов стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которому ранее была введена одна или несколько доз по меньшей мере одного дополнительного противоракового средства и у которого определена раковая клетка или иммунная клетка, которая имеет повышенную экспрессию и/или активность киназы ТАМ, которые включают введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли, пациенту. В некоторых вариантах осуществления этих способов стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) выбор пациента, у которого определена или диагностирована повышенная экспрессия и/или активность киназы ТАМ в раковой клетке или иммунной клетке; и (b) после (a) введение выбранному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления этих способов стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) выбор пациента, у которого определен или диагностирован рак, которому ранее вводили одну или несколько доз дополнительного противоракового средства и у которого определена раковая клетка или иммунная клетка, имеющая повышенную экспрессию и/или активность киназы ТАМ; и (b) после (a), введение выбранному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления этих способов стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак, которые включают: (a) введение пациенту, у которого определен или диагностирован ТАМ-ассоциированный рак, одной или нескольких доз ингибитора киназы ТАМ; (b) после (a), определение резистентности ТАМ-ассоциированного рака у пациента к ингибитору ТАМ-киназы; и (c) после (b), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления этих способов стадия (с) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак, которые включают: (a) определение резистентности ТАМ-ассоциированного рака у пациента к ингибитору ТАМ-киназы, который ранее был введен пациенту; и (b) после (a), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления этих способов стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак и определено, что уже развилась резистентность к ингибитору ТАМ-киназы, которые включают введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы снижения иммунной толерантности у субъекта, нуждающегося в этом, которые включают введение субъекту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или его фармацевтической композиции, как определено в настоящем документе.

В настоящем документе также предложены способы ингибирования ангиогенеза у субъекта, нуждающегося в этом, включающие введение субъекту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или его фармацевтической композиции, как определено в настоящем документе.

В настоящем документе также предложены способы подавления резистентности к терапевтическому средству у субъекта, нуждающегося в этом, которые включают введение субъекту терапевтически эффективного количества (i) соединения формулы I или его фармацевтически приемлемой соли, или любой из его фармацевтических композиций, описанных в настоящем документе, и (ii) терапевтического средства, где терапевтическое средство выбрано из группы, состоящей из химиотерапевтического средства, ингибитора PI-3-киназы, ингибитора EGFR, ингибитора HER2/neu, ингибитора FGFR, ингибитора ALK, ингибитора IGF1R, ингибитора VEGFR, ингибитора PDGFR, глюкокортикоида, ингибитора BRAF, ингибитора MEK, ингибитора HER4, ингибитора MET (например, ингибитора c-Met типа 1), ингибитора RAF, ингибитора Akt, ингибитора FTL-3, и ингибитора пути МАР-киназы.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован ТАМ-ассоциированный рак, которые включают проведение лучевой терапии до или после введения пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак, которые включают проведение хирургического вмешательства до или после введения пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или фармацевтической композиции, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложены способы ингибирования активности киназы ТАМ в клетке млекопитающего, нуждающегося в этом, которые включают приведение в контакт клетки млекопитающего с соединением формулы I или его фармацевтически приемлемой солью, или фармацевтической композицией, включающей терапевтически эффективное количество соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложен способ получения соединения формулы I или его фармацевтически приемлемой соли.

В настоящем документе также предложено соединение формулы I или его фармацевтически приемлемая соль, полученная способом получения соединения, как определено в настоящем документе.

Если не указано иное, все технические и научные термины, используемые в настоящем документе, имеют то же значение, которое обычно понимается специалистом в области, к которой относится настоящее изобретение. В настоящем документе описаны способы и материалы для использования в настоящем изобретении; также могут быть использованы другие подходящие методы и материалы, известные в данной области. Материалы, методы и примеры являются только иллюстративными и не предназначены для ограничения. Все публикации, патентные заявки, патенты, последовательности, записи в базе данных и другие ссылки, упомянутые в настоящем документе, включены в качестве ссылки в полном объеме. В случае противоречий настоящее описание, включая определения, имеет приоритет.

Другие особенности и преимущества изобретения будут очевидны из следующего подробного описания, а также из формулы изобретения.

ПОДРОБНОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В настоящем документе предложено соединение формулы I:

и его стереоизомеры, таутомеры и фармацевтически приемлемые соли, где:

X1 представляет собой CH или N;

R1 представляет собой водород или C1-C6 алкил;

R2 представляет собой

(a) водород,

(b) C1-C6 алкил,

(c) гидроксиС1-C6 алкил,

(d) дигидроксиС2-С6 алкил,

(e) C1-C6 фторалкил, необязательно замещенный OH,

(f) (ди-C1-C6 алкокси)C2-C6 алкил-,

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(h) Cyc1,

(i) Cyc2,

(j) (hetCyc1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(k) (Ar1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(l) (hetAr1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, или

(m) (HOSO3)C1-C6 алкил-;

Cyc1 представляет собой 3-4-членное циклоалкильное кольцо, необязательно замещенное 1-2 заместителями, независимо выбранными из галогена, гидрокси, C1-C3 алкила, гидроксиС1-C3 алкила, C1-C3 алкокси, (C1-C3 алкокси)C1-C3 алкил- и R'R''NC(=O)-;

R' и R'' независимо представляют собой водород или C1-C6 алкил;

Cyc2 представляет собой 5-членное циклоалкильное кольцо, замещенное 1-2 заместителями, независимо выбранными из C1-C3 алкила, (C1-C3 алкокси)C1-C3 алкил- и гидроксиС1-C3 алкил-;

hetCyc1 представляет собой 5-6-членное насыщенное гетероциклическое кольцо, имеющее 1-2 кольцевых гетероатома, независимо выбранных из O, N и SO2, где указанное кольцо необязательно замещено оксо;

Ar1 представляет собой фенил;

hetAr1 представляет собой пиридил;

G представляет собой

или ;

X2 представляет собой C или N;

Кольцо A, включая атомы в точках присоединения, представляет собой 5-6-членное гетероциклическое кольцо, необязательно имеющее дополнительные 1-2 кольцевых атома азота, когда X2 представляет собой N, и имеющее один кольцевой атом азота, когда X2 представляет собой C;

R3 представляет собой водород, метил или отсутствует;

Кольцо B, включая атомы в точках присоединения, представляет собой 6-членную насыщенную карбоциклическую группу, необязательно замещенную оксо, или 6-членное ароматическое карбоциклическое кольцо, необязательно замещенное OH;

R6 представляет собой водород, галоген, C1-C6 алкил, C1-C6 алкокси, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, при условии, что когда R6 находится на кольцевом атоме углерода, смежном с углеродом, связанным с фрагментом -NHC(=O)- формулы I, тогда R6 не является галогеном, и

R7 представляет собой водород, C1-C6 алкил, оксо или тиоксо,

или необязательно, когда R6 и R7 находятся у одного и того же атома углерода, R6 и R7 вместе с атомом углерода, к которому они присоединены, образуют циклопропильное кольцо;

hetCyc2 представляет собой 4-6-членное насыщенное гетероциклическое кольцо, имеющее кольцевой атом азота и необязательно замещенное C1-C6 алкилом;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

Для сложных химических названий, используемых в настоящем документе, группа заместителя упоминается перед группой, к которой она присоединяется. Например, метоксиэтил включает этильную основную цепь с метоксизаместителем.

Термин «гетероциклическое кольцо», когда конкретно относится к кольцу A, означает, что кольцо A представляет собой насыщенное, частично ненасыщенное или ароматическое 5-6-членное гетероциклическое кольцо.

Термин «галоген» означает -F (иногда называемый здесь «фтор»), -Cl, -Br и -I.

Термины «C1-C2 алкил», «C1-C3 алкил», «C1-C6 алкил» и «C2-C6 алкил», используемые в настоящем документе, относятся к насыщенным линейным или разветвленным одновалентным углеводородным радикалам из от одного до двух, от одного до трех, от одного до шести или от двух до шести атомов углерода, соответственно. Примеры включают, но не ограничиваются ими, метил, этил, 1-пропил, изопропил, 1-бутил, изобутил, втор-бутил, трет-бутил, 2-метил-2-пропил, пентил, неопентил и гексил.

Термины «C1-C2 алкокси», «C1-C3 алкокси» и «C1-C6 алкокси», как используются в настоящем описании, относятся к насыщенному одновалентному алкоксирадикалу с линейной или разветвленной цепью, содержащему от одного до двух, от одного до трех или от одного до шести атомов углерода, соответственно, где радикал находится на атоме кислорода. Примеры включают метокси, этокси, пропокси, изопропокси, бутокси и трет-бутокси.

Термин «C1-C6 фторалкил», как используется в настоящем описании, включает C1-C6 алкильные и C1-C6 алкокси-группы, соответственно, которые замещены одним или несколькими фторами, такие как, но не ограничиваясь ими, фторметил, дифторметил, трифторметил, 2,2,2-трифторэтил и тому подобные.

Термин «(C1-C6 алкокси)C1-C6 алкил-», как используется в настоящем описании, относится к насыщенным одновалентным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, где один из атомов углерода замещен C1-C6 алкоксигруппой, как определено в настоящем документе. Примеры включают метоксиметил (CH3OCH2-) и метоксиэтил (CH3OCH2CH2-).

Термин "(C1-C3 алкокси)C1-C3 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным радикалам с линейной или разветвленной цепью, содержащим от одного до трех атомов углерода, где один из атомов углерода замещен C1-C3 алкоксигруппой, как определено в настоящем документе.

Термин "(ди-C1-C6 алкокси)C2-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, где два атома углерода замещены C1-C6 алкоксигруппой, как определено в настоящем документе.

Термины "гидроксиС1-C3 алкил-" и "гидроксиС1-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным алкильным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, соответственно, где один из атомов углерода замещен гидроксильной группой.

Термин "дигидроксиС2-С6 алкил-", как используется в настоящем описании, относится к насыщенному одновалентному алкильному радикалу с линейной или разветвленной цепью, содержащему от двух до шести атомов углерода, где два атома углерода замещены гидроксильной группой, при условии, что две гидроксильные группы не находятся на одном и том же атоме углерода.

Термин "(hetCyc1)C1-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным алкильным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, соответственно, где один из атомов углерода замещен группой hetCyc1, как определено в настоящем документе.

Термин "(Ar1)C1-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным алкильным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, соответственно, где один из атомов углерода замещен группой Ar1, как определено в настоящем документе.

Термин "(hetAr1)C1-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным алкильным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, соответственно, где один из атомов углерода замещен группой hetAr1, как определено в настоящем документе.

Термин "(HOSO3)C1-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным алкильным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, соответственно, где один из атомов углерода замещен группой HOSO3-.

Термин "(C3-C6 циклоалкил)C1-C6 алкил-", как используется в настоящем описании, относится к насыщенным одновалентным алкильным радикалам с линейной или разветвленной цепью, содержащим от одного до шести атомов углерода, соответственно, где один из атомов углерода замещен C3-C6 циклоалкильной группой.

Термин "C3-C6 циклоалкил", как используется в настоящем описании, относится к насыщенному карбоциклическому кольцу, имеющему от трех до шести кольцевых атомов углерода, то есть циклопропилу, циклобутилу, циклопентилу или циклогексилу.

Термин «оксо» или «оксогруппа», как используется в настоящем описании, означает атом кислорода, который связан двойной связью с атомом углерода, то есть =O.

Термин «тиоксо», как используется в настоящем описании, означает атом серы, который связан двойной связью с атомом углерода, то есть =S.

Термин «соединение», как используется в настоящем описании, включает все стереоизомеры, геометрические изомеры, таутомеры и изотопы изображенных структур. Подразумевается, что соединения в настоящем документе, идентифицированные по названию или структуре как одна конкретная таутомерная форма, включают другие таутомерные формы, если не указано иное.

Термин «таутомер», используемый в настоящем описании, относится к соединениям, структуры которых заметно различаются расположением атомов, но которые существуют в легком и быстром равновесии, и следует понимать, что соединения, представленные в настоящем документе, могут быть изображены как различные таутомеры, и когда соединения имеют таутомерные формы, предполагается, что все таутомерные формы входят в объем изобретения, и название соединений не исключает наличия какого-либо таутомера. Примеры таутомеризаций включают, но не ограничиваются ими, амид-имидная; енамин-иминовая; енамин-(отличающийся)енаминовая таутомеризации; и кето-энольная.

Следует понимать, что определенные соединения, представленные в настоящем документе, могут содержать один или несколько центров асимметрии и поэтому могут быть получены и выделены в смеси изомеров, такой как рацемическая смесь, или в энантиомерно чистой форме. Для соединений по изобретению, в которых стереохимия обозначена прямыми толстыми линиями или прямыми пунктирными линиями, прямые толстые линии или прямые пунктирные линии указывают на относительную стереохимию. Для соединений по изобретению, в которых стереохимия обозначена сплошными клиньями или штриховыми клиньями, сплошные клинья или пунктирные клинья указывают на абсолютную стереохимию.

В одном варианте осуществления формулы I, X1 представляет собой CH.

В одном варианте осуществления формулы I, X1 представляет собой N.

В одном варианте осуществления формулы I, R9 представляет собой водород.

В одном варианте осуществления формулы I, R9 представляет собой галоген.

В одном варианте осуществления формулы I, X1 представляет собой CH и R9 представляет собой галоген. В одном варианте осуществления формулы I, X1 представляет собой CH и R9 представляет собой фтор.

В одном варианте осуществления формулы I, X1 представляет собой N и R9 представляет собой водород.

В одном варианте осуществления формулы I, R1 представляет собой водород.

В одном варианте осуществления формулы I, R1 представляет собой C1-C6 алкил. В одном варианте осуществления формулы I, R1 представляет собой метил.

В одном варианте осуществления формулы I, R2 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой водород и R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой C1-C6 алкил. В одном варианте осуществления формулы I, R2 представляет собой C1-C6 алкил и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой метил или этил. В одном варианте осуществления формулы I, R2 представляет собой метил или этил и R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой гидроксиС1-C6 алкил. В одном варианте осуществления формулы I, R2 представляет собой гидроксиС1-C6 алкил и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой гидроксиС1-C6 алкил и R1 представляет собой C1-C6 алкил. В одном варианте осуществления формулы I, R2 представляет собой гидроксиС1-C6 алкил и R1 представляет собой метил. В одном варианте осуществления формулы I, R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород. В одном из указанных вариантов осуществления R1 представляет собой C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой метил.

В одном варианте осуществления формулы I, представляет собой дигидроксиС2-С6 алкил. В одном варианте осуществления формулы I, R2 представляет собой дигидроксиС2-С6 алкил и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой C1-C6 фторалкил, необязательно замещенный OH. В одном варианте осуществления формулы I, R2 представляет собой C1-C6 фторалкил, необязательно замещенный OH, и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой C1-C6 фторалкил, необязательно замещенный OH, и R1 представляет собой C1-C6 алкил. В одном варианте осуществления формулы I, R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I R2 представляет собой (ди-C1-C6 алкокси)C2-C6 алкил-. В одном варианте осуществления формулы I R2 представляет собой (ди-C1-C6 алкокси)C2-C6 алкил- и R1 представляет собой водород. В одном варианте осуществления формулы I R2 представляет собой (ди-C1-C6 алкокси)C2-C6 алкил- и R1 представляет собой C1-C6 алкил. В одном варианте осуществления R2 представляет собой

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH. В одном варианте осуществления формулы I, R2 представляет собой (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R2 представляет собой C1-C6 алкил. В одном варианте осуществления, R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород. В одном из указанных вариантов осуществления R1 представляет собой C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой метил.

В одном варианте осуществления формулы I, R2 представляет собой Cyc1. В одном варианте осуществления формулы I, R2 представляет собой Cyc1 и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой Cyc1 и R1 представляет собой C1-C6 алкил. В одном варианте осуществления формулы I R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой Cyc2. В одном варианте осуществления формулы I, R2 представляет собой Cyc2 и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой Cyc2 и R1 представляет собой C1-C6 алкил. В одном варианте осуществления формулы I R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой (hetCyc1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH. В одном варианте осуществления формулы I, R2 представляет собой (hetCyc1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой (hetCyc1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R1 представляет собой C1-C6 алкил. В одном варианте осуществления R2 выбран из структур

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой (Ar1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH. В одном варианте осуществления формулы I, R2 представляет собой (Ar1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой (Ar1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R2 представляет собой C1-C6 алкил. В одном из указанных вариантов осуществления R2 представляет собой (Ar1)C1-C6 алкил-, где указанная алкильная часть замещена OH. В одном варианте осуществления R2 представляет собой

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой (hetAr1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH. В одном варианте осуществления формулы I, R2 представляет собой (hetAr1)C1-C6 алкил- где указанная алкильная часть необязательно замещена OH, и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой (hetAr1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, и R1 представляет собой C1-C6 алкил. В одном из указанных вариантов осуществления R2 представляет собой (hetAr1)C1-C6 алкил-, где указанная алкильная часть замещена OH. В одном варианте осуществления R2 выбран из структур:

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I, R2 представляет собой (HOSO3)C1-C6 алкил-. В одном варианте осуществления формулы I R2 представляет собой (HOSO3)C1-C6 алкил- и R1 представляет собой водород. В одном варианте осуществления формулы I, R2 представляет собой (HOSO3)C1-C6 алкил- и R1 представляет собой C1-C6 алкил. В одном варианте осуществления R2 представляет собой

и R1 представляет собой водород или C1-C6 алкил. В одном из указанных вариантов осуществления R1 представляет собой водород.

В одном варианте осуществления формулы I G представляет собой

где X2 представляет собой C или N, и кольцо A представляет собой 5-6-членное гетероциклическое кольцо, необязательно имеющее дополнительные 1-2 кольцевых атома азота, когда X2 представляет собой N, и имеющее один кольцевой атом азота, когда X2 представляет собой C, и R3, R6, R7 и R8 имеют значения, как определено для формулы I.

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой C или N, кольцо A представляет собой 5-6-членное гетероциклическое кольцо, имеющее один кольцевой атом азота, и R3, R6, R7 и R8 имеют значения, как определено для формулы I.

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее один дополнительный кольцевой атом азота, и R7 представляет собой оксо, где G имеет формулу A-1

где R6 представляет собой C1-C6 алкил, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, и hetCyc2 и R8 имеют значения, как определено для формулы I. В одном варианте осуществления формулы A-1, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления G представляет собой формулу A-1, где формула A-1 выбрана из структур:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее дополнительный кольцевой атом азота, и R7 представляет собой водород, где G имеет формулу A-2

где R6 представляет собой водород, C1-C6 алкил, или C3-C6 циклоалкил, R7 представляет собой водород, и R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы A-2, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, кольцо A представляет собой формулу A-2 и выбрано из структур:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, где G имеет формулу A-3

где R6 представляет собой галоген, C1-C6 алкил, C1-C6 алкокси или C3-C6 циклоалкил, R7 представляет собой водород, при условии, что когда R6 находится на кольцевом атоме углерода, смежном с углеродом, связанным с фрагментом -NHC(=O)- формулы I, тогда R6 не является галогеном, и R8 имеет значение, как определено для формулы I. Используемый в настоящем описании термин «кольцевой атом углерода, расположенный рядом с углеродом, связанным с фрагментом -NHC(=O)- формулы I» относится к атому углерода, обозначенному звездочкой в следующей структуре:

В одном варианте осуществления формулы A-3, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу A-3 и выбрано из структур:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее два дополнительных кольцевых атома азота, и R7 представляет собой оксо или тиооксо, где G имеет формулу A-4

где Y представляет собой O или S, R6 представляет собой C1-C6 алкил, и R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы A-4, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу A-4 и выбрано из структур:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой C, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее кольцевой атом азота, где G имеет формулу A-5

где R6 представляет собой C1-C6 алкил, R7 представляет собой водород, и R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы A-5, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу A-5 и выбрано из структур:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее два дополнительных кольцевых атома азота, где G имеет формулу A-6

где R6 и R7 представляют собой водород и R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы A-6, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу A-6 и имеет структуру:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 представляет собой водород или метил, и кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее кольцевой атом азота, где G имеет формулу A-7

где R6 и R7 представляют собой водород, или R6 и R7 находятся у одного и того же атома углерода и R6 и R7 вместе с атомом углерода, к которому они присоединены, образуют циклопропильное кольцо, и R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы A-7, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу A-7 и выбрано из структур:

В одном варианте осуществления формулы I, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 5-членное гетероциклическое кольцо, имеющее дополнительный кольцевой атом азота, где G имеет формулу A-8

где R6 представляет собой C1-C6 алкил, R7 представляет собой водород или C1-C6 алкил, и R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы A-8, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу A-8 и выбрано из структур:

В одном варианте осуществления формулы I, G представляет собой

где кольцо B и R8 имеют значения, как определено для формулы I.

В одном варианте осуществления формулы I, G представляет собой

где кольцо B представляет собой 6-членную насыщенную карбоциклическую группу, необязательно замещенную оксо. В одном варианте осуществления, G имеет формулу B-1

где R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы B-1, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления, G представляет собой формулу B-1 и имеет структуру:

.

В одном варианте осуществления формулы I, G представляет собой

где кольцо B представляет собой 6-членное ароматическое карбоциклическое кольцо, необязательно замещенное ОН. В одном варианте осуществления, G имеет формулу B-2

где R8 имеет значение, как определено для формулы I. В одном варианте осуществления формулы B-2, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами. В одном варианте осуществления формулы B-2, R8 представляет собой Ar2, где Ar2 представляет собой фенил, который является незамещенным. В одном варианте осуществления, G представляет собой формулу B-2 и имеет структуру:

В одном варианте осуществления, соединения формулы I включают формулу I-A, где:

X1 представляет собой CH или N;

R1 представляет собой водород или C1-C6 алкил;

R2 представляет собой

(a) водород,

(b) C1-C6 алкил,

(c) гидроксиС1-C6 алкил,

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, или

(h) Cyc1;

Cyc1 представляет собой 3-4-членное циклоалкильное кольцо, необязательно замещенное 1-2 заместителями, независимо выбранными из галогена, гидрокси, C1-C3 алкила, гидроксиС1-C3 алкила, C1-C3 алкокси, (C1-C3 алкокси)C1-C3 алкил- и R'R''NC(=O)-;

X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее один дополнительный кольцевой атом азота, и R7 представляет собой oxo, где G имеет формулу A-1

R6 представляет собой C1-C6 алкил, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2;

hetCyc2 представляет собой 4-6-членное насыщенное гетероциклическое кольцо, имеющее кольцевой атом азота и необязательно замещенное C1-C6 алкилом;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-A, R1 представляет собой водород,

В одном варианте осуществления формулы I-A, R9 представляет собой водород.

В одном варианте осуществления формулы I-A, R9 представляет собой галоген. В одном варианте осуществления формулы I-A, R9 представляет собой фтор.

В одном варианте осуществления формулы I-A, X1 представляет собой CH.

В одном варианте осуществления формулы I-A, X1 представляет собой CH и R9 представляет собой галоген. В одном варианте осуществления формулы I-A, X1 представляет собой CH и R9 представляет собой фтор.

В одном варианте осуществления формулы I-A, R1 представляет собой H, X1 представляет собой CH и R9 представляет собой фтор.

В одном варианте осуществления формулы I-A, R1 представляет собой H, X1 представляет собой CH, R8 представляет собой Ar2 и R9 представляет собой фтор.

В одном варианте осуществления формулы I-A, X1 представляет собой N.

В одном варианте осуществления формулы I-A, X1 представляет собой N и R9 представляет собой водород.

В одном варианте осуществления формулы I-A, R1 представляет собой водород, X1 представляет собой N и R9 представляет собой водород.

В одном варианте осуществления формулы I-A, R1 представляет собой водород, X1 представляет собой N, R8 представляет собой Ar2 и R9 представляет собой водород.

В одном варианте осуществления формулы I-A, R2 представляет собой H.

В одном варианте осуществления формулы I-A, R2 представляет собой C1-C6 алкил.

В одном варианте осуществления формулы I-A, R2 представляет собой гидроксиС1-C6 алкил.

В одном варианте осуществления формулы I-A, R2 представляет собой (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH.

В одном варианте осуществления формулы I-A, R2 представляет собой Cyc1.

В одном варианте осуществления формулы I-A, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-A, R8 представляет собой hetAr2. В одном варианте осуществления формулы I-A, R8 представляет собой пиразолил, необязательно замещенный C1-C6 алкилом.

В одном варианте осуществления формулы I-A, R8 представляет собой C3-C6 циклоалкил.

В одном варианте осуществления формулы I-A, R8 представляет собой hetCyc3.

В одном варианте осуществления формулы I-A, R8 представляет собой C1-C6 алкил.

В одном варианте осуществления, соединения формулы I включают формулу I-B, где:

X1 представляет собой CH или N;

R1 представляет собой водород или C1-C6 алкил;

R2 представляет собой

(c) гидроксиС1-C6 алкил,

(d) дигидроксиС2-С6 алкил,

(e) C1-C6 фторалкил, необязательно замещенный OH,

(f) (ди-C1-C6 алкокси)C2-C6 алкил-,

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(h) Cyc1,

(i) Cyc2,

(j) (hetCyc1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(k) (Ar1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(l) (hetAr1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, или

(m) (HOSO3)C1-C6 алкил-;

Cyc1 представляет собой 3-4-членное циклоалкильное кольцо, необязательно замещенное 1-2 заместителями, независимо выбранными из галогена, гидрокси, C1-C3 алкила, гидроксиС1-C3 алкила, C1-C3 алкокси, (C1-C3 алкокси)C1-C3 алкил- и R'R''NC(=O)-;

R' и R'' независимо представляют собой водород или C1-C6 алкил;

Cyc2 представляет собой 5-членное циклоалкильное кольцо, замещенное 1-2 заместителями, независимо выбранными из C1-C3 алкила, (C1-C3 алкокси)C1-C3 алкил- и гидроксиС1-C3 алкил-;

hetCyc1 представляет собой 5-6-членное насыщенное гетероциклическое кольцо, имеющее 1-2 кольцевых гетероатома, независимо выбранных из O, N и SO2, где указанное кольцо необязательно замещено оксо;

Ar1 представляет собой фенил;

hetAr1 представляет собой пиридил;

X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее дополнительный кольцевой атом азота, и R7 представляет собой водород, где G имеет формулу A-2

R6 представляет собой водород, C1-C6 алкил или C3-C6 циклоалкил;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-B, X1 представляет собой CH.

В одном варианте осуществления формулы I-B, X1 представляет собой N.

В одном варианте осуществления формулы I-B, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-B, R1 представляет собой водород.

В одном варианте осуществления формулы I-B, R9 представляет собой водород.

В одном варианте осуществления формулы I-B, R9 представляет собой галоген. В одном варианте осуществления формулы I-B, R9 представляет собой фтор.

В одном варианте осуществления формулы I-B, R1 представляет собой водород, X1 представляет собой CH, R8 представляет собой Ar2, где Ar2 имеет значение, как определено для формулы I-B, и R9 представляет собой фтор.

В одном варианте осуществления формулы I-B, R1 представляет собой водород, X1 представляет собой CH, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

В одном варианте осуществления формулы I-B, R1 представляет собой водород, X1 представляет собой N, R8 представляет собой Ar2, где Ar2 имеет значение, как определено для формулы I-B, и R9 представляет собой водород.

В одном варианте осуществления формулы I-B, R1 представляет собой водород, X1 представляет собой N, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой водород.

В одном варианте осуществления, соединения формулы I включают формулу I-C, где:

X1 представляет собой CH или N;

R1 представляет собой водород;

R2 представляет собой

(c) гидроксиС1-C6 алкил,

(e) C1-C6 фторалкил, необязательно замещенный OH, или

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH;

X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, где G имеет формулу A-3

R6 представляет собой галоген, C1-C6 алкил, C1-C6 алкокси, или C3-C6 циклоалкил;

R7 представляет собой водород;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-C, R9 представляет собой водород.

В одном варианте осуществления формулы I-C, R9 представляет собой галоген. В одном варианте осуществления формулы I-C, R9 представляет собой фтор.

В одном варианте осуществления формулы I-C, X1 представляет собой CH.

В одном варианте осуществления формулы I-C, X1 представляет собой CH и R9 представляет собой галоген. В одном варианте осуществления формулы I-C, X1 представляет собой CH и R9 представляет собой фтор.

В одном варианте осуществления формулы I-C, X1 представляет собой N.

В одном варианте осуществления формулы I-C, X1 представляет собой N и R9 представляет собой водород.

В одном варианте осуществления формулы I-C, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-C, X1 представляет собой CH, R9 представляет собой фтор, и R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-C, X1 представляет собой N, R9 представляет собой водород, и R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления, соединения формулы I включают формулу I-D, где:

X1 представляет собой CH;

R1 представляет собой водород;

R2 представляет собой

(c) гидроксиС1-C6 алкил,

(e) C1-C6 фторалкил, необязательно замещенный OH, или

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH;

R3 отсутствует;

X2 представляет собой N;

X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее два дополнительных кольцевых атома азота, и R7 представляет собой оксо или тиооксо, где G имеет формулу

R6 представляет собой C1-C6 алкил;

Y представляет собой O или S;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-D, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-D, R9 представляет собой галоген. В одном варианте осуществления формулы I-D, R9 представляет собой фтор.

В одном варианте осуществления формулы I-D, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами и R9 представляет собой фтор.

В одном варианте осуществления, соединения формулы I включают формулу I-E, где:

X1 представляет собой CH или N;

R2 представляет собой

(c) гидроксиС1-C6 алкил,

(e) C1-C6 фторалкил, необязательно замещенный OH, или

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH;

X2 представляет собой C, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее кольцевой атом азота, где G имеет формулу A-5

R6 представляет собой C1-C6 алкил;

R7 представляет собой водород;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-E, R1 представляет собой водород.

В одном варианте осуществления формулы I-E, X1 представляет собой CH.

В одном варианте осуществления формулы I-E, X1 представляет собой N.

В одном варианте осуществления формулы I-E, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-E, R9 представляет собой водород.

В одном варианте осуществления формулы I-E, R9 представляет собой фтор.

В одном варианте осуществления формулы I-E, R1 представляет собой водород, X1 представляет собой CH, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

В одном варианте осуществления формулы I-E, R1 представляет собой водород, X1 представляет собой N, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой водород.

В одном варианте осуществления, соединения формулы I включают формулу I-F, где:

X1 представляет собой CH;

R1 представляет собой водород;

R2 представляет собой (c) гидроксиС1-C6 алкил;

X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее два дополнительных кольцевых атома азота, где G имеет формулу A-6

R6 представляет собой водород;

R7 представляет собой водород;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-F, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-F, R9 представляет собой галоген. В одном варианте осуществления формулы I-F, R9 представляет собой фтор.

В одном варианте осуществления формулы I-F, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

В одном варианте осуществления, соединения формулы I включают формулу I-G, где:

X1 представляет собой CH;

R1 представляет собой водород;

R2 представляет собой (c) гидроксиС1-C6 алкил;

X2 представляет собой N, R3 представляет собой водород или метил, и кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее кольцевой атом азота, где G имеет формулу A-7

R6 представляет собой водород и R7 представляет собой водород,

или R6 и R7 находятся у одного и того же атома углерода и R6 и R7 вместе с атомом углерода, к которому они присоединены, образуют циклопропильное кольцо;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-G, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-G, R9 представляет собой галоген. В одном варианте осуществления формулы I-G, R9 представляет собой фтор.

В одном варианте осуществления формулы I-G, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

В одном варианте осуществления, соединения формулы I включают формулу I-H, где:

X1 представляет собой CH;

R1 представляет собой водород;

R2 представляет собой (c) гидроксиС1-C6 алкил;

X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 5-членное гетероциклическое кольцо, имеющее дополнительный кольцевой атом азота, где G имеет формулу A-8

R6 представляет собой C1-C6 алкил;

R7 представляет собой водород или C1-C6 алкил;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-H, R8 представляет собой Ar2. В одном варианте осуществления формулы I-H, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-H, R9 представляет собой галоген. В одном варианте осуществления формулы I-H, R9 представляет собой фтор.

В одном варианте осуществления формулы I-H, R8 представляет собой Ar2, где Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

В одном варианте осуществления, соединения формулы I включают формулу I-I, где:

X1 представляет собой CH;

R1 представляет собой водород;

R2 представляет собой (c) гидроксиС1-C6 алкил;

G представляет собой формулу B-1

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-I, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-I, R9 представляет собой галоген. В одном варианте осуществления формулы I-I, R9 представляет собой фтор.

В одном варианте осуществления формулы I-I, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

В одном варианте осуществления, соединения формулы I включают формулу I-J, где:

X1 представляет собой CH;

R1 представляет собой водород;

R2 представляет собой (c) гидроксиС1-C6 алкил;

G представляет собой формулу B-2

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена, C1-C2 алкила и C1-C2 алкокси;

hetCyc3 представляет собой 5-6-членное гетероциклическое кольцо, имеющее кольцевой атом кислорода; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы I-J, R8 представляет собой Ar2. В одном варианте осуществления, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами.

В одном варианте осуществления формулы I-J, R9 представляет собой галоген. В одном варианте осуществления формулы I-J, R9 представляет собой фтор.

В одном варианте осуществления формулы I-J, Ar2 представляет собой фенил, необязательно замещенный одним или несколькими галогенами, и R9 представляет собой фтор.

Соединения формулы I включают их фармацевтически приемлемые соли. Кроме того, соединения формулы I также включают другие соли таких соединений, которые не обязательно являются фармацевтически приемлемыми солями и которые могут быть полезны в качестве промежуточных соединений для получения и/или очистки соединений формулы I и/или для разделения энантиомеров соединений формулы I. Неограничивающие примеры фармацевтически приемлемых солей соединений формулы I включают хлористоводородные соли.

Кроме того, следует понимать, что соединения формулы I или их соли могут быть выделены в форме сольватов, и, соответственно, любой такой сольват включен в объем настоящего изобретения. Например, соединения формулы I и их соли могут существовать в несольватированных, а также в сольватированных формах с фармацевтически приемлемыми растворителями, такими как вода, этанол и т.п.

В одном варианте осуществления, соединения формулы I включают соединения примеров 1-201 и их стереоизомеры и фармацевтически приемлемые соли и сольваты. В одном варианте осуществления, соединения примеров 1-201 находятся в форме свободного основания. В одном варианте осуществления, одно или несколько соединений примеров 1-201 представляют собой соли хлористоводородной кислоты.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 25, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 37, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 46, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 48, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 55, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 58, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 72, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 76, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 77, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 78, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 83, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 84, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 85, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 91, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 97, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 100, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 103, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 105, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 107, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 108, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 114, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 115, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 119, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 121, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 124, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 125, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 126, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 127, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 129, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 151, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 152, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 163, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 169, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 188, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 190, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 199, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 200, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы I представляет собой соединение примера No. 201, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления соединения формулы I включают соединения формулы II и их стереоизомеры, таутомеры и фармацевтически приемлемые соли, где:

X1 представляет собой CH или N;

R1 представляет собой водород или C1-C6 алкил;

R2 представляет собой

(a) водород,

(b) C1-C6 алкил,

(c) гидроксиС1-C6 алкил,

(d) дигидроксиС2-С6 алкил,

(e) C1-C6 фторалкил, необязательно замещенный OH,

(g) (C1-C6 алкокси)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(h) Cyc1,

(i) Cyc2,

(j) (hetCyc1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(k) (Ar1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH,

(l) (hetAr1)C1-C6 алкил-, где указанная алкильная часть необязательно замещена OH, или

(m) (HOSO3)C1-C6 алкил-;

Cyc1 представляет собой 3-4-членное циклоалкильное кольцо, необязательно замещенное 1-2 заместителями, независимо выбранными из галогена, гидрокси, гидроксиС1-C3 алкила, C1-C3 алкокси, (C1-C3 алкокси)C1-C3 алкил- и R'R''NC(=O)-;

R' и R'' независимо выбраны из C1-C6 алкила;

Cyc2 представляет собой 5-членное циклоалкильное кольцо, замещенное 1-2 заместителями, независимо выбранными из C1-C3 алкила, (C1-C3 алкокси)C1-C3 алкил- и гидроксиС1-C3 алкил-;

hetCyc1 представляет собой 5-6-членное насыщенное гетероциклическое кольцо, имеющее 1-2 кольцевых гетероатома, независимо выбранных из O, N и SO2, где указанное кольцо необязательно замещено оксо;

Ar1 представляет собой фенил;

hetAr1 представляет собой пиридил;

G представляет собой

или ;

X2 представляет собой C или N;

Кольцо A, включая атомы в точках присоединения, представляет собой 5-6-членное гетероциклическое кольцо, необязательно имеющее дополнительные 1-2 кольцевых атома азота, когда X2 представляет собой N, и имеющее один кольцевой атом азота, когда X2 представляет собой C;

R3 представляет собой водород или отсутствует;

R6 представляет собой водород, галоген, C1-C6 алкил, C1-C6 алкокси, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, при условии, что когда R6 представляет собой галоген и находится на кольцевом атоме углерода, смежном с углеродом, связанным с фрагментом -NHC(=O)- формулы I, тогда R6 не является галогеном;

R7 представляет собой водород, C1-C6 алкил, оксо или тиоксо;

hetCyc2 представляет собой 4-членное насыщенное гетероциклическое кольцо, имеющее кольцевой атом азота, замещенный C1-C6 алкилом;

кольцо B, включая атомы в точках присоединения, представляет собой 6-членную насыщенную карбоциклическую группу, необязательно замещенную оксо, или 6-членное ароматическое карбоциклическое кольцо, необязательно замещенное OH;

R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил, hetCyc3 или C1-C6 алкил;

Ar2 представляет собой фенил, необязательно замещенный одним или несколькими заместителями, независимо выбранными из галогена;

hetAr2 представляет собой 5-6-членный гетероарил, имеющий 1-2 кольцевых атома азота и необязательно замещенный одним или несколькими заместителями, независимо выбранными из C1-C2 алкила; и

R9 представляет собой водород или галоген.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее один дополнительный кольцевой атом азота, и R7 представляет собой оксо, так что G имеет формулу A-1

где R6 представляет собой C1-C6 алкил, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, и hetCyc2 и R8 имеют значения, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее дополнительный кольцевой атом азота, и R7 представляет собой водород, так что G имеет формулу A-2

где R6 представляет собой водород, C1-C6 алкил или C3-C6 циклоалкил, R7 представляет собой водород, и R8 имеет значение, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, так что G имеет формулу A-3

где R6 представляет собой галоген, C1-C6 алкил, C1-C6 алкокси, или C3-C6 циклоалкил, R7 представляет собой водород, при условии, что когда R6 находится на кольцевом атоме углерода, смежном с углеродом, связанным с фрагментом -NHC(=O)- формулы II, тогда R6 не является галогеном, и R8 имеет значение, как определено для формулы II. Используемый в настоящем описании термин «кольцевой атом углерода, расположенный рядом с углеродом, связанным с фрагментом -NHC(=O)- формулы II» относится к атому углерода, обозначенному звездочкой в следующей структуре:

.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее два дополнительных кольцевых атома азота, и R7 представляет собой оксо или тиооксо, так что G имеет формулу A-4

где Y представляет собой O или S, R6 представляет собой C1-C6 алкил, и R8 имеет значение, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой C, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее кольцевой атом азота, так что G имеет формулу A-5

где R6 представляет собой C1-C6 алкил, R7 представляет собой водород, и R8 имеет значение, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее два дополнительных кольцевых атома азота, так что G имеет формулу A-6

где R6 и R7 представляют собой водород и R8 имеет значение, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 представляет собой водород или метил, и кольцо A представляет собой 6-членное гетероциклическое кольцо, имеющее кольцевой атом азота, так что G имеет формулу A-7

где R6 и R7 представляют собой водород, и R8 имеет значение, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где X2 представляет собой N, R3 отсутствует, кольцо A представляет собой 5-членное гетероциклическое кольцо, имеющее дополнительный кольцевой атом азота, так что G имеет формулу A-8

где R6 представляет собой C1-C6 алкил, R7 представляет собой водород или C1-C6 алкил, и R8 имеет значение, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где кольцо B и R8 имеют значения, как определено для формулы II.

В одном варианте осуществления формулы II, G представляет собой

где кольцо B представляет собой 6-членную насыщенную карбоциклическую группу, необязательно замещенную оксо.

В одном варианте осуществления формулы II, G имеет формулу B-1

где R8 имеет значение, как определено для формулы II.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 2, 3, 4, 5, 6, 7, 8, 12, 13, 14, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 67, 68, 69, 70, 71, 72, 73, 75, 76, 77, 79, 80, 81, 84, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 128, 142, 144, 145, 146, 147, 148, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 166, 167, 168, 169, 170, 171, 172, 173, 179, 181, 182, 183, 184, 185, 186, 187, 189, 191, 192, 193, 194, 195, 196, или 197, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 2, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 3, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 4, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 5, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 6, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 7, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 8, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 12, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 13, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 14, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 16, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 17 , или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 18, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 19, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 20, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 21, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 22, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 23, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 24, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 25, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 26, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 27, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 28, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 29, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 30, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 31, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 32, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 33, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 34, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 35, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 36, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 37, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 38, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 39, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 40, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 41, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 42, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 43, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 44, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 45, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 46, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 47, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 50, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 51, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 52, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 53, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 54, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 55, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 56, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 57, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 58, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 59, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 60, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 61, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 62, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 63 , или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 64, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 65, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 66, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 67, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 68, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 69, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 70, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 71, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 72 , или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 73, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 74, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 75, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 76, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 77, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 79, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 80, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 81, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 84, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 86, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 87 , или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 88, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 89, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 90, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 91, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 92, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 93, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 94, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 95, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 96, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 97, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 98, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 99, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 100, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 101, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 102, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 103, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 104, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 105, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 106, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 107, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 108, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 109, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 110, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 113, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 114 , или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 115, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 116, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 117, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 118, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 119, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 120, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 121, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 122, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 128, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 142, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 144, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 145, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 146, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 147, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 148, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 150, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 151, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 152, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 153, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 154, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 155, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 156, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 157, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 158, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 159, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 160, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 161, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 162, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 163, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 164, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 166, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 167, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 168, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 169, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 170, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 171, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 172, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 173, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 179, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 181, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 182, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 183, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 184, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 185, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 186, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 187, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 189, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 191, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 192, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 193, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 194, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 195, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 196, или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, соединение формулы II представляет собой соединение примера No. 197, или его фармацевтически приемлемую соль или сольват.

Термин «фармацевтически приемлемый» указывает на то, что соединение, или его соль или композиция химически и/или токсикологически совместимы с другими ингредиентами, составляющими препарат, и/или с пациентом, которого им лечат.

Соединения, представленные в настоящем документе, также могут содержать неестественные пропорции атомных изотопов у одного или нескольких атомов, которые составляют такие соединения. То есть, атом, в частности, когда упоминается в отношении соединения по формуле I, включает все изотопы и смеси изотопов этого атома, встречающиеся в природе или полученные синтетическим путем, либо природного состава, либо в изотопно-обогащенной форме. Например, когда упоминается водород, подразумевается, что он относится к 1H, 2H, 3H или их смесям; когда упоминается углерод, подразумевается, что он относится к 11C, 12C, 13C, 14C или их смесям; когда упоминается азот, подразумевается, что он относится к 13N, 14N, 15N или их смесям; когда упоминается кислород, подразумевается, что он относится к 14O, 15O, 16O, 17O, 18O или их смесям; и когда упоминается фтор, подразумевается, что он относится к 18F, 19F или их смесям. Соединения, представленные в настоящем документе, поэтому также включают соединения с одним или несколькими изотопами одного или нескольких атомов и их смеси, включая радиоактивные соединения, в которых один или несколько нерадиоактивных атомов заменены одним из его обогащенных радиоактивных изотопов. Радиоактивно меченые соединения полезны в качестве дополнительных противораковых средств, например, терапевтических средств для лечения рака, реагентов для исследования, например, аналитических реагентов, и диагностических агентов, например, агентов для визуализации in vivo. Предполагается, что все изотопные варианты соединений, представленных в настоящем документе, радиоактивные или нет, входят в объем настоящего изобретения.

В иллюстративных целях на схемах 1-24 показаны общие способы получения соединений, представленных в настоящем документе, а также ключевых промежуточных соединений. Более подробное описание отдельных стадий реакции см. в разделе «Примеры» ниже. Специалисты в данной области понятно, что для синтеза соединений по изобретению можно использовать другие пути синтеза. Хотя конкретные исходные вещества и реагенты показаны на схемах и описаны ниже, другие исходные вещества и реагенты могут быть легко заменены, для получения множества производных и/или условий реакции. Кроме того, многие соединения, полученные описанными ниже способами, могут быть дополнительно модифицированы в свете этого раскрытия с использованием общепринятой химии, хорошо известной специалистам в данной области.

Схема 1

На схеме 1 показан общий способ получения соединения 5, где R6 и R8 имеют значения, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-1, R7 представляет собой водород и R3 отсутствует.

Диэтил 2-(аминометилен)малонат может взаимодействовать с реагентом, имеющим формулу OCN-R8, где R8 имеет значение, как определено для формулы I, с получением соединения 2. Соединение 2 может быть обработано сильным основанием (например, метоксид натрия) с получением соединения 3. Соединение 3 может взаимодействовать с реагентом, имеющим формулу R6-I, и основанием, таким как K2CO3, где R6 имеет значение, как определено для формулы I, с получением соединения 4. Обработка соединения 4 водной кислотой дает соединение 5.

Схема 2

На схеме 2 показан общий способ получения соединения 7, где R6 представляет собой циклопропил, и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-1, R6 представляет собой циклопропил, R7 представляет собой водород и R3 отсутствует.

Соединение 3, где R8 имеет значение, как определено для формулы I (полученного, как на схеме 1), может быть обработано реагентом, имеющим формулу R6-B(OH)2, где R6 представляет собой циклопропил, в присутствии Cu(OAc)2 и 2,2'-бипиридина с получением соединения 6. Обработка соединения 6 водной кислотой дает соединение 7.

Схема 3

На схеме 3 показан общий способ получения соединения 12, где R6 представляет собой hetCyc2 и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-1, R7 представляет собой водород и R3 отсутствует.

Соединение 3, где R8 имеет значение, как определено для формулы I (полученного, как на схеме 1), может быть обработано реагентом (8), где P1 представляет собой аминозащитную группу (например, Boc), в присутствии основания (например, K2CO3) с получением соединения 9. Защитная группа P1 соединения 9 может быть удалена с получением соединения 10. Соединение 10 может взаимодействовать с реагентом, имеющим формулу RC(=O)H, где R представляет собой C1-C6 алкил, в присутствии восстанавливающего агента (например, NaBH(OAc)3) с получением соединения 11. Соединение 11 может быть обработано водной кислотой с получением соединения 12.

Схема 4

На схеме 4 показан общий способ получения соединения 16, где R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-2, R6 и R7 представляют собой водород и R3 отсутствует.

Соединение 13, где R8 имеет значение, как определено для формулы I, может быть обработано оксалальдегидом в присутствии кислоты с получением соединения 14. Соединение 14 может быть обработано 2,2-диметил-1,3-диоксан-4,6-дионом в присутствии карбоновой кислоты (например, уксусной кислоты) и аминового основания (например, пиперидина) с получением соединения 15. Соединение 15 может быть обработано основанием (например, метоксид натрия) с получением соединения 16.

Схема 5

На схеме 5 показан общий способ получения соединения 19, где R6 представляет собой водород, C1-C6 алкил, C1-C6 алкокси, HOC1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-2, R7 представляет собой водород и R3 отсутствует.

Соединение 17, где R6 представляет собой водород, C1-C6 алкил, C1-C6 алкокси, P2OC1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, и где P2 представляет собой гидроксизащитную группу, может взаимодействовать с реагентом, имеющим формулу H2N-NHR8, где R8 имеет значение, как определено для формулы I, с получением соединения 18, в качестве минорного продукта. Соединение 18 может взаимодействовать с 2,2-диметил-1,3-диоксан-4,6-дионом в присутствии кислоты (например, HOAc) и пиперидина с получением соединения 19, после чего, если R6 представляет собой P2OC1-C6 алкил, защитную группу для гидроксильной группы удаляют.

Схема 6

На схеме 6 показан общий способ получения соединения 22, где R8 имеет значение, как определено для формулы I, и R1 и R2 независимо представляют собой H или C1-C3 алкил, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-3, R6 представляет собой C1-C6 алкил, R7 представляет собой водород и R3 отсутствует.

Соединение 20, где R8 имеет значение, как определено для формулы I, может взаимодействовать с соединением 21a, где R1 и R2 независимо представляют собой H или C1-C3 алкил, в присутствии палладиевого катализатора с получением соединения 21. Соединение 21 может быть обработано гидроксидом лития с получением соединения 22.

Схема 7

На схеме 7 показан общий способ получения соединения 25, где R6 представляет собой C1-C6 алкокси и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-3, R7 представляет собой водород и R3 отсутствует.

Соединение 23, где R6 представляет собой C1-C6 алкокси, может взаимодействовать с реагентом, имеющим формулу R8-I, где R8 имеет значение, как определено для формулы I, в присутствии медного катализатора, основания и хинолинола, с получением соединения 24. Обработка соединения 24 водной кислотой дает соединение 25.

Схема 8

На схеме 8 показан общий способ получения соединения 28, где R6 представляет собой C1-C6 алкил и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-3, R7 представляет собой водород, и R3 отсутствует.

Этил 3-хлор-3-оксопропаноат может взаимодействовать с реагентом R8-NH2, где R8 имеет значение, как определено для формулы I, с получением соединения 26. Соединение 26 может взаимодействовать с реагентом 27, где R6 представляет собой C1-C6 алкил, в присутствии основания (например, этоксид натрия), с получением соединения 28.

Схема 9

На схеме 9 показан общий способ получения соединения 32, где R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-3, R6 представляет собой метил, R7 представляет собой водород и R3 отсутствует.

Диэтил 2-(пропан-2-илиден)малонат может взаимодействовать с реагентом, имеющим формулу R8-NH2, где R8 имеет значение, как определено для формулы I, в присутствии имидазола при повышенных температурах (например, при примерно 200°C), с получением соединения 30. Соединение 30 может взаимодействовать 1,1-диметокси-N, N-диметилметанамином с получением соединения 31. Обработка соединения 32 гидроксидом лития дает соединение 32.

Схема 10

На схеме 10 показан общий способ получения соединения 34, где R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-3, R6 представляет собой C1-C6 алкил, R7 представляет собой водород, и R3 отсутствует.

Соединение 34 может быть получено обработкой соединения 26 (полученного, как на схеме 8), где R8 имеет значение, как определено для формулы I, реагентом 27a, где R6 представляет собой C1-C6 алкил, в присутствии этоксида натрия.

Схема 11

На схеме 11 показан общий способ получения соединения 38, где R8 представляет собой Ar2, hetAr2 или C3-C6 циклоалкил, и R6 представляет собой C3-C6 циклоалкил, и соединения 39, где R8 имеет значение, как определено для формулы I, и X представляет собой Cl или Br, которые являются промежуточными соединениями, используемыми для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-3, R7 представляет собой водород и R3 отсутствует.

Соединение 35, где X представляет собой Cl или Br, может взаимодействовать с бороновой кислотой, имеющей формулу (HO)2B-R8, где R8 представляет собой Ar2, hetAr2, или C3-C6 циклоалкил, в присутствии медного катализатора (например, ацетат меди(II)) и основания (например, пиридин) с получением соединения 36. Соединение 36 может быть обработано соединением, имеющим формулу R6-BF3K, где R6 представляет собой C3-C6 циклоалкил, с получением соединения 37. Обработка соединения 37 гидроксидом лития дает соединение 38. Соединение 39 можно получить обработкой соединения 36 гидроксидом лития.

Схема 12

На схеме 12 показан общий способ получения соединения 43, где R6 представляет собой C1-C6 алкил, C1-C6 алкокси, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2, и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-4, R7 представляет собой тиоксо, и R3 отсутствует.

Диэтил 2-оксомалонат может взаимодействовать с соединением, имеющим формулу 40, где R8 имеет значение, как определено для формулы I, с получением соединения 41. Соединение 41 может быть обработано реагентом, имеющим формулу R6-I, где R6 представляет собой C1-C6 алкил, C1-C6 алкокси, P2O-C1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2 и P2 представляет собой защитную группу для гидроксильной группы, в присутствии основания (например, K2CO3), с получением соединения 42. Обработка соединения 42 водной кислотой дает соединение 43, после чего, если R6 представляет собой P2OC1-C6 алкил, защитную группу для гидроксильной группы удаляют.

Схема 13

На схеме 13 показан общий способ получения соединения 46, где R6 представляет собой C1-C6 алкил, C1-C6 алкокси, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2 и R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-4, R7 представляет собой оксо, и R3 отсутствует.

Соединение 42, полученное согласно схеме 12, может быть обработано перекисью водорода в присутствии кислоты с получением соединения 44. Соединение 44 может быть обработано соединением, имеющим формулу R6-I, где R6 представляет собой C1-C6 алкил, C1-C6 алкокси, P2O-C1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2 и P2 представляет собой гидроксизащитную группу, в присутствии основания (например, K2CO3) с получением соединения 45. Обработка соединения 45 водной кислотой дает соединение 46, после чего, если R6 представляет собой P2OC1-C6 алкил, защитную группу для гидроксильной группы удаляют.

Схема 14

На схеме 14 показан общий способ получения соединения 50, где R6 представляет собой C1-C6 алкил, C1-C6 алкокси, гидроксиС1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2 и R8 представляет собой Ar2, hetAr2 или циклопропил, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-5, R7 представляет собой водород и R3 отсутствует.

Метил 5-бром-4-гидроксиникотинат может быть обработан соединением, имеющим формулу R6-I, где R6 представляет собой C1-C6 алкил, C1-C6 алкокси, P2O-C1-C6 алкил, C3-C6 циклоалкил, (C3-C6 циклоалкил)C1-C6 алкил- или hetCyc2 и P2 представляет собой гидроксизащитную группу, в присутствии основания (например, Cs2CO3) с получением соединения 47. Соединение 47 может быть обработано бороновой кислотой 48, где R8 представляет собой Ar2, hetAr2 или циклопропил, с получением соединения 49. Обработка соединения 49 водной кислотой дает соединение 50, после чего, если R6 представляет собой P2OC1-C6 алкил, защитную группу для гидроксильной группы удаляют.

Схема 15

На схеме 15 показан общий способ получения соединения 58, где R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-6, R6 и R7 представляют собой водород, и R3 отсутствует.

Соединение 51, где R8 имеет значение, как определено для формулы I, может быть обработано формальдегидом и цианидом калия с получением соединения 52. Соединение 52 может быть обработано оксалилдихлоридом с получением соединения 53. Соединение 53 может быть обработано метоксидом натрия с получением соединения 54. Соединение 54 можно восстановить в стандартных условиях гидрирования (например, в атмосфере водорода в присутствии палладиевого катализатора, такого как палладий на угле) с получением соединения 55. Соединение 55 можно превратить в соединение 56 при обработке фосфорилхлоридом. Соединение 56 может быть обработано цианидом цинка в присутствии палладиевого катализатора и лиганда (например, Pd2dba3 и dppf) с получением соединения 57. Нитрильная группа соединения 57 может быть гидролизована обработкой водной кислотой с получением соединения 58.

Схема 16

На схеме 16 показан общий способ получения соединения 59, где R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил или hetCyc3, и соединения 61, где R3 представляет собой C1-C6 алкил, и R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил или hetCyc3, которые являются промежуточными соединениями, используемыми для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-7, R7 представляет собой водород, и R3 представляет собой метил.

Этил 2-оксопиперидин-3-карбоксилат может быть обработан реагентом R8-I, где R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил или hetCyc3, в присутствии иодида меди (I), хинолин-8-ола и основания (например, CsCO3) с получением соединения 58. Соединение 58 можно гидролизовать в основных условиях (например, LiOH) с получением соединения 59.

Альтернативно, соединение 58 может быть обработано соединением, имеющим формулу R3-I, где R3 представляет собой C1-C6 алкил, с получением соединения 60. Соединение 60 можно гидролизовать в основных условиях (например, LiOH) с получением соединения 61.

Схема 17

На схеме 17 показан общий способ получения соединения 65, где R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил или hetCyc3, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-7, R6 и R7 вместе образуют циклопропильное кольцо, и R3 представляет собой водород.

(1-Цианоциклопропил)метил метансульфонат может быть обработан диэтилмалонатом в присутствии гидрида натрия с получением соединения 62. Соединение 62 может подвергаться внутримолекулярной циклизации в присутствии водорода и каталитического количества оксида платины(IV) с получением соединения 63. Соединение 63 может быть обработано соединением, имеющим формулу R8-I, где R8 представляет собой Ar2, hetAr2, C3-C6 циклоалкил или hetCyc3, в присутствии иодида меди (I), хинолин-8-ола и основания (например, Cs2CO3) с получением соединения 64. Соединение 64 можно гидролизовать в основных условиях (например, LiOH) с получением соединения 65.

Схема 18

На схеме 18 показан общий способ получения соединения 70, где R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо A и кольцо A представляет собой A-8, R7 представляет собой водород, и R3 отсутствует.

Диэтил 2-(этоксиметилен)малонат может взаимодействовать с соединением 66, где R8 имеет значение, как определено для формулы I, с получением соединения 67. Соединение 67 может взаимодействовать с соединением 68, где R6 представляет собой C1-C6 алкил, с получением соединения 69. Обработка соединения 69 гидроксидом натрия дает соединение 70.

Схема 19

На схеме 19 показан общий способ получения соединения 72, где R8 имеет значение, как определено для формулы I, которое является промежуточным соединением, используемым для получения соединений формулы I, где G представляет собой кольцо B и кольцо B представляет собой B-1.

Этил (E)-2-циано-3-этоксиакрилат может взаимодействовать с циклогексан-1,3-дионом в присутствии трет-бутоксида калия с получением соединения 71. Соединение 71 может взаимодействовать с реагентом R8-I, где R8 имеет значение, как определено для формулы I, с получением соединения 72.

Схема 20

На схеме 20 показан общий способ получения соединения 79, где R9 имеет значение, как определено для формулы I, и соединения 80, где R9 и R2 имеют значения, как определено для формулы I, которые являются промежуточными соединениями, используемыми для получения соединений формулы I, где X1 представляет собой CH.

Соединение 73, где P3 представляет собой аминозащитную группу (например, пара-метоксибензил; PMB), может взаимодействовать с соединением 74, где R9 имеет значение, как определено для формулы I, в присутствии основания с получением соединения 75. Аминозащитная группа соединения 75 может быть удалена в стандартных условиях (например, TFA) с получением соединения 76. Соединение 76 может быть обработано может быть обработано I2 в присутствии основания (например, KOH) с получением соединения 77. Аминогруппа соединения 77 может быть защищена в стандартных условиях с получением соединения 78, где P3 представляет собой аминозащитную группу (например, пара-метоксибензил; PMB). Нитрогруппа соединения 78 может быть восстановлена в стандартных условиях (например, хлорид олова(II)) с получением соединения 79. Соединение 79 может быть обработано соединением, имеющим формулу H2NR2, где R2 имеет значение, как определено для формулы I, в присутствии CuI, лиганда (например, 1H-пиррол-2-карбоновая кислота), и основания (например, карбонат калия) с получением соединения 80.

Схема 21

На схеме 21 показан общий способ получения соединения 86, где R2 представляет собой водород, C1-C6 алкил, C1-C6 фторалкил, (ди-C1-C6 алкокси)C2-C6 алкил-, (C1-C6 алкокси)C1-C6 алкил-, Cyc1, Cyc2, (hetCyc1)C1-C6 алкил-, (Ar1)C1-C6 алкил-, (hetAr1)C1-C6 алкил- или (HOSO3)C1-C6 алкил-, которое является промежуточным соединением, используемым для получения соединений формулы I где X1 представляет собой N, R9 представляет собой водород, и R2 представляет собой водород, C1-C6 алкил, C1-C6 фторалкил, (ди-C1-C6 алкокси)C2-C6 алкил-, (C1-C6 алкокси)C1-C6 алкил-, Cyc1, Cyc2, (hetCyc1)C1-C6 алкил-, (Ar1)C1-C6 алкил-, (hetAr1)C1-C6 алкил- или (HOSO3)C1-C6 алкил-.

Соединение 81 может быть обработано I2 в присутствии основания (например, KOH) с получением соединения 82. Аминогруппа соединения 82 может быть защищена в стандартных условиях (например, обработкой 1-(хлорметил)-4-метоксибензолом в присутствии основания, например, K2CO3) с получением соединения 83, где P3 представляет собой аминозащитную группу (например, PMB). Соединение 83 может быть обработано 2-хлор-5-гидроксипиридином в присутствии основания (например, Cs2CO3) с получением соединения 84. Соединение 84 может быть обработано реагентом H2NR2, где R2 представляет собой водород, C1-C6 алкил, C1-C6 фторалкил, (ди-C1-C6 алкокси)C2-C6 алкил-, (C1-C6 алкокси)C1-C6 алкил-, Cyc1, Cyc2, (hetCyc1)C1-C6 алкил-, (Ar1)C1-C6 алкил-, (hetAr1)C1-C6 алкил- или (HOSO3)C1-C6 алкил-, в присутствии CuI, лиганда (например, 1H-пиррол-2-карбоновая кислота), и основания (например, карбонат калия) с получением соединения 85. Соединение 85 может быть обработано литий бис(триметилсилил)амидом в присутствии палладиевого катализатора (например, Pd2dba3) и лиганда (например, X-Phos) с получением соединения 86.

Схема 22

На схеме 22 показан общий способ получения соединения 91, где R2 представляет собой гидроксиС1-C6 алкил и P3 представляет собой аминозащитную группу, которое является промежуточным соединением, используемым для получения соединений формулы I, где X1 представляет собой N и R9 представляет собой водород.

Соединение 87 (полученное, как на схеме 21), где P3 представляет собой аминозащитную группу, может быть обработано соединением, имеющим формулу H2NR2, где R2 представляет собой гидроксиС1-C6 алкил, в присутствии CuI, лиганда (например, 1H-пиррол-2-карбоновая кислота), и основания (например, карбонат калия) с получением соединения 88. Гидроксильный фрагмент группы R2 соединения 88 может быть защищена в стандартных условиях (например, обработкой трет-бутилдиметилсилилхлоридом) с получением соединения 89, где R2a представляет собой гидроксиС1-C6 алкил, где гидроксильная группа защищена. Соединение 89 может быть обработано трет-бутилкарбаматом в присутствии палладиевого катализатора (например, Pd2dba3) и лиганда (например, X-Phos) с получением соединения 90. Удаление защитной группы для гидроксильной группы в стандартных условиях дает соединение 91.

Схема 23

На схеме 23 показан общий способ получения соединения 96, которое представляет собой соединение формулы I, где R1, R2, X1, R9 и G имеют значения, как определено для формулы I.

Соединение 92, где R9 и X1 имеют значения, как определено для формулы I, и P3 представляет собой аминозащитную группу, может быть обработано соединением 93, где G имеет значение, как определено для формулы I, в присутствии реагентов для реакций сочетания (например, в присутствии HATU или EDCI/HOBt и диизопропилэтиламина) с получением соединения 94. Соединение 94 может быть обработано реагентом R1R2NH, где R1 и R2 имеют значения, как определено для формулы I, и где, если фрагмент R2 содержит гидроксильную группу, то гидроксильная группа необязательно защищена защитной группой для гидроксильной группы в присутствии иодида меди(I) и либо в присутствии основания (например, K2CO3) и 1H-пиррол-2-карбоновой кислоты, или в присутствии лиганда (например, N1,N2-диметилэтан-1,2-диамин) и основания (например, K3PO4) с получением соединения 95. Удаление аминозащитной группы и гидроксильной группы, если они есть, в стандартных условиях (например, трифторуксусная кислота) дает соединение 96. В вариантах осуществления, где G представляет собой B-1 (например, как на схеме 19), соединение 95, в котором G представляет собой B-2, образуется в качестве побочного продукта окисления во время стадии реакции превращения соединения 94 в соединение 95.

Схема 24

На схеме 24 показан альтернативный общий способ получения соединения 96, которое представляет собой соединение формулы I, где R1, R2, X1, R9 и G имеют значения, как определено для формулы I.

Соединение 92, где R9 и X1 имеют значения, как определено для формулы I, и P3 представляет собой аминозащитную группу, может быть обработано реагентом, имеющим формулу R1R2NH, где R1 и R2 имеют значения, как определено для формулы I, и где, если фрагмент R2 содержит гидроксильную группу, то гидроксильная группа необязательно защищена защитной группой для гидроксильной группы, в присутствии иодида меди(I) и либо в присутствии основания (например, K2CO3) и 1H-пиррол-2-карбоновой кислоты, либо в присутствии лиганда (например, N1,N2-диметилэтан-1,2-диамин) и основания (например, K3PO4), с получением соединения 97. Соединение 97 может быть обработано соединением 93, где G имеет значение, как определено для формулы I, в присутствии реагентов для реакций сочетания (например, в присутствии HATU или EDCI/HOBt и диизопропилэтиламина) с получением соединения 95. Удаление аминозащитной группы и гидроксильной группы, если присутствуют, в стандартных условиях (например, трифторуксусная кислота) дает соединение 96.

Термин «аминозащитная группа», используемый в настоящем документе, относится к производному групп, обычно используемых для блокирования или защиты аминогруппы, пока реакции проводят на других функциональных группах соединения. Примеры подходящих защитных групп для использования в любом из способов, описанных в настоящем документе, включают карбаматы, амиды, алкильные и арильные группы, имины, а также многие производные N-гетероатома, которые можно удалить для регенерации желаемой аминогруппы. Неограничивающими примерами аминозащитных групп являются пара-метоксибензил (PMB), трет-бутилоксикарбонил (“Boc”), бензилоксикарбонил (“CBz”) и 9-флуоренилметиленоксикарбонил (“Fmoc”). Дополнительные примеры таких групп находятся в T.W. Greene, et al., Greene’s Protective Groups in Organic Synthesis. New York: Wiley Interscience, 2006.

Гидроксильные группы могут быть защищены любой подходящей защитной группой для гидроксила, например, как описано в T.W. Greene, et al., Greene’s Protective Groups in Organic Synthesis. New York: Wiley Interscience, 2006. Примеры включают бензиловый, тритиловый, силиловый эфиры и тому подобное.

В одном варианте осуществления, в настоящем документе представлен способ получения соединения Формулы I, включающий:

(a) взаимодействие соединения, имеющего формулу

где X1, N, и R9 имеют значения, как определено для формулы I, и P3 представляет собой аминозащитную группу, с реагентом, имеющим формулу R1R2NH, где R1 и R2 имеют значения, как определено для формулы I, и где, если фрагмент R2 содержит гидроксильную группу, то гидроксильная группа необязательно защищена защитной группой для гидроксильной группы, в присутствии иодида меди(I) и или в присутствии основания и 1H-пиррол-2-карбоновой кислоты, или в присутствии лиганда и основания, с последующим удалением аминозащитной группы и удалением гидроксильной группы, если присутствует; или

(b) взаимодействие соединения, имеющего формулу:

где R9 и X1 имеют значения, как определено для формулы I, P3 представляет собой аминозащитную группу, и R1 и R2 имеют значения, как определено для формулы I, где, если фрагмент R2 содержит гидроксильную группу, то гидроксильная группа необязательно защищена защитной группой для гидроксильной группы, с реагентом, имеющим формулу

где G имеет значение, как определено для формулы I, в присутствии реагентов для реакций сочетания, с последующим удалением аминозащитной группы и удалением гидроксильной группы, если присутствует; и

необязательно образование его фармацевтически приемлемой соли.

Соединения формулы I или их фармацевтически приемлемые соли могут модулировать или ингибировать активность одной или нескольких киназ ТАМ. Способность соединений формулы I действовать как ингибиторы одной или нескольких киназ ТАМ может быть продемонстрирована с помощью анализов, описанных в примерах A, B и C. Значения IC50 показаны в таблицах в примерах.

Соединения формулы I или их фармацевтически приемлемые соли могут модулировать или ингибировать активность киназы c-Met. Способность соединений формулы I действовать как ингибиторы киназ c-Met дикого типа и некоторых мутантных форм может быть продемонстрирована с помощью анализа, описанного в примере D. Значения IC50 показаны в таблице 9.

Используемый в настоящем документе термин «киназа ТАМ» относится к одному, двум или всем трем рецепторным тирозинкиназам ТАМ, т.е., TYRO3, AXL и MER.

Используемый в настоящем документе термин «ингибитор киназы ТАМ» относится к любому соединению, проявляющему ингибирующую активность в отношении одной, двух или всех трех рецепторных киназ ТАМ, т.е. соединения проявляют ингибирующую активность в отношении AXL, и/или MER, и/или TYRO3.

Используемый в настоящем документе термин «ингибитор киназы c-Met» относится к любому соединению, проявляющему ингибирующую активность против киназ c-Met дикого типа или определенных мутантных киназ c-Met. В одном варианте осуществления, термин «ингибитор c-met-киназы» относится к любому соединению, проявляющему ингибирующую активность в отношении киназы c-Met дикого типа или мутантной киназы c-Met, выбранной из Del14, D1228H, D1228N, F1200I, L1195V, Y1230C, Y1230H и Y1230S.

В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли обладают ингибирующей активностью против AXL. В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли обладают ингибирующей активностью против MER. В некоторых вариантах осуществления соединение формулы I обладает ингибирующей активностью против AXL и MER. В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли обладают ингибирующей активностью против AXL, MER и TYRO3. В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемые соли обладают ингибирующей активностью в отношении киназы c-Met. В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемые соли обладают ингибирующей активностью в отношении одной или нескольких рецепторных тирозинкиназ, выбранных из AXL, MER, TYRO3 и c-Met. В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемые соли обладают ингибирующей активностью в отношении киназы c-Met, которая не включает аминокислоты, кодируемые экзоном 14. В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемые соли обладают ингибирующей активностью в отношении мутированного c-Met (например, любого из примеров мутированных белков c-Met, описанных в настоящем документе или известных в настоящей области) (например, мутации в c-Met, которая вызывает резистентность к ингибитору c-Met I типа).

В одном варианте осуществления, соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) против ТАМ-киназы и/или c-Met менее примерно 1000 нМ, менее примерно 500 нМ, менее примерно 200 нМ, менее примерно 100 нМ, менее примерно 50 нМ, менее примерно 25 нМ, менее примерно 10 нМ или менее примерно 1 нМ, как измерено в анализе, как описано в настоящем документе. В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) в отношении киназы ТАМ и/или c-Met менее примерно 25 нМ, менее примерно 10 нМ, менее примерно 5 нМ или менее примерно 1 нМ, как измерено в анализе, как представлено в настоящем документе.

В одном варианте осуществления, иллюстративные соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) против AXL менее примерно 50 нМ, менее примерно 25 нМ, менее примерно 10 нМ или менее примерно 1 нМ, как измерено в анализе, как описано в настоящем документе.

В одном варианте осуществления, соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) в отношении MER менее чем примерно менее примерно 200 нМ, менее примерно 100 нМ, менее примерно 50 нМ, менее примерно 25 нМ, менее примерно 10 нМ или менее примерно 1 нМ, как измерено в анализе, как описано в настоящем документе. В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) против MER менее примерно 25 нМ, менее примерно 10 нМ, менее примерно 5 нМ или менее примерно 1 нМ, как измерено в анализе, как представлено в настоящем документе.

В одном варианте осуществления, соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) против TYRO3 менее примерно 1000 нМ, менее примерно 750 нМ, менее примерно 500 нМ, менее примерно 250 нМ, менее примерно 200 нМ, менее чем примерно 100 нМ, менее примерно 50 нМ, менее примерно 25 нМ, менее примерно 10 нМ или менее примерно 1 нМ, как измерено в анализе, как описано в настоящем документе.

В одном варианте осуществления, соединения формулы I или их фармацевтически приемлемые соли проявляют ингибирующую активность (IC50) против c-Met менее примерно 1000 нМ, менее примерно 750 нМ, менее примерно 500 нМ, менее примерно 250 нМ, менее примерно 200 нМ, менее примерно 100 нМ, менее примерно 50 нМ, менее примерно 25 нМ, менее примерно 10 нМ или менее примерно 1 нМ, как измерено в анализе, как описано в настоящем документе.

В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли ингибируют все три киназы ТАМ (т.е., AXL, MER и TYRO3) примерно с 5-кратной разницей.

В некоторых вариантах осуществления соединения формулы I или их фармацевтически приемлемые соли являются селективными в отношении AXL по сравнению с MER. В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемая соль проявляет по меньшей мере 2-кратную селективность; по меньшей мере 3-кратную селективность; по меньшей мере 4-кратную селективность; по меньшей мере 5-кратную селективность; по меньшей мере 6-кратную селективность; по меньшей мере 7-кратную селективность; по меньшей мере 8-кратную селективность; по меньшей мере 9-кратную селективность; по меньшей мере 10-кратную селективность; по меньшей мере 11-кратную селективность; по меньшей мере 12-кратную селективность; по меньшей мере 13-кратную селективность; по меньшей мере 14-кратную селективность; по меньшей мере 15-кратную селективность; по меньшей мере 20-кратную селективность; по меньшей мере 25-кратную селективность; по меньшей мере 30-кратную селективность; по меньшей мере 35-кратную селективность; по меньшей мере 40-кратную селективность; по меньшей мере 45-кратную селективность; по меньшей мере 50-кратную селективность; или по меньшей мере 55-кратную селективность, к AXL по сравнению с MER. В некоторых вариантах осуществления селективность в отношении AXL и MER измеряют с помощью ферментного анализа (например, ферментного анализа, как представлено в настоящем документе.

В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемая соль проявляет по меньшей мере 5-кратную селективность; по меньшей мере 10-кратную селективность; по меньшей мере 15-кратную селективность; по меньшей мере 20-кратную селективность; по меньшей мере 25-кратную селективность; по меньшей мере 30-кратную селективность; по меньшей мере 35-кратную селективность, по меньшей мере 40-кратную селективность; по меньшей мере 50-кратную селективность; по меньшей мере 60-кратную селективность; по меньшей мере 70-кратную селективность; по меньшей мере 80-кратную селективность; по меньшей мере 90-кратную селективность; по меньшей мере 100-кратную селективность; по меньшей мере 125-кратную селективность; по меньшей мере 150-кратную селективность; или по меньшей мере 200-кратную селективность, к AXL по сравнению с TYRO3. В некоторых вариантах осуществления селективность в отношении AXL и TYRO3 измеряют с помощью ферментного анализа (например, ферментного анализа, как представлено в настоящем документе).

В некоторых вариантах осуществления соединения формулы I или его фармацевтически приемлемые соли проявляют по меньшей мере 5-кратную селективность; по меньшей мере 10-кратную селективность; по меньшей мере 15-кратную селективность; по меньшей мере 20-кратную селективность; по меньшей мере 25-кратную селективность; по меньшей мере 30-кратную селективность; по меньшей мере 35-кратную селективность; или по меньшей мере 40-кратную селективность; к MER по сравнению с TYRO3. В некоторых вариантах осуществления селективность в отношении MER и TYRO3 измеряют с помощью ферментного анализа (например, ферментного анализа, как представлено в настоящем документе.

В некоторых вариантах осуществления в настоящем документе предложен способ ингибирования киназы AXL, который включает приведение в контакт киназы AXL с соединением формулы I или его фармацевтически приемлемой солью.

В некоторых вариантах осуществления в настоящем документе предложен способ ингибирования киназы MER, который включает приведение в контакт киназы MER с соединением формулы I или его фармацевтически приемлемой солью.

В некоторых вариантах осуществления в настоящем документе предложен способ ингибирования киназы TYRO3, который включает приведение в контакт киназы TYRO3 с соединением формулы I или его фармацевтически приемлемой солью.

В некоторых вариантах осуществления в настоящем документе предложен способ ингибирования киназы c-Met (например, любой из типичных киназ c-Met, описанных в настоящем документе), который включает приведение в контакт киназы c-Met с соединением формулы I или его фармацевтически приемлемой солью.

Соединения формулы I или их фармацевтически приемлемые соли являются полезными при лечении различных заболеваний, связанных с повышенной (например, по меньшей мере 1%, по меньшей мере 2%, по меньшей мере 4%, по меньшей мере 6%, по меньшей мере 8%, по меньшей мере 10%, по меньшей мере 12%, по меньшей мере 14%, по меньшей мере 16%, по меньшей мере 18%, по меньшей мере 20%, по меньшей мере 25%, по меньшей мере 30%, по меньшей мере 35%, по меньшей мере 40%, по меньшей мере 45%, по меньшей мере 50%, по меньшей мере 55%, по меньшей мере 60%, по меньшей мере 65%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 100%, по меньшей мере 110%, по меньшей мере 120%, по меньшей мере 130%, по меньшей мере 140%, по меньшей мере 150%, по меньшей мере 160%, по меньшей мере 170%, по меньшей мере 180%, по меньшей мере 190%, по меньшей мере 200%, по меньшей мере 210%, по меньшей мере 220%, по меньшей мере 230%, по меньшей мере 240%, по меньшей мере 250%, по меньшей мере 260%, по меньшей мере 270%, по меньшей мере 280%, по меньшей мере 290% или по меньшей мере 300%) экспрессией, уровнем и/или активностью одной или нескольких киназ ТАМ и/или киназы c-Met (например, в раковой клетке или в иммунной клетке) (например, по сравнению с контролем, например, нераковой тканью или клеткой, или соответствующей тканью или клеткой от контрольного субъекта, у которого нет ракового заболевания). В одном варианте осуществления, соединения формулы I или их фармацевтически приемлемые соли являются полезными при лечении или профилактике пролиферативных нарушений, таких как рак. В одном варианте осуществления, опухоли с активирующей мутацией (например, точечная мутация или хромосомная транслокация) в гене, кодирующем рецепторную тирозинкиназу, и/или повышающей экспрессию рецепторной тирозинкиназы (например, любой из киназ ТАМ или c-Met-киназы, описанных в настоящем документе) могут быть особенно чувствительны к соединениям формулы I. В одном варианте осуществления, опухоли с мутацией в гене MET, которая приводит к пропуску экзона 14 во время сплайсинга мРНК, чувствительны к соединениям формулы I. В одном варианте осуществления, опухоли, имеющие мутацию в гене MET, которая приводит к экспрессии белка c-Met, имеющего резистентность к ингибитору c-Met типа I, чувствительны к соединениям формулы I.

Используемые в настоящем документе термины «лечить» или «лечение» относятся к терапевтическим или паллиативным мерам. Благоприятные или желаемые клинические результаты включают, но не ограничиваются ими, облегчение, полностью или частично, симптомов, связанных с заболеванием, или расстройством, или состоянием, уменьшение степени заболевания, стабилизацию (т.е. не ухудшение) состояния заболевания, задержку или замедление прогрессирования заболевания, улучшение или временное облегчение болезненного состояния (например, одного или нескольких симптомов заболевания) и ремиссию (частичнаую или полную), обнаруживаемая или необнаруживаемая. «Лечение» также может означать увеличение выживаемости по сравнению с ожидаемой выживаемостью при отсутствии лечения.

Используемые в настоящем документе термины «субъект», «индивидуум» или «пациент» используются взаимозаменяемо и относятся к любому животному, включая млекопитающих, таких как мыши, крысы, другие грызуны, кролики, собаки, кошки, свиньи, крупный рогатый скот, овцы, лошади, приматы и человек. В некоторых вариантах осуществления пациент представляет собой человека. В некоторых вариантах осуществления субъект перенес и/или у него обнаружен по меньшей мере один симптом заболевания или расстройства, подлежащего лечению и/или профилактике. В некоторых вариантах осуществления у субъекта было определено или диагностировано ТАМ-ассоциированное заболевание или расстройство (например, ТАМ-ассоциированный рак) и/или было определено или диагностировано c-Met-ассоциированное заболевание или расстройство (например, c-Met-ассоциированный рак) (например, как определено с использованием одобренного регулирующим органом, например, одобренного FDA, анализа или набора). В некоторых вариантах осуществления у субъекта был определен или диагностирован рак, связанный с одной или несколькими киназами ТАМ и/или киназой c-Met (например, TAK-ассоциированный рак) (например, как определено с использованием одобренного регулирующим органом, например, одобренного FDA, анализа или набора). В некоторых вариантах осуществления субъект имеет опухоль, связанной с одной или несколькими киназами ТАМ и/или киназой c-Met (например, увеличение экспрессии, уровня и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met в клетке (например, раковая клетка или иммунная клетка) по сравнению с контролем, например, нераковой тканью или соответствующей тканью от контрольного субъекта, у которого нет ракового заболевания (например, как определено с использованием анализа или набора, одобренного регулирующим органом). В некоторых вариантах осуществления у субъекта подозревается наличие TAM-ассоциированного рака и/или c-Met-ассоциированного рака. В некоторых вариантах осуществления у субъекта есть история болезни, указывающая, что субъект имеет опухоль, связанной с одной или несколькими киназами ТАМ (например, TAM-ассоциированный рак) и/или киназой c-Met (и, возможно, в истории болезни указано, что субъекта следует лечить любой из композиций, представленных в настоящем описании). В некоторых вариантах осуществления пациент является педиатрическим пациентом.

Термин «педиатрический пациент», используемый в настоящем описании, относится к пациенту в возрасте до 21 года на момент постановки диагноза или лечения. Термин «педиатрический» можно далее разделить на различные субпопуляции, включая: новорожденных (от рождения до первого месяца жизни); младенцы (от 1 месяца до двух лет); ребенок (от двух лет до 12 лет); и подростки (от 12 до 21 года (до двадцать второго дня рождения, но не включая)). Berhman RE, Kliegman R, Arvin AM, Nelson WE. Nelson Textbook of Pediatrics, 15th Ed. Philadelphia: W.B. Saunders Company, 1996; Rudolph AM, et al. Rudolph’s Pediatrics, 21st Ed. New York: McGraw-Hill, 2002; and Avery MD, First LR. Pediatric Medicine, 2nd Ed. Baltimore: Williams & Wilkins; 1994. В некоторых вариантах осуществления педиатрический пациент представляет собой пациента от рождения до первых 28 дней жизни, от 29 дней до возраста менее двух лет, от двух до менее 12 лет или от 12 лет до 21 года (до двадцать второго дня рождения, но не включая). В некоторых вариантах осуществления педиатрический пациент представляет собой пациента от рождения до первых 28 дней жизни, от 29 дней до возраста менее 1 года, от одного месяца до возраста менее четырех месяцев, от трех месяцев до менее семи месяцев возраста, от шести месяцев до менее 1 года, от 1 года до менее 2 лет, от 2 лет до менее 3 лет, от 2 лет до менее семь лет, от 3 до менее 5 лет, от 5 до менее 10 лет, от 6 лет до менее 13 лет, от 10 лет до менее 15 лет или от 15 лет до менее 22 лет.

Фраза «терапевтически эффективное количество» означает количество соединения, которое при введении пациенту, нуждающемуся в таком лечении, является достаточным для (i) лечения заболевания или расстройства, ассоциированного с ТАМ-киназой (например, TAM-ассоциированный рак) и/или заболевания или расстройства, ассоциированного с c-Met киназой (например, MET-ассоциированный рак), (ii) смягчения, улучшения или устранения одного или нескольких симптомов конкретного заболевания, состояния или расстройства, или (iii) задержки появления одного или нескольких симптомов конкретного заболевания, состояния или расстройства, описанного в данном документе. Количество соединения формулы I, которое будет соответствовать такому количеству, будет варьироваться в зависимости от таких факторов, как конкретное соединение, состояние заболевания и его тяжесть, идентификационные характеристики (например, масса) пациента, нуждающегося в лечении, но тем не менее может быть определено обычным образом специалистом в данной области.

Термин «регулирующий орган» относится к агентству страны по разрешению медицинского использования фармацевтических средств в стране. Например, неограничивающим примером регулирующего органа является Управление США по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA).

Термин «TAM-ассоциированное заболевание или расстройство», используемый в настоящем описании, относится к заболеваниям или расстройствам, связанным с или имеющим повышенную экспрессию и/или активность одной или нескольких киназ ТАМ в клетке (например, раковой клетке или иммунной клетке) (например, по сравнению с контролем, например, нераковой тканью или клеткой, или соответствующей тканью или клеткой от контрольного субъекта, у которого нет ракового заболевания) и/или где активация киназы ТАМ, экспрессируемой на нераковых клетках, способствует заболеванию. Неограничивающие примеры ТАМ-ассоциированного заболевания или расстройства включают, например, рак (ТАМ-ассоциированный рак), например, любой из видов рака, описанных в настоящем документе. В одном варианте осуществления, заболевание представляет собой рак, который сверхэкспрессирует одну или несколько киназ ТАМ после лечения по меньшей мере одним дополнительным противораковым средством (например, одним или несколькими дополнительными противораковыми средствами, описанными в настоящем документе), например, терапевтическим средством, нацеленным на киназу, и/или химиотерапевтическим средством, как описано в настоящем документе). В одном варианте осуществления заболевание связано с передачей сигналов через одну или несколько киназ ТАМ, экспрессируемых в клетках иммунной системы (например, иммунные клетки, выбранные из группы опухоль-ассоциированных макрофагов, естественных клеток-киллеров (NK) и подмножеств опухолеассоциированных дендритных клеток), где экспрессия одной или нескольких киназ ТАМ в иммунных клетках может ограничивать способность иммунной системы пациента вызывать эффективный противоопухолевый ответ.

Термин “TAM-ассоциированный рак”, используемый в настоящем описании, относится к раковым заболеваниям, связанным или имеющим повышенную экспрессию и/или активность одной или нескольких киназ ТАМ в раковой клетке или иммунной клетке (например, по сравнению с контролем, например, нераковой тканью или клеткой, или соответствующей тканью или клеткой от контрольного субъекта, у которого нет ракового заболевания). Неограничивающие примеры TAM-ассоциированного рака описаны в настоящем документе. В некоторых вариантах осуществления TAM-ассоциированный рак представляет собой рак, имеющий хромосомную транслокацию, которая приводит к экспрессии слитого белка TMEM87B-MERTK (например, аминокислоты 1-55 TMEM87B и аминокислоты 433-1000 MERTK) или слитого белка AXL-MBIP. Описание примерной хромосомной транслокации, которая приводит к экспрессии слитого белка TMEM87B-MERTK предоставлено в Shaver et al. (Cancer Res. 76(16):4850-4860, 2016). Описание примерной хромосомной транслокации, которая приводит к экспрессии слитого белка AXL-MBIP предоставлено в Seo et al. (Genome Res. 22:2109-2119, 2012). Хромосомные транслокации или результирующая экспрессия слитых белков TMEM87B-MERTK или AXL-MBIP могут быть обнаружены с помощью гибридизации in situ (например, флуоресцентной гибридизации in situ (FISH)). Хромосомные транслокации, которые приводят к экспрессии TMEM87B-MERTK или AXL-MBIP, могут быть обнаружены путем секвенирования ДНК из образца, полученного от субъекта (например, крови, плазмы, мочи, спинномозговой жидкости, слюны, мокроты, бронхоальвеолярного лаважа, желчи, лимфатической жидкости, жидкости кисты, кала асцита или биопсии опухоли, полученных от субъекта). Примеры способов, которые можно использовать для секвенирования ДНК, известны в данной области и включают, например, секвенирование следующего поколения (NGS), традиционную ПЦР, цифровую ПЦР и микроматричный анализ. Дополнительные способы, которые можно использовать для обнаружения хромосомных транслокаций, которые приводят к экспрессии слитых белков TMEM87B-MERTK или AXL-MBIP или к экспрессии слитых белков TMEM87B-MERTK или AXL-MBIP, известны в данной области.

Термин «заболевание или расстройство, ассоциированное с c-Met», используемый в настоящем описании, относится к заболеваниям или расстройствам, связанным или имеющим повышенную экспрессию, уровень и/или активность киназы c-Met в клетке (например, раковой клетке или иммунной клетке) (например, по сравнению с контролем, например, нераковой тканью или клеткой, или соответствующей тканью или клеткой от контрольного субъекта, у которого нет ракового заболевания) и/или при которых активация c-Met киназы, экспрессируемой в нераковых клетках, способствует развитию заболевания. Неограничивающие примеры заболевания или расстройства, ассоциированного с c-MET, включают, например, рак (c-Met-ассоциированный рак), например, любой из видов рака, описанных в настоящем документе. В одном варианте осуществления, заболевание представляет собой рак, который сверхэкспрессирует киназу c-Met после лечения по меньшей мере одним дополнительным противораковым средством (например, одним или несколькими дополнительными противораковыми средствами, описанными в настоящем документе), например, терапевтическим средством, нацеленным на киназу, и/или химиотерапевтическое средство, как описано в настоящем документе). В некоторых вариантах осуществления заболевание представляет собой рак, который имеет более высокий уровень белка киназы c-Met (например, из-за мутации в гене MET, которая приводит к снижению протеасомной деградации киназы c-MET в клетке млекопитающего). В некоторых вариантах осуществления заболевание представляет собой рак, который имеет более высокий уровень активности киназы c-Met из-за активирующей мутации в гене c-Met (например, любой из активирующих мутаций в гене c-Met, описанных в настоящем документе) или увеличения экспрессии киназы c-Met в клетке млекопитающего. В некоторых вариантах осуществления заболевание представляет собой рак, который экспрессирует киназу c-Met, которая устойчива (например, по меньшей мере до некоторой степени по сравнению с киназой c-Met дикого типа) к ингибитору c-Met типа I.

Рецепторные тирозинкиназы (RTK) представляют собой белки клеточной поверхности, которые передают сигналы из внеклеточной среды в цитоплазму и ядро клетки для регулирования таких клеточных событий, как выживание, рост, пролиферация, дифференцировка, адгезия и миграция. Все RTK содержат внеклеточный лиганд-связывающий домен и цитоплазматический протеинтирозинкиназный домен. Связывание лиганда приводит к димеризации RTK, которая запускает активацию цитоплазматической киназы и инициирует пути передачи нисходящего сигнала ниже по течению. RTK можно классифицировать на отдельные подсемейства на основе их сходства последовательностей.

Рецепторные тирозинкиназы TAM (TYRO3, AXL (также известная как UFO) и MER) представляют собой новый класс врожденных иммунных контрольных точек, которые участвуют в ключевых этапах противоопухолевого иммунитета (Akalu, T, et al., Immunological Reviews 2017; 276:165-177). Киназы ТАМ характеризуются внеклеточным лиганд-связывающим доменом, состоящим из двух иммуноглобулин-подобных доменов и двух доменов фибронектина типа III. Два лиганда, специфичный для остановки роста 6 (GAS6) и белок S (ProS), были идентифицированы для киназ ТАМ. GAS6 может связываться со всеми тремя киназами ТАМ и активировать их, в то время как ProS является лигандом для MER и TYRO3 (Graham et al., 2014, Nature reviews Cancer 14, 769-785).

Киназы ТАМ эктопически экспрессируются или сверхэкспрессируются при большом количестве видов рака, включая злокачественные новообразования молочной железы, толстой кишки, почек, кожи, легких, печени, головного мозга, яичников, предстательной железы и щитовидной железы (Graham et al., 2014, Nature Reviews Cancer 14, 769-785; и Linger et al., 2008, Oncogene 32, 3420-3431) и играют важную роль в инициировании и поддержании опухоли. При активации AXL и MER могут регулировать выживаемость, пролиферацию, миграцию и инвазию опухолевых клеток, ангиогенез и взаимодействия опухоль-хозяин (Schoumacher, M. et al., Curr. Oncol. Rep. 2017; 19(3);19). Соответственно, блокирование передачи сигналов ТАМ может способствовать задействованию адаптивного иммунитета и блокаде контрольных точек Т-клеток комплемента (Akalu, T, et al., Immunological Reviews 2017; 276:165-177). Таким образом, ингибирование TAM представляет собой привлекательный подход для таргетирования другого класса онкогенных RTK (Graham et al., 2014, Nature Reviews Cancer 14, 769-785; and Linger et al., 2008, Oncogene 32, 3420-3431).

AXL был первоначально идентифицирован как трансформирующий ген из ДНК пациентов с хроническим миелогенным лейкозом (O'Bryan et al., 1991, Molecular and Cellular Biology 11, 5016-5031). GAS6 связывается с AXL и вызывает последующее автофосфорилирование и активацию тирозинкиназы AXL. AXL активирует несколько нисходящих сигнальных путей, включая PI3K-Akt, Raf-MAPK, PLC-PKC (Feneyrolles et al., 2014, Molecular Cancer Therapeutics 13, 2141-2148; Linger et al., 2008, Oncogene 32, 3420-3431). Сверхэкспрессия или сверхактивация белка AXL коррелировала со стимулированием множественных онкогенных процессов. Высокие уровни экспрессии AXL связаны с плохим прогнозом при различных формах рака, таких как мультиформная глиобластома (Hutterer, M., et al., Clin. Caner Res. 2008, 14, 130-138), рак молочной железы (Wang, X., Cancer Res. 2013, 73, 6516-6525), рак легких (Niederst, M. et al, Sci. Signaling, 2013, 6, re6), остеосаркома (Han, J., Biochem. Biophys. Res. Commun. 2013, 435, 493-500), и острый миелоидный лейкоз (Ben-Batalla, L., et al., Blood 2013, 122, 2443-2452). AXL сверхэкспрессируется или амплифицируется при различных злокачественных новообразованиях, включая рак легких, рак предстательной железы, рак толстой кишки, рак молочной железы, меланому и почечно-клеточную карциному (Linger et al., 2008, Oncogene 32, 3420-3431), и сверхэкспрессия AXL коррелирует с плохим прогнозом (Linger et al., 2008, Oncogene 32, 3420-3431). Активация AXL способствует выживанию, пролиферации, ангиогенезу, метастазированию раковых клеток и резистентность к химиотерапии и таргетной терапии. Нокдаун AXL или антитело к AXL могут ингибировать миграцию рака груди и рака NSCLC in vitro и блокировать рост опухоли в ксенотрансплантатных моделях опухоли (Li et al., 2009, Oncogene 28, 3442-3455). В клетках рака поджелудочной железы ингибирование AXL снижает пролиферацию и выживаемость клеток (Koorstra et al., 2009, Cancer Biology & Therapy 8, 618-626). При раке предстательной железы ингибирование AXL снижает миграцию, инвазию и пролиферацию клеток (Tai et al., 2008, Oncogene 27, 4044-4055). При трижды негативном раке молочной железы пациенты обычно представляют собой серьезную клиническую проблему, поскольку они не реагируют на различные таргетные методы лечения рака из-за очевидного отсутствия активации RTK. Тем не менее, пациенты с трижды негативным раком молочной железы действительно демонстрируют некоторую реакцию на химиотерапию на основе таксана, и исследования показали, что сочетание антимитотических препаратов (например, доцетаксела) с ингибитором AXL сенсибилизирует раковые клетки к антимитотическому препарату, и AXL в комбинации с антимитотическим препаратом может быть подходящей комбинированной терапией при этом заболевании ( Wilson, et al., Cancer Res. 2014, 74(20), 5878-5890).

ТАМ-киназы могут вносить вклад в терапевтическую резистентность, по меньшей мере, с помощью трех механизмов: внутренней передачи сигналов выживания в опухолевых клетках, индукции ТАМ-киназ в качестве механизма ускользания для опухолей, которые лечили онкоген-целевыми средствами, и иммуносупрессии в микроокружении опухоли (Graham, et al, Nature Reviews Cancer, 2014, 14, 769-785).

Было обнаружено, что киназы ТАМ способствуют устойчивости к цитотоксической химиотерапии (химиорезистентность) лейкозных клеток и клеток солидных опухолей (Graham, et al, Nature Reviews Cancer, 2014, 14, 769-785). Было обнаружено, что трансгенные лимфоциты, эктопически экспрессирующие MER, более устойчивы к дексаметазону, чем лимфоциты дикого типа (Keating, A.K., et al., Oncogene, 2006, 25, 6092-6100), и стимуляция B-ALL клеток с помощью GAS6 увеличивала резистентность к цитарабину (Shiozawa, Y., et al., Neoplasia, 2010, 12, 116-127). AXL индуцируется в клетках острого миелоидного лейкоза (AML), которое лечили с помощью цитотоксических химиотерапий, и опосредует повышенную химиорезистентность (Hong, C.C., et al., Cancer Lett., 2008, 268, 314-324). Устойчивые к химиотерапии линии клеток хронического миелоидного лейкоза (ХМЛ) имеют повышенные уровни AXL, и shRNA-опосредованный нокдаун AXL увеличивает чувствительность к химиотерапии в клетках CML и ксенотрансплантатных моделях (Zhao, Y., et al., Cancer Invest. 2012, 30, 287-294). Точно так же shRNA-опосредованный нокдаун MER сенсибилизирует клетки B-клеточного острого лимфобластного лейкоза (B-ALL) и T-клеточного острого лимфобластного лейкоза (T-ALL) к ряду химиотерапий (Linger, R.M., et al., Blood, 2013, 122, 1599-1609; Brandao, L.N., et al., Blood Cancer J., 2013, 3, e101). При солидных опухолях, таких как немелкоклеточный рак легкого, протоковая аденокарцинома поджелудочной железы, астроцитома, аденокарцинома легкого, рак яичников, меланома и мультиформная глиобластома, сверхэкспрессия AXL или MER способствует хеморезистентности, и shRNA-опосредованное ингибирование сенсибилизирует клетки к лечению с помощью цитотоксических химиотерапий (Linger, R.N., et al., Oncogene, 2013, 32, 3420-3431; Song, X., et al., Cancer, 2011, 117, 734-743; Keating, A.K., et al., Mol. Cancer Ther. 2010, 9, 1298-1307; Lay, J.D., et al., Cancer Res. 2007, 67, 3878-3887; Zhao, Y., et al., Cancer Invest, 2012, 30, 287-294; Macleod, K., Cancer Res. 2005, 65, 6789-6800; Zhu, S., et al., Proc. Natl Acad. Sci. USA, 2009, 106, 17025-17030; Wang, Y., et al., Oncogene 2013, 32, 872-882).

В отличие от химиорезистентности, примеры приобретенной резистентности к ТАМ-киназам в настоящее время ограничиваются AXL. AXL активируется в устойчивых к иматинибу линиях клеток CML и гастроинтестинальной стромальной опухоли (GIST), и образцах опухолей (Mahadevan, D., et al., Oncogene, 2007, 26, 3909-3919; Dufies, M., et al., Oncotarget 2011, 2, 874-885; Gioia, R., et al., Blood, 2011, 118, 2211-2221), и siRNA-опосредованный нокдаун AXL восстанавливает чувствительность иматиниба к резистентным клеточным линиям (Dufies, M., et al.). Аналогичным образом, AXL индуцируется в лапатиниб-резистентных HER2 (также известных как ERBB2)-положительных клеточных линиях рака молочной железы, и ингибирование AXL восстанавливает чувствительность к лапатинибу (Liu, L., et al., Cancer Res. 2009, 69, 6871-6878). AXL был связан с приобретенной резистентностью к ингибиторам тирозинкиназы рецептора эпидермального фактора роста (EGFR) (например, лапатиниб и эрлотиниб) и терапевтическим антителам (например, цетуксимаб) при трижды негативном раке молочной железы (Meyer, A.S. et al., Sci. Signal 2013, 6, ra66), колоректальном раке (Brand, et al., Cancer Res. 2014, 74:5152-5164), клеточных линиях рака головы и шеи (Kiles, K.M, et al., Mol. Cancer Ther. 2013, 12, 2541-2558) и немелкоклеточном раке легкого (Zhang, Nat. Genet. 2013, 44(8), 852-860). AXL также был связан с приобретенной резистентностью к ингибиторам, нацеленным на другие киназы, включая ингибиторы PI3Kα, такие как апелисиб (BYL719) при плоскоклеточном раке головы и шеи и пищевода (Elkabets, et al., Cancer Cell 2015, 27:533-546), ингибиторы MEK (например, U0126 (1,4-диамино-2,3-дициано-1,4-бис(o-аминофенилмеркапто)бутадиен) и PD 325901 (1,4-диамино-2,3-дициано-1,4-бис(o-аминофенилмеркапто)бутадиен) в клеточных линиях трижды негативного рака молочной железы и клеточных линиях меланомы (Miller, et al., Cancer Discovery 2016, 6:382-39), фактор роста фибробластов (FGFR) (Ware, K.E., Oncogenesis 2013, 2, e39), киназа анапластической лимфомы (ALK) (Kim, H.R., et al., Mol. Oncol. 2013, 7, 1093-1102) и рецептор инсулиноподобного фактора роста 1 (IGF1R) (Huang, R., Cancer Res. 2010, 70, 7221-7231), и было продемонстрировано, что ингибирование AXL преодолевает или задерживает резистентность к этим ингибиторам. AXL активируется в клеточных линиях и ксенотрансплантатах NSCLC, устойчивых к ингибиторам тирозинкиназы EGFR (эрлотиниб) и и препаратам антител (цетуксимаб) (Brad, T.M., et al., Cancer Res. 2014, 74, 5152-5164; Zhang, Z., et al., Nature Genet. 2012, 44, 852-860), и индуцируется в 20% совпадающих образцов опухолей, взятых у пациентов с NSCLC после развития устойчивости к ингибитору EGFR эрлотиниб.

Что касается двойных ингибиторов MER и AXL, нормальная роль MER и AXL в предотвращении или прекращении врожденного иммуно-опосредованного воспаления и ответов естественных клеток-киллеров (NK) нарушается в микроокружении опухоли. MER и AXL снижают противоопухолевую активность NK-клеток, что способствует увеличению метастазов.

MER первоначально был идентифицирован как фосфопротеин из библиотеки экспрессии лимфобластоидов (Graham et al., 1995, Oncogene 10, 2349-2359). И GAS6, и ProS могут связываться с MER и индуцировать фосфорилирование и активацию MER-киназы (Lew et al., 2014. eLife, 3:e03385). Как и AXL, активация MER также передает нисходящие сигнальные пути, включая PI3K-Akt и Raf-MAPK (Linger et al., 2008, Oncogene 32, 3420-3431). MER сверхэкспрессируется при многих видах рака, включая множественную миелому, желудок, простату, молочную железу, меланому и рабдомиосаркому (Linger et al., 2008, Oncogene 32, 3420-3431). Нокдаун MER ингибирует рост клеток множественной миеломы in vitro и в ксенотрансплантатных моделях (Waizenegger et al., 2014, Leukemia, 1-9). При остром миелоидном лейкозе нокдаун MER индуцировал апоптоз, уменьшал образование колоний и увеличивал выживаемость на модели мышей (Lee-Sherick et al., 2013, Oncogene 32, 5359-5368). Ингибирование MER увеличивало апоптоз, уменьшало образование колоний, увеличивало химиочувствительность и уменьшало рост опухоли при NSCLC (Linger et al., 2013, Oncogene 32, 3420-3431). Подобные эффекты наблюдают при нокдауне MER при меланоме (Schlegel et al., 2013) и глиобластоме (Wang et al., 2013, Oncogene 32, 872-882).

TYRO3 был первоначально идентифицирован с помощью исследования клонирования на основе ПЦР (Lai and Lemke, 1991, Neuron 6, 691-704). Оба лиганда, GAS6 и ProS, могут связываться с Tyro3 и активировать его. TYPO3 также играет определенную роль в росте и пролиферации рака. TYRO3 сверхэкспрессируется в клетках меланомы, а нокдаун TYRO3 вызывает апоптоз в этих клетках (Demarest et al., 2013, Biochemistry 52, 3102-3118).

ТАМ-киназы стали потенциальными мишенями для иммуноонкологии. Устойчивый клинический ответ на блокаду иммунных контрольных точек, наблюдаемый у онкологических больных, ясно указывает на то, что иммунная система играет важную роль в инициировании и поддержании опухоли. Генетические мутации раковых клеток могут предоставить разнообразный набор антигенов, которые иммунные клетки могут использовать, чтобы отличать опухолевые клетки от их нормальных аналогов. Однако раковые клетки выработали несколько механизмов, позволяющих уклоняться от иммунного надзора хозяина. Фактически, одним из отличительных признаков рака человека является его способность избегать уничтожения иммунной системой. Раковые клетки могут индуцировать иммуносупрессивное микроокружение, способствуя образованию ассоциированных с опухолью макрофагов M2, супрессорных клеток миелоидного происхождения (MDSC) и регуляторных Т-клеток. Раковые клетки также могут продуцировать высокие уровни белков иммунных контрольных точек, таких как PD-L1, чтобы вызвать анергию или истощение Т-клеток. Теперь ясно, что опухоли кооптируют определенные пути иммунных контрольных точек в качестве основного механизма иммунорезистентности (Pardoll, 2012, Cancer 12, 252-264). Противодействие этим негативным регуляторам функции Т-клеток антителами продемонстрировало поразительную эффективность в клинических испытаниях ряда злокачественных новообразований, включая запущенную меланому, немелкоклеточный рак легкого и мочевого пузыря. Хотя эти методы лечения показали обнадеживающие результаты, не у всех пациентов наблюдается противоопухолевый ответ, что позволяет предположить, что другие иммуносупрессивные пути также могут быть важны.

Было показано, что ТАМ-киназы функционируют как контрольные точки для активации иммунной системы в опухолевой среде. Все ТАМ-киназы экспрессируются в NK-клетках, и киназы ТАМ-киназы ингибируют противоопухолевую активность NK-клеток. LDC1267, низкомолекулярный ингибитор киназы ТАМ, активирует NK-клетки и блокирует метастазы в моделях опухолей с различной гистологией (Paolino et al., 2014, Nature 507, 508-512). Кроме того, киназа MER снижает активность ассоциированных с опухолью макрофагов за счет увеличения секреции иммуносупрессивных цитокинов, таких как ILIO и IL4, и снижения продукции иммунных активирующих цитокинов, таких как IL12 (Cook et al., 2013, The Journal of Clinical Investigation 123, 3231-3242). Было показано, что ингибирование MER реверсирует этот эффект. В результате мыши с нокаутом MER становятся резистентными к образованию опухоли PyVmT (Cook et al., 2013, Journal of Clinical Investigation 123, 3231-3242). Роль ТАМ-киназ в иммунном ответе также подтверждается исследованиями на мышах с нокаутированным геном. Мыши с тройным нокаутом TAM (TKO) жизнеспособны. Однако у этих мышей наблюдались признаки аутоиммунного заболевания, включая увеличение селезенки и лимфатических узлов, выработку аутоантител, опухшие подушечки стопы и суставы, кожные поражения и системная красная волчанка (Lu and Lemke, 2001, Science 293, 306-311). Это согласуется с фенотипом нокаута для одобренных мишеней для иммуноонкологии, таких как CTLA4 и PD-1. У мышей с нокаутом CTLA-4 и PD-1 наблюдали признаки аутоиммунного заболевания, и эти мыши умирали в течение нескольких недель после рождения (Chambers et al., 1997, Immunity 7, 885-895; and Nishimura et al., 2001, Science 291, 319-322). Следовательно, ингибирование ТАМ-киназ отдельно или в сочетании с другими видами иммунотерапии может повысить способность иммунной системы вызывать терапевтически полезный иммунный ответ против рака.

Рецепторные тирозинкиназы MET (например, c-Met) контролируют рост, инвазию и метастазирование в раковых клетках. c-Met активируется при раке человека с помощью множества различных молекулярных механизмов (см., например, Zhang et al., Carcinogenesis 4:345-355, 2016). Например, заболевание или состояние, ассоциированное с c-Met (например, c-Met-ассоциированный рак), включает: (i) мутации, которые изменяют последовательность и повышают активность киназы c-Met; (ii) мутации в регуляторных последовательностях, контролирующих экспрессию c-Met, или регуляторах экспрессии c-Met, которые обеспечивают повышенную экспрессию c-Met; (iii) мутации, которые изменяют последовательность полипептида c-Met для увеличения периода полужизни c-Met киназы (например, мутация в гене MET, которая приводит к пропуску экзона 14 во время сплайсинга мРНК, что приводит к увеличению уровня c-Met в клетке млекопитающего); (iv) метилирование гена MET (см., например, Nones et al., Int. J. Cancer 135:1110-8, 2014); (v) метилирование длинного диспергированного ядерного элемента (L1), присутствующего в интроне MET между экзоном 2 и экзоном 3 (Weber et al., Oncogene 29:5775-5784, 2010); (vi) амплификацию гена MET; или (vii) одновременную экспрессию рецептора и лиганда, что приводит к аутокринной стимуляции раковых клеток (Birchmeier et al., Nat. Rev. Mol. Cell Biol. 4:915-925, 2003).

Примеры мутаций в гене MET, которые изменяют последовательность киназы c-Met и увеличивают активность киназы c-Met (например, по сравнению с киназой c-Met дикого типа), включают, но не ограничиваются ими, мутации, перечисленные в Таблице 1.

Таблица 1. Примерный список мутаций в гене MET, которые изменяют последовательность киназы c-Met и увеличивают активность киназы c-Met

Мутация изоформы 1 MET Мутация изоформы 2 MET Ссылка
V1092I V1110I Schmidt et al., Oncogene 18:2343-2350, 1999
H1094L H1112L Schmidt et al., Oncogene 18:2343-2350, 1999
H1094R H1112R Schmidt et al., Cancer Research 58:1719-1722, 1998
H1094Y H1112Y Schmidt et al., Oncogene 18:2343-2350, 1999
H1106D H1124D Schmidt et al., Oncogene 18:2343-2350, 1999
D1228H D1246H Bardelli et al., Proc. Natl. Acad. Sci. 95: 14379-14383, 2002
D1228N D1246N Bardelli et al., Proc. Natl. Acad. Sci. 95: 14379-14383, 2002
Y1230C Y1248C Bardelli et al., Proc. Natl. Acad. Sci. 95: 14379-14383, 2002
Y1230D Y1248D Schmidt et al., Oncogene 18:2343-2350, 1999
Y1230H Y1248H Bardelli et al., Proc. Natl. Acad. Sci. 95: 14379-14383, 2002
M1250T M1268T Bardelli et al., Proc. Natl. Acad. Sci. 95: 14379-14383, 2002

Примеры мутаций, которые изменяют последовательность полипептида c-Met для увеличения периода полужизни c-Met киназы (по сравнению с киназой c-Met дикого типа), включают, но не ограничиваются ими, мутации, перечисленные в таблице 2, которые способствуют пропуску экзон 14 MET во время сплайсинга мРНК. Другие иллюстративные мутации, которые, как предполагается, будут способствовать пропуску экзона 14 MET во время сплайсинга мРНК, включают, но не ограничиваются ими, мутации, раскрытые в Frampton et al., Cancer Discovery 5(8):850-9, 2015; and Heist et al., Oncologist 21(4):481-6, 2016. Часть белка c-Met, кодируемая экзоном 14, наиболее заметно Y1003 в мотиве DpYR, необходима для эффективного рекрутирования CBL убиквитин-протеин-лигазы E3, которая нацелена на MET для опосредованной убиквитином деградации (Lee et al., J. Biol. Chem. 269:19457-61, 1994; Lee et al., Exp. Mol. Med. 38:565-73, 2006; Lee et al., Oncogene 33:34-43, 2014). Пропуск экзона 14 MET при сплайсинге мРНК приводит к киназе c-Met, которая поддерживает рамку считывания и демонстрирует повышенную стабильность белка c-Met и пролонгированную передачу сигналов при стимуляции HGF, что приводит к увеличению онкогенного потенциала (Peschard et al., Mol. Cell 8:995-1004, 2001; Abella et al., Mol. Cell. Biol. 25:9632-45, 2005). Другие иллюстративные мутации, которые изменяют последовательность полипептида c-Met для увеличения периода полужизни c-Met киназы, включают, но не ограничиваются этим, аминокислотную замену в Y1003 (например, аминокислотную замену Y1003F) (Peschard et al., Mol. Cell 8:995-1004, 2001).

Таблица 2. Примерный список мутаций, которые приводят к пропуску экзона 14 MET

хромосомная локализация эталонная последовательность Измененная последовательность ("-" означает удаление) Ссылка
chr7:116411875-116411897 AAGCTCTTTCTTTCTCTCTGTT - Kong-Beltran et al., Cancer Res. 66(1):283-289, 2006
chr7:116412022-116412050 ACCGAGCTACTTTTCCAGAAGGTATATT - Kong-Beltran et al., Cancer Res. 66(1):283-289, 2006
chr7:116412043-116412044 G T Kong-Beltran et al., Cancer Res. 66(1):283-289, 2006
chr7:116411854-116411874 CCCATGATAGCCGTCTTTAA - Onozato et al., J. Thorac. Oncol. 4:5-11, 2009.
chr7:116411884-116411895 CTTTCTCTCTG - Onozato et al., J. Thorac. Oncol. 4:5-11, 2009.
chr7:116411886-116411905 TTCTCTCTGTTTTAAGATC - Onozato et al., J. Thorac. Oncol. 4:5-11, 2009.
chr7:116412043-116412044 G A Onozato et al., J. Thorac. Oncol. 4:5-11, 2009.
chr7:116412043-116412044 G T Asaoka et al., Biochem. Biophys. Res. Comm. 394:1042-6, 2010.
chr7:116411884-116411896 CTTTCTCTCTGT - Jenkins et al., Clin. Lung Cancer 16:e101-e104, 2015.
chr7:116412042-116412043 G C Waqar et al., J. Thorac. Oncol. 10:e29-31, 2015.
chr7:116412042-116412043 G C Mendenhall et al., J. Thorac. Oncol. 10:e23-34, 2015.

Примеры c-Met-ассоциированного рака включают, но не ограничиваются ими, перечисленные в Таблице 3.

Таблица 3. Иллюстративные виды c-Met-ассоциированного рака, демонстрирующие повышенную экспрессию и/или активность c-Met

Тип рака Тип генетических изменений Ссылка
Рак желудочно-кишечного тракта (GI); рак желудка Амплификация гена МЕТ;
Аминокислотная замена в киназном домене (например, аминокислотная замена в положении 1108, например, аминокислотная замена A1108S);
точечная мутация, приводящая к пропуску экзона 14 MET во время сплайсинга мРНК (например, chr7:116412043-116412044, мутация G в T)
Mo et al., Chronic Dis. Transl. Med. 3(3):148-153, 2017; Tovar et al., Ann. Transl. Med. 5(10):205, 2017; Asaoka et al., Biochem. Biophys. Res. Comm. 394:1042-6, 2010.
Колоректальная аденокарцинома аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I); аминокислотная замена в положении 988 (например, аминокислотная замена R988C); аминокислотная замена в положении 1253 (например, аминокислотная замена Y1253D); и аминокислотная замена в положении 1248 (например, аминокислотная замена Y1248H) Zenali et al., Oncoscience 2(5):533-541, 2015.
Колоректальный рак (CRC) Амплификация гена МЕТ;
сверхэкспрессия МЕТ;
аминокислотные замены в JM-домене c-Met-киназы (например, аминокислотная замена в положении 970 (например, аминокислотная замена R970C) и аминокислотная замена в положении 992 (например, аминокислотная замена T992I)
Zeng et al., Cancer Lett. 265:258-269, 2008; Kong-Beltran et al., Cancer Res. 66:283-9, 2006; Tovar et al., Ann. Transl. Med. 5(10):205, 2017.
Немелкоклеточный рак легкого (NSCLC) точечная мутация, приводящая к пропуску экзона 14 MET во время сплайсинга мРНК;
Амплификация гена МЕТ;
аминокислотные замены в киназном домене c-Met (например, аминокислотная замена в положении 970 (например, аминокислотная замена R970C), аминокислотная замена в положении 988 (например, аминокислотная замена R988C); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I); аминокислотная замена в положении 1058 (например, аминокислотная замена S1058P));
аминокислотная замена в JM-домене c-Met-киназы (например, аминокислотная замена в положении 988 (например, аминокислотная замена R988C), аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I), аминокислотная замена в положении 1058 (например, аминокислотная замена S1058P), аминокислотная замена в положении 970 (например, аминокислотная замена R970C), и аминокислотная замена в положении 992 (например, аминокислотная замена T992I)).
Ichimura et al., Jpn J. Cancer Res. 87:1063-1069, 1996; Ma et al., Cancer Res. 63:6272-81, 2003; Kong-Beltran et al., Cancer Res. 66:283-9, 2006; Tovar et al., 2017, Ann. Transl. Med. 5(10):205, 2017
Гепатоцеллюлярная карцинома (HCC) Сверхэкспрессия МЕТ;
Аминокислотные замены в киназном домене c-Met (например, аминокислотная замена в положении 1191 (например, аминокислотная замена T1191I), аминокислотная замена в положении 1262 (например, аминокислотная замена J1262R), или аминокислотная замена в положении 1268 (например, аминокислотная замена M1268T или M1268I)); аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 988 (например, аминокислотная замена R988C)
Goyal et al., Clin. Cancer Res. 19:2310-2318, 2013; Tovar et al., Ann. Transl. Med. 5(10):205, 2017; Zenali et al., Oncoscience 2(5):533-541, 2015
Наследственный папиллярный рак почки (HPRC) Аминокислотные замены в киназном домене c-Met (например, аминокислотная замена в положении 112 (например, аминокислотная замена H112R, H112L, или H112I), положение аминокислоты как положение 1230 (например, аминокислотная замена Y1230C, Y1230H, или Y1230D), аминокислотная замена в положении 1246 (например, аминокислотная замена D1246N), аминокислотная замена в положении 1248 (например, аминокислотная замена Y1248C), аминокислотная замена в положении 1268 (например, аминокислотная замена M1268T или аминокислотная замена M1268I). Tovar et al., Ann. Transl. Med. 5(10):205, 2017
Папиллярный рак почки Аминокислотные замены в киназном домене c-Met (например, перечисленные в таблице 1) Jeffers et al., Proc. Natl. Acad. Sci. U.S.A. 94(21):11445-11450, 1997; Schmidt et al., Nat. Genet. 16:68-73, 1997; Schmidt et al., Oncogene 18:2343-50, 1991.
Меланома аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 988 (например, аминокислотная замена R988C); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I). Zenali et al., Oncoscience 2(5):533-541, 2015.
Аденокарцинома желудка аминокислотная замена в положении 375 (например, аминокислотная замена N375S). Zenali et al., Oncoscience 2(5):533-541, 2015.
аденокарцинома червеобразного отростка аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 988 (например, аминокислотная замена R988C) Zenali et al., Oncoscience 2(5):533-541, 2015.
Аденокарцинома двенадцатиперстной кишки аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Аденокарцинома поджелудочной железы аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Аденокарцинома легкого аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 988 (например, аминокислотная замена R988C); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Папиллярный рак щитовидной железы аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Медуллярный рак щитовидной железы аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Саркома Юинга аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Аденокарцинома предстательной железы аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Плоскоклеточный рак головы и шеи и шейки матки аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 988 (например, аминокислотная замена R988C); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
почечно-клеточная карцинома аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1092 (например, аминокислотная замена V1092I); аминокислотная замена в положении 1094 (например, аминокислотная замена H1094L, H1094R или H1094Y); аминокислотная замена в положении 1106 (например, аминокислотная замена H1106D); аминокислотная замена в положении 1228 (например, аминокислотная замена D1228H или D1228N); аминокислотная замена в положении 1230 (например, аминокислотная замена Y1230C, Y1230D или Y1230H); аминокислотная замена в положении 1250 (например, аминокислотная замена M1250T) Zenali et al., Oncoscience 2(5):533-541, 2015; Schmidt et al., Oncogene 18:2343-2350, 1999; Scmidt et al., Cancer Research 58:1719-1722, 1998; Bardelli et al., Proc. Natl. Acad. Sci. 95: 14379-14383, 2002.
Феохромоцитома и смешанная феохромоцитома аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 988 (например, аминокислотная замена R988C) Zenali et al., Oncoscience 2(5):533-541, 2015.
Серозный рак яичников аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1010 (например, аминокислотная замена 1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Светлоклеточный рак яичников аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Смешанный рак яичников аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Серозная перитонеальная карцинома аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Протоковая аденокарцинома молочной железы аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I). Zenali et al., Oncoscience 2(5):533-541, 2015.
Лейомиосаркома матки аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Эндометриоидная аденокарцинома матки аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I). Zenali et al., Oncoscience 2(5):533-541, 2015.
Смешанная мезодермальная опухоль матки аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Глиобластома аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Анапластическая глиома аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Олигодендроглиома аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Десмопластическая мелкокруглоклеточная опухоль аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Плоскоклеточный рак прямой кишки аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Карцинома слюнной железы аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Ангиосаркома сердца аминокислотная замена в положении 375 (например, аминокислотная замена N375S); аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I) Zenali et al., Oncoscience 2(5):533-541, 2015.
Гастроинтестинальная стромальная опухоль (GIST) аминокислотная замена в положении 1010 (например, аминокислотная замена T1010I); аминокислотная замена в положении 988 (например, аминокислотная замена R988C) Zenali et al., Oncoscience 2(5):533-541, 2015.
Инвазивная тимома аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.
Саркома веретена аминокислотная замена в положении 375 (например, аминокислотная замена N375S) Zenali et al., Oncoscience 2(5):533-541, 2015.

В некоторых вариантах осуществления соединения формулы I можно использовать для лечения c-Met-ассоциированного рака, экспрессирующего киназу c-Met, которая устойчива (например, по меньшей мере до некоторой степени по сравнению с киназой c-Met дикого типа) к ингибитору c-Met (например, ингибитор c-Met типа I). Неограничивающие примеры аминокислотных замен, которые приводят к устойчивости c-Met к ингибитору c-Met (например, ингибитору c-Met типа I), включают: аминокислотную замену в положении 1092 (например, аминокислотная замена V1092I в изоформе 1 c-Met или аминокислотная замена V1110I в изоформе 2 c-Met); аминокислотную замену в положении 1094 (например, аминокислотная замена H1094L в изоформе 1 c-Met или аминокислотная замена H1112L в изоформе 2 c-Met; аминокислотная замена H1094Y в изоформе 1 c-Met или аминокислотная замена H1112Y в изоформе 2 c-Met); аминокислотную замену в положении 1155 (например, аминокислотная замена V1155L в изоформе 1 или аминокислотная замена V1173L в изоформе 2 c-Met); аминокислотную замену в положении 1163 (например, аминокислотная замена G1163R в изоформе 1 c-Met или аминокислотная замена G1181R в изоформе 2 c-Met); аминокислотную замену в положении 1195 (например, аминокислотная замена L1195F в изоформе 1 c-Met или аминокислотная замена L1213F в изоформе 2 c-Met; аминокислотная замена L1195V в изоформе 1 c-Met или аминокислотная замена L1213V в изоформе 2 c-Met); аминокислотную замену в положении 1200 (например, аминокислотная замена F1200I в изоформе 1 c-Met или аминокислотная замена F1218I в изоформе 2 c-Met); аминокислотную замену в положении 1211 (например, аминокислотная замена M1211L в изоформе 1 c-Met или аминокислотная замена M1229L в изоформе 2 c-Met); аминокислотную замену в положении 1228 (например, аминокислотная замена D1228A в изоформе 1 c-Met или аминокислотная замена D1246A в изоформе 2 c-Met; аминокислотная замена D1228G в изоформе 1 c-Met или аминокислотная замена D1246G в изоформе 2 c-Met; аминокислотная замена D1228H в изоформе 1 c-Met или аминокислотная замена D1246H в изоформе 2 c-Met; аминокислотная замена D1228N в изоформе 1 c-Met или аминокислотная замена D1246N в изоформе 2 c-Met; аминокислотная замена D1228V в изоформе 1 c-Met или аминокислотная замена D1246V в изоформе 2 c-Met; или аминокислотная замена D1228Y в изоформе 1 c-Met или аминокислотная замена D1246Y в изоформе 2 c-Met); аминокислотную замену в положении 1230 (например, аминокислотная замена Y1230C в изоформе 1 c-Met или аминокислотная замена Y1248C в изоформе 2 c-Met; аминокислотная замена Y1230H аминокислотная замена в изоформе 1 c-Met или аминокислотная замена Y1248H в изоформе 2 c-Met; или аминокислотная замена Y1230S в изоформе 1 c-Met или аминокислотная замена Y1248S в изоформе 2 c-Met); или аминокислотную замену в положении 1250 (например, аминокислотная замена M1250T в изоформе 1 c-Met или аминокислотная замена M1268T в изоформе 2 c-Met). Неограничивающие примеры ингибиторов типа I включают кризотиниб (PF-02341066), капматиниб, NVP-BVU972, AMG 337, бозитиниб, глуметиниб, саволитиниб и тепотиниб. В некоторых вариантах осуществления аминокислотные замены, которые приводят к устойчивости c-Met к ингибитору c-Met типа 1, включают L1195V, F1200I, D1228H, D1228N, Y1230C, Y1230H, и Y1230S.

В некоторых вариантах осуществления соединения формулы I можно использовать для лечения c-Met-ассоциированного рака, имеющего хромосомную транслокацию, которая приводит к слитому белку, включающему киназный домен c-Met, где слитый белок имеет повышенную активность c-Met по сравнению с c-Met-киназой дикого типа (например, слитый белок Met-TPR (Rodrigues et al., Mol. Cell. Biol. 13:6711-6722, 1993) и слитый белок/хромосомная транслокация, описанная в Cooper et al., Nature 311(5981):29-33, 1984.

Соответственно, в одном варианте осуществления, в настоящем документе предложен способ лечения TAM-ассоциированного заболевания или расстройства (например, TAM-ассоциированного рака), c-Met-ассоциированного заболевания или расстройства (например, c-Met-ассоциированного рака), или обоих, у пациента, нуждающегося в этом, включающий введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, которые включают введение пациенту, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции.

В настоящем документе также предложены способы лечения пациента, страдающего раком, которые включают: (a) определение у пациента TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих, и (b) введение пациенту, у которого определен TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции.

В настоящем документе также предложены способы снижения риска развития метастазов или дополнительных метастазов у пациента, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, которые включают введение пациенту, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. В некоторых вариантах осуществления способы приводят к снижению по меньшей мере на 1% (например, снижению по меньшей мере на 2%, снижению по меньшей мере на 3%, снижению по меньшей мере на 4%, снижению по меньшей мере на 5%, снижению по меньшей мере на 6%, снижению по меньшей мере на 8%, снижению по меньшей мере на 10%, снижению по меньшей мере на 12%, снижению по меньшей мере на 14%, снижению по меньшей мере на 16%, снижению по меньшей мере на 18%, снижению по меньшей мере на 20%, снижению по меньшей мере на 25%, снижению по меньшей мере на 30%, снижению по меньшей мере на 35%, снижению по меньшей мере на 40%, снижению по меньшей мере на 45%, снижению по меньшей мере на 50%, снижению по меньшей мере на 55%, снижению по меньшей мере на 60%, снижению по меньшей мере на 65%, снижению по меньшей мере на 70%, снижению по меньшей мере на 75%, снижению по меньшей мере на 80%, снижению по меньшей мере на 85%, снижению по меньшей мере на 90%, снижению по меньшей мере на 95%, или снижению по меньшей мере на 99%) риска развития метастазов или дополнительных метастазов у пациентов, например, по сравнению с популяцией субъектов, которые имеют аналогичный TAM-ассоциированный рак и/или c-Met-ассоциированный рак, но получающих другое лечение или без лечения.

Также представлены способы снижения риска развития метастазов или дополнительных метастазов у пациента, страдающего раком, которые включают: (a) определение у пациента TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих; и (b) введение пациенту, у которого определен TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления способы приводят к снижению по меньшей мере на 1% (например, снижению по меньшей мере на 2%, снижению по меньшей мере на 3%, снижению по меньшей мере на 4%, снижению по меньшей мере на 5%, снижению по меньшей мере на 6%, снижению по меньшей мере на 8%, снижению по меньшей мере на 10%, снижению по меньшей мере на 12%, снижению по меньшей мере на 14%, снижению по меньшей мере на 16%, снижению по меньшей мере на 18%, снижению по меньшей мере на 20%, снижению по меньшей мере на 25%, снижению по меньшей мере на 30%, снижению по меньшей мере на 35%, снижению по меньшей мере на 40%, снижению по меньшей мере на 45%, снижению по меньшей мере на 50%, снижению по меньшей мере на 55%, снижению по меньшей мере на 60%, снижению по меньшей мере на 65%, снижению по меньшей мере на 70%, снижению по меньшей мере на 75%, снижению по меньшей мере на 80%, снижению по меньшей мере на 85%, снижению по меньшей мере на 90%, снижению по меньшей мере на 95%, или снижению по меньшей мере на 99%) риска развития метастазов или дополнительных метастазов у пациентов, например, по сравнению с популяцией субъектов, которые имеют аналогичный TAM-ассоциированный рак и/или c-Met-ассоциированный рак, но получающих другое лечение или без лечения.

Также представлены способы снижения миграции и/или инвазии раковых клеток у пациента, у которого определен TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, которые включают введение пациенту, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления способы приводят к снижению по меньшей мере на 1% (например, снижению по меньшей мере на 2%, снижению по меньшей мере на 3%, снижению по меньшей мере на 4%, снижению по меньшей мере на 5%, снижению по меньшей мере на 6%, снижению по меньшей мере на 8%, снижению по меньшей мере на 10%, снижению по меньшей мере на 12%, снижению по меньшей мере на 14%, снижению по меньшей мере на 16%, снижению по меньшей мере на 18%, снижению по меньшей мере на 20%, снижению по меньшей мере на 25%, снижению по меньшей мере на 30%, снижению по меньшей мере на 35%, снижению по меньшей мере на 40%, снижению по меньшей мере на 45%, снижению по меньшей мере на 50%, снижению по меньшей мере на 55%, снижению по меньшей мере на 60%, снижению по меньшей мере на 65%, снижению по меньшей мере на 70%, снижению по меньшей мере на 75%, снижению по меньшей мере на 80%, снижению по меньшей мере на 85%, снижению по меньшей мере на 90%, снижению по меньшей мере на 95% или снижению по меньшей мере на 99%) миграции и/или инвазии раковой клетки у пациента, например, по сравнению с миграцией и/или инвазией раковой клетки или популяции раковых клеток у субъекта, имеющего аналогичный TAM-ассоциированный рак и/или c-Met-ассоциированный рак, но получающих другое лечение или без лечения.

В настоящем документе также предложены способы уменьшения миграции и/или инвазии раковой клетки у пациента, страдающего раком, которые включают: (a) определение у пациента TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих; и (b) введение пациенту, у которого определен TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления способы приводят к снижению по меньшей мере на 1% (например, снижению по меньшей мере на 2%, снижению по меньшей мере на 3%, снижению по меньшей мере на 4%, снижению по меньшей мере на 5%, снижению по меньшей мере на 6%, снижению по меньшей мере на 8%, снижению по меньшей мере на 10%, снижению по меньшей мере на 12%, снижению по меньшей мере на 14%, снижению по меньшей мере на 16%, снижению по меньшей мере на 18%, снижению по меньшей мере на 20%, снижению по меньшей мере на 25%, снижению по меньшей мере на 30%, снижению по меньшей мере на 35%, снижению по меньшей мере на 40%, снижению по меньшей мере на 45%, снижению по меньшей мере на 50%, снижению по меньшей мере на 55%, снижению по меньшей мере на 60%, снижению по меньшей мере на 65%, снижению по меньшей мере на 70%, снижению по меньшей мере на 75%, снижению по меньшей мере на 80%, снижению по меньшей мере на 85%, снижению по меньшей мере на 90%, снижению по меньшей мере на 95%, или снижению по меньшей мере на 99%) миграции и/или инвазии раковой клетки у пациента, например, по сравнению с миграцией и/или инвазией раковой клетки или популяции раковых клеток у субъекта, имеющего аналогичный TAM-ассоциированный рак и/или c-Met-ассоциированный рак, но получающих другое лечение или без лечения.

Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, любого из примеров дополнительных противораковых средств, описанных в настоящем документе или известных в данной области). Например, в некоторых примерах, по меньшей мере одно противораковое средство или терапия могут быть выбраны из группы: ингибитор контрольных точек иммунного ответа, ингибитор киназ, химиотерапия, лучевая терапия и хирургическое вмешательство.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, пациент ранее получал лечение по меньшей мере одним дополнительным противораковым средством (например, любое из дополнительных противораковых средств, описанных в настоящем документе) и предшествующее лечение по меньшей мере одним дополнительным противораковым средством было безуспешным (например, у пациента ранее развилась резистентность к одному или нескольким из по меньшей мере одного дополнительного противоракового средства).

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство выбрано из группы, состоящей из: химиотерапевтического средства, ингибитора PI-3-киназы, ингибитора EGFR, ингибитора HER2/neu, ингибитора FGFR, ингибитора ALK, ингибитора IGF1R, ингибитора VEGFR, ингибитора PDGFR, глюкокортикоида, ингибитора BRAF, ингибитора MEK, ингибитора HER4, ингибитора MET (например, ингибитор c-Met киназы типа I), ингибитора RAF, ингибитора Akt, ингибитора FTL-3, ингибитора пути МАР-киназы.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство может включать ингибитор киназы, и у пациента ранее развилась резистентность к ингибитору киназы. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно противораковое средство включает ингибитор киназы, выбранный из группы: бозитиниб, 1-(6,7-дигидро-5H-бензо[6,7]циклогепта[1,2-c]пиридазин-3-ил)-N3-[7(S)-(1-пирролидинил)-6,7,8,9-тетрагидро-5H-бензоциклогептен-2-ил]-1H-1,2,4-триазол-3,5-диамин (BGB324), кризотиниб, форетиниб, (N-[4-(2-амино-3-хлорпиридин-4-илокси)-3-фторфенил]-4-этокси-1-(4-фторфенил)-2-оксо-1,2-дигидропиридин-3-карбоксамид (BMS-777607), , амуватиниб, BMS-796302, кабозантиниб, глесатиниб (MGCD265), 2-(4-фторфенил)-N-[3-фтор-4-(3-фенил-1H-пирроло[2,3-b]пиридин-4-илокси)фенил]-1,5-диметил-3-оксо-2,3-дигидро-1H-пиразол-4-карбоксамид (NPS-1034), N-[4-[(6,7-диметоксихинолин-4-ил)окси]-3-фторфенил]-4-этокси-1-(4-фтор-2-метилфенил)-1H-пиразол-3-карбоксамид гидрохлорид (LDC1267), гилтеритиниб, [3-(2-[[3-фтор-4-(4-метилпиперазин-1-ил)фенил]амино]-5-метил-7H-пирроло[2,3-d]пиримидин-4-ил)фенил]ацетонитрил (SGI-7079), дуберматиниб (TP-0903), транс-4-[2-(бутиламино)-5-[4-[(4-метилпиперазин-1-ил)метил]фенил]-7H-пирроло[2,3-d]пиримидин-7-ил]циклогексанол (UNC2025), 3-[3-[4-(Морфолин-4-илметил)-1H-пиррол-2-илметилен]-2-оксо-2,3-дигидро-1H-индол-5-илметил]тиазолидин-2,4-дион гидрохлорид (S49076), сунитиниб, 12A11, Mab173, YW327.6S2, D9, E8, мерестиниб, , [3-(2-[[3-фтор-4-(4-метилпиперазин-1-ил)фенил]амино]-5-метил-7H-пирроло[2,3-d]пиримидин-4-ил)фенил]ацетонитрил (SGI-7079), , N-[4-[(6,7-диметоксихинолин-4-ил)окси]-3-фторфенил]-4-этокси-1-(4-фтор-2-метилфенил)-1H-пиразол-3-карбоксамид гидрохлорид, капматиниб, NVP-BVU972, AMG 337, бозитиниб, глуметиниб, саволитиниб и тепотиниб.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает дексаметазон, и у пациента ранее развилась резистентность к дексаметазону. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает цитарабин, и у пациента ранее развилась резистентность к цитарабину. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает иматиниб, и у пациента ранее развилась резистентность к иматинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает лапатиниб, и у пациента ранее развилась резистентность к лапатинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает цетуксимаб, и у пациента ранее развилась резистентность к цетуксимабу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает эрлотиниб, и у пациента ранее развилась резистентность к эрлотинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает алпелисиб, и у пациента ранее развилась резистентность к алпелисибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает цисплатин, и у пациента ранее развилась резистентность к цисплатину. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает сунитиниб, и у пациента ранее развилась резистентность к сунитинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает метформин, и у пациента ранее развилась резистентность к метформину.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает анти-PD1 антитело и у пациента ранее развилась резистентность к анти-PD1 антителу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает доцетаксел, и у пациента ранее развилась резистентность к доцетакселу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство включает ингибитор EGFR, и у пациента уже развилась резистентность к ингибитору EGFR.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере одно дополнительное противораковое средство представляет собой ингибитор c-Met типа 1, и у пациента уже развилась резистентность к ингибитору c-Met. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает кризотиниб, и у пациента ранее развилась резистентность к кризотиниб. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает капматиниб, и у пациента ранее развилась резистентность к капматинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает NVP-BVU972, и у пациента ранее развилась резистентность к NVP-BVU972. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает AMG 337, и у пациента ранее развилась резистентность к AMG 337. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает бозитиниб, и у пациента ранее развилась резистентность к бозитинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает глуметиниб, и у пациента ранее развилась резистентность к глуметинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает саволитиниб, и у пациента ранее развилась резистентность к саволитинибу. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, по меньшей мере один дополнительный ингибитор c-Met типа 1 включает тепотиниб, и у пациента ранее развилась резистентность к тепотинибу.

В некоторых вариантах осуществления опухоль развила мутацию резистентности после лечения ингибитором с-Мет типа 1. В некоторых вариантах осуществления мутация резистентности в c-Met приводит к экспрессии белка c-Met, включающего одну или несколько из следующих аминокислотных замен: L1195V, F1200I, D1228H, D1228N, D1230C, Y1230H и Y1230S.

В настоящем документе также предложены способы выбора лечения для пациента, у которого определен или диагностирован ТАМ-ассоциированный рак, c-Met-ассоциированный рак, или оба, которые включают выбор соединения формулы I, или его фармацевтически приемлемой соли, или их фармацевтической композиции для пациента, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. Некоторые варианты осуществления дополнительно включают введение пациенту выбранного соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции.

В настоящем документе также предложены способы выбора лечения для пациента, которые включают: (a) определение у пациента TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих; и (b) выбор соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции для пациента, у которого определен TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. Некоторые варианты осуществления дополнительно включают введение выбранного соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции пациенту, у которого определен TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, у субъекта определен или диагностирован TAM-ассоциированный рак (например, любой из видов TAM-ассоциированного рака, описанных в настоящем документе, например, имеющий любую из типичных мутаций ТАМ, описанных в настоящем документе). В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, у субъекта определен или диагностирован, как TAM-ассоциированный рак (например, любой из видов TAM-ассоциированного рака, описанных в настоящем документе, например, имеющий любую из типичных мутаций ТАМ, описанных в настоящем документе), так и c-Met-ассоциированный рак (например, любой из типичных видов c-Met-ассоциированного рака, описанных в настоящем документе, например, имеющий любую из типичных мутаций c-Met, описанных в настоящем документе). В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, у субъекта определен или диагностирован c-Met-ассоциированный рак (например, любой из типичных видов c-Met-ассоциированного рака, описанных в настоящем документе, например, имеющий любую из типичных мутаций c-Met, описанных в настоящем документе).

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, c-Met-ассоциированный рак представляет собой рак, имеющий мутацию, которая увеличивает активность киназы c-Met. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, мутация, которая увеличивает активность киназы c-Met, приводит к одной или нескольким аминокислотным заменам в киназе c-Met. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, c-Met-ассоциированный рак представляет собой рак, имеющий мутацию, которая увеличивает экспрессию c-Met в клетке млекопитающего. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, c-Met-ассоциированный рак представляет собой рак, имеющий мутацию, которая обеспечивает увеличенный период полужизни c-Met киназы в клетке млекопитающего. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, мутация, которая приводит к увеличению периода полужизни c-Met киназы в клетке млекопитающего, является мутацией, которая приводит к пропуску экзона 14 c-Met во время сплайсинга мРНК. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, c-Met-ассоциированный рак представляет собой рак, имеющий амплификацию гена МЕТ. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, c-Met-ассоциированный рак представляет собой c-Met-ассоциированный рак, который имеет резистентность к ингибитору c-Met I типа.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, c-Met-ассоциированный рак выбран из группы: рак желудочно-кишечного тракта (GI), рак желудка, колоректальная аденокарцинома, колоректальный рак (CRC), немелкоклеточный рак легкого (NSCLC), гепато-целлюлярная карцинома (HCC), наследственный папиллярный рак почки (HPRC), папиллярный рак почки, меланома, аденокарцинома желудка, аденокарцинома червеобразного отростка, аденокарцинома двенадцатиперстной кишки, аденокарцинома поджелудочной железы, аденокарцинома легкого, папиллярный рак щитовидной железы, медуллярный рак щитовидной железы, саркома Юинга, аденокарцинома предстательной железы, плоскоклеточный рак головы и шеи и шейки матки, почечно-клеточная карцинома, феохромоцитома и смешанная феохромоцитома, серозный рак яичников, светлоклеточный рак яичников, смешанный рак яичников, серозная перитонеальная карцинома, протоковая аденокарцинома молочной железы, лейомиосаркома матки, эндометриоидная аденокарцинома матки, смешанная мезодермальная опухоль матки, глиобластома, анапластическая глиома, олигодендроглиома, десмопластическая мелкокруглоклеточная опухоль, плоскоклеточный рак прямой кишки, карцинома слюнной железы, ангиосаркома сердца, гастроинтестинальная стромальная опухоль, инвазивная тимома и саркома веретена.

В настоящем документе также предложены способы выбора лечения для пациента, у которого определен или диагностирован рак, которые включают: (a) введение пациенту по меньшей мере одного дополнительного противоракового средства (например, любое из дополнительных противораковых средств, описанных в настоящем документе); (b) после (a), выявление повышенной экспрессии, уровня и/или активности киназы ТАМ и/или киназы c-Met в раковой клетке или иммунной клетке пациента; и (c) после (b), выбор соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции для пациента.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) введение пациенту, у которого определен или диагностирован рак, одной или нескольких доз по меньшей мере одного дополнительного противоракового средства (например, по меньшей мере одного из любых дополнительных противораковых средств, описанных в настоящем документе); (b) после (a), определение увеличения экспрессии, уровня и/или активности киназы ТАМ и/или киназы c-Met в раковой клетке или иммунной клетке пациента; и (c) после (b), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления стадия (c) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) определение увеличения экспрессии, уровня и/или активности киназы TAM и/или киназы c-Met в раковой клетке или иммунной клетке от пациента, у которого определен или диагностирован рак и которому ранее была введена одна или несколько доз по меньшей мере одного дополнительного противоракового средства (например, любого из дополнительных противораковых средств, описанных в данном документе); и (b) после (a), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. В некоторых вариантах осуществления стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которому ранее была введена одна или несколько доз по меньшей мере одного дополнительного противоракового средства и у которого определена раковая клетка или иммунная клетка, которая имеет повышенную экспрессию, уровень и/или активность киназы ТАМ и/или киназы c-Met, которые включают введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или его фармацевтической композиции пациенту. В некоторых вариантах осуществления способ дополнительно включает введение пациенту, по меньшей мере, одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) выбор пациента у которого определена или диагностирована повышенная экспрессия, уровень и/или активность киназы ТАМ и/или киназы c-Met в раковой клетке или иммунной клетке; и (b) после (a) введение выбранному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства (например, любого из дополнительных противораковых средств, описанных в настоящем документе).

Также предложены способы лечения пациента, у которого определен или диагностирован рак, которые включают: (a) выбор пациента, у которого определен или диагностирован рак, которому ранее была введена одна или несколько доз дополнительного противоракового средства (например, любого из дополнительных противораковых средств, описанных в настоящем документе) и у которого определена раковая клетка, или иммунная клетка, имеющая повышенную экспрессию, уровень и/или активность киназы ТАМ и/или киназы c-Met; и (b) после (a), введение выбранному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. В некоторых вариантах осуществления стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, повышенную экспрессию, уровень и/или активность киназы ТАМ определяют в раковой клетке или иммунной клетке. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, у пациента определена или диагностирована раковая клетка или иммунная клетка, имеющая повышенную экспрессию, уровень и/или активность киназы ТАМ.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, повышенную экспрессию, уровень и/или активность киназы ТАМ и киназы c-Met определяют в раковой клетке или иммунной клетке. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, у пациента определена или диагностирована раковая клетка или иммунная клетка, имеющая повышенную экспрессию, уровень и/или активность киназы TAM и киназы c-Met.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, повышенная экспрессия, уровень и/или активность киназы ТАМ в раковой клетке или иммунной клетке является результатом хромосомной транслокации, которая приводит к экспрессии слитого белка TREM87B-MERTK или слитого белка AXL-MBIP.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, повышенную экспрессию, уровень и/или активность киназы c-Met определяют в раковой клетке или иммунной клетке. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, у пациента определена или диагностирована раковая клетка или иммунная клетка, имеющая повышенную экспрессию, уровень и/или активность киназы c-Met.

Также представлены способы лечения пациента, у которого определен или диагностирован ТАМ-ассоциированный рак, которые включают: (a) введение пациенту, у которого определен или диагностирован ТАМ-ассоциированный рак, одной или нескольких доз ингибитора киназы ТАМ; (b) после (a), определение резистентности ТАМ-ассоциированного рака у пациента к ингибитору ТАМ-киназы; и (c) после (b), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. В некоторых вариантах осуществления стадия (с) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового (например, любого из дополнительных противораковых средств, описанных в настоящем документе).

Также представлены способы лечения пациента, у которого определен или диагностирован ТАМ-ассоциированный рак, которые включают: (a) определение резистентности ТАМ-ассоциированного рака у пациента к ингибитору ТАМ-киназы, который ранее был введен пациенту; и (b) после (a), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. В некоторых вариантах осуществления стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак и у которого определена уже развившаяся резистентность к ингибитору ТАМ-киназы, которые включают введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, любого из дополнительных противораковых средств, описанных в настоящем документе или известных в данной области).

В настоящем документе также представлены способы лечения пациента, у которого определен или диагностирован c-Met-ассоциированный рак, которые включают: (a) введение пациенту, у которого определен или диагностирован c-Met-ассоциированный рак, одной или нескольких доз ингибитора киназы c-Met; (b) после (a), определение резистентности c-Met-ассоциированного рака у пациента к ингибитору c-Met-киназы; и (c), после (b), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, любого из дополнительных противораковых средств, описанных в настоящем документе или известных в данной области). В одном варианте осуществления, ингибитор c-Met, вводимый на стадии (a) представляет собой ингибитор c-Met типа I. В одном варианте осуществления, ингибитор c-Met типа 1 c-Met представляет собой кризотиниб, капматиниб, NVP-BVU972, AMG 337, бозитиниб, глуметиниб, саволитиниб или тепотиниб.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован c-Met-ассоциированный рак, которые включают: (a) определение резистентности c-Met-ассоциированного рака у пациента к ингибитору c-Met-киназы, который ранее был введен пациенту; и (b) после (a), введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления этих способов стадия (b) дополнительно включает введение пациенту по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, ингибитор c-Met, вводимый на стадии (a) представляет собой ингибитор c-Met типа I. В одном варианте осуществления, ингибитор c-Met типа 1 представляет собой кризотиниб, капматиниб, NVP-BVU972, AMG 337, бозитиниб, глуметиниб, саволитиниб или тепотиниб.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован c-Met-ассоциированный рак и уже была определена развившаяся резистентность к ингибитору c-Met-киназы, которые включают введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, у пациента развилась резистентность к ингибитору c-Met I типа. В одном варианте осуществления, ингибитор c-Met типа 1 представляет собой кризотиниб, капматиниб, NVP-BVU972, AMG 337, бозитиниб, глуметиниб, саволитиниб или тепотиниб.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, стадия определения пациента, как страдающего TAM-ассоциированным раком и/или c-Met-ассоциированным раком, включает выполнение анализа биопсийного образца, полученного от пациента. В некоторых вариантах осуществления анализ выбран из группы секвенирования, иммуногистохимии, твердофазного иммуноферментного анализа и флуоресцентной гибридизации in situ (FISH). В некоторых вариантах осуществления анализ выбран из группы: денатурирующий градиентный гель-электрофорез (DGGE), гель-электрофорез в температурном градиенте (TGGE), температурный градиентный капиллярный электрофорез, анализ одноцепочного конформационного полиморфизма, анализ молекулярного маяка, анализ динамической гибридизации, анализ на основе ПЦР и денатурирующая высокоэффективная жидкостная хроматография. Некоторые варианты осуществления этих способов могут дополнительно включать получение образца биопсии у пациента.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, соединение формулы I выбрано из соединений, описанных в примерах No. 1-201, или их фармацевтически приемлемых солей. В некоторых вариантах осуществления соединение формулы I выбрано из i) примера No. 1-20; ii) примера No. 21-40; iii) примера No. 41-60; iv) примера No. 61-80; v) примера No. 81-100; vi) примера No. 101-120; vii) примера No. 121-140; viii) примера No. 141-160; ix) примера No. 161-180; x) примера No. 181-201 или его фармацевтически приемлемых солей.

Соединения и способы, описанные в настоящем документе, полезны для лечения опухолей и рака (например, TAM-ассоциированные типы рака и/или c-Met-ассоциированные типы рака). TAM-ассоциированный рак и/или c-Met-ассоциированный рак, который лечат, могут быть первичной опухолью или метастатической опухолью. В одном аспекте способы, описанные в настоящем документе, используются для лечения солидной ТАМ-ассоциированной опухоли, например, меланомы, рака легких (включая аденокарциному легкого, базальноклеточную карциному, плоскоклеточный рак, крупноклеточный рак, бронхиолоальвеолярный рак, бронхиогенный рак, немелкоклеточный рак, мелкоклеточный рак, мезотелиому); рака молочной железы (включая дуктальную карциному, лобулярную карциному, инфильтративный рак молочной железы, светлоклеточный рак, муцинозную карциному, карциному серозных полостей молочной железы); колоректального рака (рак толстой кишки, рак прямой кишки, колоректальная аденокарцинома); рака анального канала; рака поджелудочной железы (включая аденокарциному поджелудочной железы, рак островковых клеток, нейроэндокринные опухоли); рака предстательной железы; аденокарциномы предстательной железы; рака мочевыводящих путей; рака или карциномы яичников (эпителиальная карцинома яичников или поверхностная эпителиально-стромальная опухоль, включая серозную опухоль, эндометриоидную опухоль и муцинозную цистаденокарциному); рака печени и желчных протоков (включая гепато-целлюлярную карциному, холангиокарциному, гемангиому); эзофагеальный карциномы или рака (включая эзофагеальную аденокарциному и плоскоклеточный рак); плоскоклеточного рака ротовой полости и ротоглотки; аденоид-кистозного рака слюнных желез: рака мочевого пузыря; карциномы мочевого пузыря; рака матки (включая рак эндометрия или эндометриальную аденокарциному, глазную, папиллярную серозную карциному матки, светлоклеточную карциному матки, саркомы и лейомиосаркомы матки, смешанные мюллеровы опухоли); глиому, глиобластому, медуллобластому и другие опухоли головного мозга; рака почки (включая рак почки, почечно-клеточную карциному, почечно-клеточный рак, опухоль Вильма); аденомы гипофиза; рака головы и шеи (включая плоскоклеточные раки); рака желудка (раки желудка, аденокарцинома желудка, гастроинтестинальная стромальная опухоль (GIST)); рака яичка; эмбрионально-клеточной опухоли; нейроэндокринной опухоли; рака шейки матки; карциноиды желудочно-кишечного тракта, груди и других органов; слизеобразующего рака; мезенхимальные опухоли, включая саркомы (например, саркома Капоши), фибросаркомы, гемангиома, ангиоматоз, гемангиоперицитома, псевдоангиоматозная стромальная гиперплазия, миофибробластома, фиброматоз, воспалительная миофибробластическая опухоль, липома, ангиолипома, зернисто-клеточная опухоль, нейрофиброма, шваннома, ангиосаркома, липосаркома, рабдомиосаркома, остеосаркома, лейомиома, лейомиосаркома, кожи (например, плоскоклеточный рак кожи), включая меланому, шейка матки, ретинобластома, рак головы и шеи, поджелудочной железы, мозга, щитовидной железы, яичка, почки, мочевого пузыря, мягких тканей, надпочечников, уретры, рак полового члена, миксосаркома, хондросаркома, остеосаркома, хордома, злокачественная фиброзная гистиоцитома, лимфангиосаркома, мезотелиома, плоскоклеточный рак; эпидермоидный рак, злокачественные опухоли придатков кожи, аденокарцинома, гепатома, гепато-целлюлярная карцинома, почечно-клеточная карцинома, гипернефрома, холангиокарцинома, переходно-клеточный рак, хориокарцинома, семинома, эмбрионально-клеточная карцинома, глиома анапластическая; мультиформная глиобластома, нейробластома, медуллобластома, злокачественная менингиома, злокачественная шваннома, неврофибросаркома, карцинома паращитовидной железы, медуллярный рак щитовидной железы, бронхиальный карциноид, феохромоцитома, рак островковых клеток, злокачественный карциноид, злокачественная параганглиома, меланома, новообразование из клеток Меркеля, листовидная цистосаркома, рак слюнных желез, рак вилочковой железы, и рак влагалища среди других.

Соединения формулы I или их фармацевтически приемлемые соли также можно использовать для лечения лимфомы или расстройства или нарушения лимфоцитарной или миелоцитарной пролиферации (например, TAM-ассоциированная лимфома или расстройства или нарушения лимфоцитарной или миелоцитарной пролиферации). Например, TAM-ассоциированный рак может быть лимфомой Ходжкина или неходжкинской лимфомой. Например, субъект может страдать от ТАМ-ассоциированной неходжкинской лимфомы, такой как, но не ограничиваясь этим: СПИД-ассоциированная лимфома; анапластическая крупноклеточная лимфома; ангиоиммунобластная лимфома; бластная N-клеточная лимфома; лимфома Беркитта: Беркитт-подобная лимфома (мелкоклеточная лимфома с нерассеченными ядрами); хронический лимфолейкоз/мелкоклеточная лимфоцитарная лимфома: кожная Т-клеточная лимфома; диффузная В-крупноклеточная лимфома; Т-клеточная лимфома энтропатического типа; фолликулярная лимфома; гепатоспленическая гамма-дельта Т-клеточная лимфома; лимфобластная лимфома: мантийноклеточная лимфома; лимфома маргинальной зоны; назальная Т-клеточная лимфома; педиатрическая лимфома; периферические Т-клеточные лимфомы; первичная лимфома центральной нервной системы; Т-клеточные лейкозы; трансформированные лимфомы; связанные с лечением Т-клеточные лимфомы; или макроглобулинемия Вальденстрема.

Альтернативно, субъект может страдать ТАМ-ассоциированной лимфомой Ходжкина, такой как, но не ограничиваясь этим: нодулярный склероз классической лимфомы Ходжкина (CHL); смешанная клеточность CHL; лимфопения CHL; CHL с высоким содержанием лимфоцитов; лимфома Ходжкина с лимфоидным преобладанием; или HL с преобладанием узловых лимфоцитов.

В одном варианте осуществления, способы, описанные в настоящем документе, могут быть полезны для лечения пациента, страдающего от конкретной TAM-ассоциированной T-клеточной, B-клеточной или NK-клеточной лимфомы, пролиферативного расстройства или нарушения. Например, пациент может страдать от конкретной TAM-ассоциированной Т-клеточной или NK-клеточной лимфомы, например, но не ограничиваясь ими: периферическая Т-клеточная лимфома, например, периферическая Т-клеточная лимфома и периферическая Т-клеточная лимфома, неуточненная (PTCL-NOS); анапластическая крупноклеточная лимфома, например, положительная киназа анапластической лимфомы (ALK). ALK-отрицательная анапластическая крупноклеточная лимфома, мантийноклеточная лимфома, или первичная анапластическая крупноклеточная лимфома кожи; ангиоиммунобластная лимфома; кожная Т-клеточная лимфома, например грибовидный микоз, синдром Сезари, первичная анапластическая крупноклеточная лимфома кожи, первичное CD30+ Т-клеточное лимфопролиферативное заболевание кожи; первичная кожная агрессивная эпидермотропная CD8+ цитотоксическая Т-клеточная лимфома; первичная кожная гамма-дельта-Т-клеточная лимфома; первичная кожная CD4+ Т-клеточная лимфома из мелких/крупных клеток и лимфоматоидный папулез; Т-клеточный лейкоз взрослых/лимфома (ATLL); бластная NK-клеточная лимфома: Т-клеточная лимфома энтеропатического типа; гепатоспленическая гамма-дельта Т-клеточная лимфома: лимфобластная лимфома; назальные NK/Т-клеточные лимфомы; связанные с лечением Т-клеточные лимфомы; например лимфомы, которые появляются после трансплантации солидного органа или костного мозга; Т-клеточный пролимфоцитарный лейкоз; Т-клеточный крупногранулярный лимфоцитарный лейкоз; хроническое лимфопролиферативное заболевание NK-клеток; агрессивный лейкоз NK-клеток; системное EBV+ Т-клеточное лимфопролиферативное заболевание детского возраста (связанное с хронической активной EBV-инфекцией); световая оспа-подобная лимфома; Т-клеточный лейкоз взрослых/лимфома; Т-клеточная лимфома, связанная с энтеропатией; гепатоспленическая Т-клеточная лимфома; или подкожная панникулитоподобная Т-клеточная лимфома.

В одном варианте осуществления, способы, описанные в данном документе, могут быть полезны для лечения пациента, страдающего специфической TAM-ассоциированной B-клеточной лимфомой или пролиферативным расстройством, таким как, но не ограничиваясь ими: множественная миелома; диффузная В-крупноклеточная лимфома; фолликулярная лимфома; лимфома лимфоидной ткани, ассоциированной со слизистой оболочкой (MALT); мелкоклеточная лимфоцитарная лимфома; мантийноклеточная лимфома (MCL); лимфома Беркитта; медиастинальная B-крупноклеточная лимфома; макроглобулинемия Вальденстрема; узловая B-клеточная лимфома из клеток краевой зоны (NMZL); лимфома маргинальной зоны селезенки (SMZL); интраваскулярный В-крупноклеточная лимфома; первичная эффузионная лимфома; или лимфогранулематоз; хронический лимфолейкоз/мелкоклеточная лимфоцитарная лимфома; В-клеточный пролимфоцитарный лейкоз; волосатоклеточный лейкоз; лимфома/лейкоз селезенки, не поддающаяся классификации; диффузная мелкоклеточная В-клеточная лимфома красной пульпы селезенки; вариант волосатоклеточного лейкоза; лимфоплазмоцитарная лимфома; заболевания тяжелых цепей, например, болезнь альфа-тяжелых цепей, болезнь гамма-тяжелых цепей, болезнь тяжелых цепей Mu; плазмаклеточная миелома; солитарная плазмоцитома кости; экстраоссальная плазмоцитома; первичная лимфома кожи фолликулярного центра; В-крупноклеточная лимфома, богатая клетками/гистиоцитами; DLBCL, связанный с хроническим воспалением; Вирус Эпштейна-Барра (EBV)+ DLBCL у пожилых людей; первичная В-крупноклеточная лимфома средостения (тимуса); первичная кожная DLBCL, ножной тип; ALK+ В-крупноклеточная лимфома; плазмобластная лимфома; В-крупноклеточная лимфома, возникающая при HHV8-ассоциированном многоочаговый; болезнь Кастлемена; В-клеточная лимфома, не поддающаяся классификации, с промежуточными характеристиками между диффузной В-крупноклеточной лимфомой и лимфомой Беркитта; В-клеточная лимфома, не поддающаяся классификации, с промежуточными характеристиками между диффузной В-крупноклеточной лимфомой и классической лимфомой Ходжкина; нодулярный склероз классической лимфомы Ходжкина; Классическая лимфома Ходжкина с высоким содержанием лимфоцитов; классическая лимфома Ходжкина со смешанно-клеточным вариантом; или классическая лимфома Ходжкина с лимфоидным истощением.

В одном варианте осуществления, способы, описанные в настоящем документе могут быть полезны для лечения пациента, страдающего ТАМ-ассоциированным лейкозом. Например, субъект может страдать острым или хроническим ТАМ-ассоциированным лейкозом лимфоцитарного или миелогенного происхождения, таким как, но не ограничиваясь ими: острый лимфобластный лейкоз (ALL); острый миелогенный лейкоз (AML); хронический лимфолейкоз (CLL); хронический миелоидный лейкоз (CML); Ювенильный миеломоноцитарный лейкоз (ЮММЛ); волосатоклеточный лейкоз (HCL); острый промиелоцитарный лейкоз (подтип AML); Т-клеточный пролимфоцитарный лейкоз (TPLL); лейкоз из больших гранулярных лимфоцитов; или хронический Т-клеточный лейкоз у взрослых; лейкоз из больших гранулярных лимфоцитов (LGL). В одном варианте осуществления, пациент страдает острым миелогенным лейкозом, например недифференцированным AML (МО); миелобластный лейкоз (Ml; с/без минимального созревания клеток); миелобластный лейкоз (M2; с созреванием клеток); промиелоцитарный лейкоз (M3 или вариант M3 [M3V]); миеломоноцитарный лейкоз (M4 или вариант M4 с эозинофилией [M4E]); моноцитарный лейкоз (M5); эритролейкоз (M6); или мегакариобластный лейкоз (M7).

В одном варианте осуществления, соединения и способы, описанные в настоящем документе, полезны для лечения ТАМ-ассоциированного рака у пациента, при котором рак сверхэкспрессирует AXL, MER или TYRO3, или их комбинацию, например, по сравнению с контрольной нераковой тканью или контрольной клеткой (например, от того же или другого субъекта). В одном варианте осуществления, рак сверхэкспрессирует AXL. В одном варианте осуществления, рак сверхэкспрессирует MER. В альтернативном варианте осуществления рак эктопически экспрессирует MER. В одном варианте осуществления TAM-ассоциированный рак представляет собой рак молочной железы, толстой кишки, почки, кожи, легкого (включая немелкоклеточный рак легкого), печени, желудка, мозга (включая глиобластому), яичников, поджелудочной железы, предстательной железы, мультиформную глиобластому, остеосаркому, злокачественные новообразования щитовидной железы, рабдомиосаркому, меланому. острый миелоидный лейкоз, острый Т-клеточный лимфоидный лейкоз, В-клеточный острый лимфоидный лейкоз, шванному и мантийноклеточную лимфому.

В одном варианте осуществления TAM-ассоциированный рак выбран из рака молочной железы, толстой кишки, почки, кожи, легкого (включая немелкоклеточный рак легкого), печени, желудка, мозга (включая глиобластому), яичников, поджелудочной железы, предстательной железы, мультиформной глиобластомы, остеосаркомы, злокачественных новообразований щитовидной железы, рабдомиосаркомы, и меланомы.

В одном варианте осуществления TAM-ассоциированный рак выбран из лейкозов (включая острый миелоидный лейкоз и хронический миелоидный лейкоз, B-клеточный миелоидный лейкоз (B-CLL), B-клеточный острый лимфобластный лейкоз, эритроидный лейкоз и T-клеточный острый лимфобластный лейкоз), немелкоклеточного рака легкого, протоковой аденокарциномы поджелудочной железы, астроцитомы, аденокарциномы легкого, рака яичников, меланомы и мультиформной глиобластомы.

В одном варианте осуществления TAM-ассоциированный рак выбран из хронического миелоидного лейкоза, гастроинтестинальных стромальных опухолей (GIST), рака молочной железы (например, HER2-положительный рак молочной железы и трижды негативный рак молочной железы), рака головы и шеи, и немелкоклеточного рака легкого.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак представляет собой рак, имеющий сверхэкспрессию ТАМ-киназы, например, по сравнению с нераковой тканью или клеткой у того же пациента или другого субъекта. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак представляет собой рак, имеющий эктопическую экспрессию киназы ТАМ.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак представляет собой рак, имеющий сверхэкспрессию или эктопическую экспрессию белка TYRO3. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак имеет одну или несколько точечных мутаций в гене, кодирующем TYRO3, что приводит к экспрессии TYRO3, которая включает одну или несколько аминокислотных замен. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак имеет хромосомную транслокацию, которая приводит к экспрессии слитого белка, включая киназный домен TYRO3 и партнер по слиянию. Неограничивающие примеры ТАМ-ассоциированного рака, имеющего сверхэкспрессию или эктопическую экспрессию TYRO3, или мутации в гене TYRO3, которая приводит к экспрессии TYRO3, имеющего одну или несколько точечных мутаций, или слитого белка TYRO3, включают: AML, множественную миелому, рак легких, меланому, рак предстательной железы, рак эндометрия, рак щитовидной железы, шванному, рак поджелудочной железы, и рак головного мозга. Неограничивающие аспекты ТАМ-ассоциированного рака, с повышенной экспрессией и/или активностью TYRO3, перечислены в таблице 4.

Таблица 4. Типы TAM-ассоциированного рака с повышенной экспрессией и/или активностью TYRO3

Меланома Аминокислотные замены в: Q67 и/или R462Q, и/или W708fs*5
Рак легких Аминокислотная замена в E340 или N615K в TYRO3
рак поджелудочной железы Аминокислотная замена R514Q в TYRO3
рак толстой кишки Аминокислотная замена G809D и/или M592I в TYRO3
рак головного мозга Аминокислотная замена A709T в TYRO3
AML, множественная миелома, рак легких, меланома, рак предстательной железы, рак эндометрия, рак щитовидной железы и шваннома Сверхэкспрессия или эктопическая экспрессия TYRO3

Дополнительные противораковые средства, которые представляют собой ингибиторы TYRO3, включают, например, 6g, мерестиниб (LY2801653), ASLAN002 (BMS-777607; (N-[4-(2-амино-3-хлорпиридин-4-илокси)-3-фторфенил]-4-этокси-1-(4-фторфенил)-2-оксо-1,2-дигидропиридин-3-карбоксамид), LDC1267 (N-[4-[(6,7-диметоксихинолин-4-ил)окси]-3-фторфенил]-4-этокси-1-(4-фтор-2-метилфенил)-1H-пиразол-3-карбоксамид гидрохлорид, и UNC2025 (транс-4-[2-(бутиламино)-5-[4-[(4-метилпиперазин-1-ил)метил]фенил]-7H-пирроло[2,3-d]пиримидин-7-ил]циклогексанол).

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак представляет собой рак, имеющий сверхэкспрессию или эктопическую экспрессию белка AXL. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак имеет одну или несколько точечных мутаций в гене, кодирующем AXL, что приводит к экспрессии AXL, которая включает одну или несколько аминокислотных замен. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак имеет хромосомную транслокацию, которая приводит к экспрессии слитого белка, включая киназный домен AXL и партнер по слиянию. Неограничивающие примеры TAM-ассоциированного рака, имеющего сверхэкспрессию или эктопическую экспрессию AXL, или мутации в гене AXL, которая приводит к экспрессии AXL, имеющего одну или несколько точечных мутаций, или слитого белка AXL, включают: AML, CML, B-CLL, рак легкого, глиобластому, рак молочной железы, колоректальный рак, рак желудка, рак поджелудочной железы, рак пищевода, меланому, плоскоклеточный рак кожи, рак предстательной железы, рак эндометрия, рак яичников, плоскоклеточную карциному полости рта, рак щитовидной железы, рак мочевого пузыря, рак почки, шванному, мезотелиому, саркому Капоши, остеосаркому, эритроидный лейкоз, рак толстой кишки, рак печени, почечно-клеточную карциному, остеосаркому, рак почки, PH+ CML, немелкоклеточный рак легкого, трижды негативный метастатический рак молочной железы, и HER2+ рак молочной железы. Неограничивающие аспекты типов TAM-ассоциированного рака с повышенной экспрессией и/или активностью AXL, перечислены в таблице 5.

Таблица 5. Типы TAM-ассоциированного рака с повышенной экспрессией и/или активностью AXL

рак яичников аминокислотные замены C24G и/или A358V в AXL
меланома Одна или несколько аминокислотных замен P36L, R236C, G413W, E431K, A451T, E535K, G829E, I610V, A666T, S685F, и R784Q в AXL
рак толстой кишки Одна или несколько аминокислотных замен N43T, M580K, и L684P в AXL
Рак кожи Аминокислотная замена P238L в AXL
рак желудка Одна или несколько аминокислотных замен V289M, R492C, S842F, и P636H в AXL
Рак легких Одна или несколько аминокислотных замен R295W, L423Q, K526N, и S599F в AXL
Рак молочной железы Одна или несколько аминокислотных замен T343M, E745K, и S747R в AXL
рак предстательной железы Аминокислотная замена R368Q в AXL
рак поджелудочной железы Аминокислотная замена E484D в AXL
рак почки Аминокислотная замена P742T в AXL
AML, CML, B-CLL, рак легких, глиобластома, рак молочной железы, колоректальный рак, рак желудка, рак поджелудочной железы, рак пищевода, меланома, плоскоклеточный рак кожи, рак предстательной железы, рак эндометрия, рак яичников, плоскоклеточная карцинома полости рта, рак щитовидной железы, рак мочевого пузыря, рак почки, шваннома, мезотелиома, саркома Капоши и остеосаркома Сверхэкспрессия или эктопическая экспрессия AXL

Дополнительные противораковые средства, которые представляют собой ингибиторы AXL, включают, например, бозитиниб (SKI-606, PF-5208765, Bosulif), бемцентиниб (BGB324; R428), кризотиниб (PF-2341066, Xalkon), форетиниб (GSK1363089, XL880), (N-[4-(2-амино-3-хлорпиридин-4-илокси)-3-фторфенил]-4-этокси-1-(4-фторфенил)-2-оксо-1,2-дигидропиридин-3-карбоксамид (BMS-777607; ASLAN002), LY2801653 (мерестиниб), амуватиниб (MP-470), кабозантиниб (XL184, BMS-907351, Cometriq), глесатиниб (MGCD265), NPS-1034 (2-(4-Фторфенил)-N-[3-фтор-4-(3-фенил-1H-пирроло[2,3-b]пиридин-4-илокси)фенил]-1,5-диметил-3-оксо-2,3-дигидро-1H-пиразол-4-карбоксамид), LDC1267 (N-[4-[(6,7-диметоксихинолин-4-ил)окси]-3-фторфенил]-4-этокси-1-(4-фтор-2-метилфенил)-1H-пиразол-3-карбоксамид гидрохлорид), гилтеритиниб (ASP2215), SGI-7079 ([3-(2-[[3-фтор-4-(4-метилпиперазин-1-ил)фенил]амино]-5-метил-7H-пирроло[2,3-d]пиримидин-4-ил)фенил]ацетонитрил), дуберматиниб (TP-0903), транс-4-[2-(бутиламино)-5-[4-[(4-метилпиперазин-1-ил)метил]фенил]-7H-пирроло[2,3-d]пиримидин-7-ил]циклогексанол (UNC2025), 3-[3-[4-(Морфолин-4-илметил)-1H-пиррол-2-илметилен]-2-оксо-2,3-дигидро-1H-индол-5-илметил]тиазолидин-2,4-дион гидрохлорид (S49076), сунитиниб (SU11248, Sutent), и моноклональные антитела 12A11, Mab173, YW327.6S2, D9, и E8.

В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак представляет собой рак, имеющий сверхэкспрессию или эктопическую экспрессию белка MER. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак имеет одну или несколько точечных мутаций в гене, кодирующем MER, что приводит к экспрессии MER, которая включает одну или несколько аминокислотных замен. В некоторых вариантах осуществления любого из способов, описанных в настоящем документе, TAM-ассоциированный рак имеет хромосомную транслокацию, которая приводит к экспрессии слитого белка, включая киназный домен MER и партнер по слиянию. Неограничивающие примеры ТАМ-ассоциированного рака, имеющего сверхэкспрессию или эктопическую экспрессию MER, или мутации в гене MER, которая приводит к экспрессии MER, имеющего одну или несколько точечных мутаций, или слитого белка MER, включают: AML, ALL (B-ALL, T-ALL), рак легких, глиому, меланому, рак предстательной железы, шванному, мантийноклеточную лимфому, рабдомиосаркому, рак поджелудочной железы, рак молочной железы, рак желудка, аденому гипофиза, рак мочевыводящих путей, рак почки, рак печени, рак толстой кишки и рак молочной железы. Неограничивающие аспекты типов MER-ассоциированного рака с повышенной экспрессией и/или активностью MER перечислены в таблице 6.

Таблица 6. Типы TAM-ассоциированного рака с повышенной экспрессией и/или активностью MER

меланома Одна или несколько аминокислотных замен P40S, V861I, K923R и P802S в MER
Рак легких Одна или несколько аминокислотных замен S159F, I431F, S905F, P672S, N718Y, и M790V в MER
рак мочевыводящих путей Одна или несколько аминокислотных замен E204K, L586F, и S626C в MER
рак желудка Аминокислотные замены S428G в MER
рак почки Аминокислотные замены A446G и/или P958L в MER
рак печени Одна или несколько аминокислотных замен N454S, V873I, и D983N в MER
Лимфома Аминокислотная замена W485S/C в MER
рак толстой кишки Одна или несколько аминокислотных замен D990N, L688M, и R722 в MER
Рак молочной железы Аминокислотная замена G594R в MER
рак головы и шеи Аминокислотная замена A708S в MER
AML, ALL, рак легких, глиома, меланома, рак предстательной железы, шваннома, мантийноклеточная лимфома и рабдомиосаркома Сверхэкспрессия или эктопическая экспрессия MER

Дополнительные противораковые средства, которые представляют собой ингибиторы MER, включают, например, форетиниб, мерестиниб (LY2801653), (N-[4-(2-амино-3-хлорпиридин-4-илокси)-3-фторфенил]-4-этокси-1-(4-фторфенил)-2-оксо-1,2-дигидропиридин-3-карбоксамид (ASLAN002; BMS-777607), [3-(2-[[3-фтор-4-(4-метилпиперазин-1-ил)фенил]амино]-5-метил-7H-пирроло[2,3-d]пиримидин-4-ил)фенил]ацетонитрил (SGI-7079), дуберматиниб (TP-0903), транс-4-[2-(бутиламино)-5-[4-[(4-метилпиперазин-1-ил)метил]фенил]-7H-пирроло[2,3-d]пиримидин-7-ил]циклогексанол (UNC2025), и 3-[3-[4-(морфолин-4-илметил)-1H-пиррол-2-илметилен]-2-оксо-2,3-дигидро-1H-индол-5-илметил]тиазолидин-2,4-дион гидрохлорид (S49076).

Также представлены способы лечения рака (например, TAM-ассоциированного рака и/или c-Met-ассоциированного рака) у пациента, нуждающегося в этом, включающий: (a) определение того, является ли рак у пациента TAM-ассоциированным раком, c-Met-ассоциированным раком или обоими; и (b) если рак определен как TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции. Некоторые варианты осуществления этих способов дополнительно включают введение субъекту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапии). В некоторых вариантах осуществления субъект ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент страдает раком, который резистентен по меньшей мере к одному дополнительному противораковому средству. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

В настоящем документе также представлен способ лечения пациента, у которого диагностирован или определен TAM-ассоциированный рак (например, любой из типичного TAM-ассоциированного рака, описанных в настоящем документе), c-Met-ассоциированный рак (например, любой из типичного c-Met рака, описанных в настоящем документе), или оба, включающий введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или их фармацевтической композиции, как определено в настоящем документе. Некоторые варианты осуществления этих способов дополнительно включают введение субъекту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления субъект ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В одном варианте осуществления у пациента рак, который резистентен к ранее введенному по меньшей мере одному дополнительному противораковому средству. В некоторых вариантах осуществления по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

В одном варианте осуществления, в настоящем документе представлены способы лечения пациента, у которого диагностирован (или определен) рак (например, например, TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба), которые включают введение пациенту терапевтически эффективного количества соединение формулы I или его фармацевтически приемлемой соли. В настоящем документе также представлены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, которые включают введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. В некоторых вариантах осуществления пациент, у которого был определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, посредством использования одобренного регулирующим органом, например, одобренного FDA теста или анализа для определения аномальной (например, повышенной) экспрессии, уровня и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met у пациента или в образце биопсии от пациента, либо путем выполнения любого из неограничивающих примеры анализов, описанных в настоящем документе. В некоторых вариантах осуществления тест или анализ предоставлен в виде набора. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления пациент ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором киназы, иммунотерапией (например, ингибитор контрольных точек иммунного ответа), химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент страдает раком, который резистентен по меньшей мере к одному дополнительному противораковому средству. В некоторых вариантах осуществления по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

Также представлено соединение формулы I или его фармацевтически приемлемая соль для применения в лечении рака у пациента, нуждающегося в этом, или у пациента, у которого определен или диагностирован ТАМ-ассоциированный рак (например, любой из типов ТАМ-ассоциированного рака, описанных в настоящем документе), c-Met-ассоциированный рак (например, любой из типов c-Met-ассоциированного рака, описанных в настоящем документе), или оба. Также представлено применение соединения формулы I или его фармацевтически приемлемой соли для производства лекарственного средства для лечения рака у пациента, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак или оба. В некоторых вариантах осуществления рак представляет собой TAM-ассоциированный рак. В некоторых вариантах осуществления рак представляет собой c-Met-ассоциированный рак. В некоторых вариантах осуществления рак представляет собой как TAM-ассоциированный рак, так и c-Met-ассоциированный рак. В некоторых вариантах осуществления у пациента определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, посредством использования одобренного регулирующим органом, например, одобренного FDA, набора для определения аномальной (например, повышенной) экспрессии, уровня и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой того же или другого субъекта. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапии). В некоторых вариантах осуществления субъект ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором контрольных точек иммунного ответа, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления у пациента рак, резистентный к одному или нескольким из, по меньшей мере, одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

В некоторых вариантах осуществления любого из способов или применений, описанных в настоящем документе, у пациента определен или диагностирован рак, связанный с или имеющий аномальную (например, повышенную) экспрессии, уровня и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой у того же или другого субъекта. В некоторых вариантах осуществления в настоящем документе представлены способы лечения TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих, у пациента, нуждающегося в таком лечении, способ, включающий а) определение аномальной (например, повышенной) экспрессии и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой у того же или другого субъекта; и b) после a), введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапии). В некоторых вариантах осуществления пациент ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

В некоторых вариантах осуществления любого из способов или применений, описанных в настоящем документе, у пациента есть история болезни, указывающая, что пациента имеет опухоль, связанную с аномальной (например, повышенной) экспрессии, уровня и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой у того же пациента или другого субъекта). В некоторых вариантах осуществления в истории болезни указано, что пациента следует лечить одним или несколькими соединениями формулы I или их фармацевтически приемлемыми солями или композициями, представленными в настоящем документе. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления субъект ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

Также представлены способы лечения пациента, которые включают введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли пациенту, имеющему историю болезни, которая указывает на то, что у пациента рак, связанный с или имеющий аномальную (например, повышенную) экспрессию, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой пациента или другого субъекта. Также предусмотрено применение соединения формулы I или его фармацевтически приемлемой соли для производства лекарственного средства для лечения TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих, у пациента, имеющего историю болезни, которая указывает на то, что у пациента рак, связанный или имеющий аномальную (например, повышенную) экспрессию, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой пациента или другого субъекта. Некоторые варианты осуществления этих способов и применений могут дополнительно включать: стадию выполнения анализа образца (например, образца биопсии), полученного от пациента, для определения, есть ли у пациента аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met (например, по сравнению с нераковой тканью или клеткой пациента или другого субъекта), и запись информации в клинический документ пациента (например, машиночитаемый носитель), что у пациента была выявлена аномальная (например, повышенная) экспрессия и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met. В некоторых вариантах осуществления анализ представляет собой анализ in vitro. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления субъект ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

Также в настоящем документе представлен способ лечения пациента, который в этом нуждается. Способ включает выполнение анализа образца, полученного от пациента, для определения, имеет ли субъект аномальную (например, повышенную) экспрессию, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met, например по сравнению с нераковой тканью или клеткой того же пациента или другого субъекта). Способ также включает введение пациенту, у которого определена аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met (например, по сравнению с нераковой тканью или клеткой того же пациента или другого субъекта) терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления пациент ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

Также предоставлены способы (например, способы in vitro) выбора лечения для пациента, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. Некоторые варианты осуществления могут дополнительно включать введение выбранного лечения пациенту, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. Например, выбранное лечение может включать введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. Некоторые варианты осуществления могут дополнительно включать стадию выполнения анализа образца (например, образца биопсии), полученного от пациента, для определения, есть ли у пациента аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met (например, по сравнению с нераковой тканью или клеткой того же пациента или другого субъекта), и определения и диагностики пациента, у которого определена аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met, как имеющего TAM-ассоциированный рак и/или c-Met-ассоциированный рак, соответственно. В некоторых вариантах осуществления у пациента был определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, посредством использования одобренного регулирующим органом, например, одобренного FDA набора для определения аномальной (например, повышенной) экспрессии, уровня и/или активности одной или нескольких киназ ТАМ и/или киназы c-Met у пациента или в образце биопсии пациента. В некоторых вариантах осуществления TAM-ассоциированный рак представляет собой рак, описанный в настоящем документе или известный в данной области. В некоторых вариантах осуществления c-Met-ассоциированный рак представляет собой рак, описанный в настоящем документе или известный в данной области. В некоторых вариантах осуществления анализ представляет собой анализ in vitro. Например, анализ, который использует секвенирование следующего поколения, иммуногистохимию или анализ FISH. В некоторых вариантах осуществления анализ представляет собой одобренный регулирующим органом, например, одобренный FDA, набор. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). Некоторые варианты осуществления этих способов дополнительно включают введение субъекту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления пациент ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором контрольных точек иммунного ответа, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

В настоящем документе также представлены способы выбора лечения для пациента, при этом способы включают стадию выполнения анализа образца, полученного от пациента, для определения, есть ли у пациента аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met, например, по сравнению с нераковой тканью или клеткой пациента или другого субъекта. Некоторые варианты осуществления дополнительно включают введение выбранного лечения пациенту, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. Например, выбранное лечение может включать введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли пациенту, у которого определен или диагностирован TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. В некоторых вариантах осуществления анализ представляет собой анализ in vitro. Некоторые варианты осуществления этих способов дополнительно включают введение пациенту по меньшей мере одного дополнительного противоракового средства (например, иммунотерапия). В некоторых вариантах осуществления пациент ранее получал лечение по меньшей мере одним дополнительным противораковым средством или терапией, например, ингибитором контрольных точек иммунного ответа, ингибитором киназы, иммунотерапией, химиотерапией, лучевой терапией и/или хирургическим вмешательством. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

Также предоставлены способы выбора пациента для лечения, при этом способы включают в себя выбор, определение или диагностику пациента, имеющего TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба, и выбор пациента для лечения, включая введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. В некоторых вариантах осуществления определение или диагностика у пациента TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих, может включать стадию выполнения анализа образца, полученного от пациента, для определения, есть ли у пациента аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met (например, по сравнению с нераковой тканью или клеткой пациента или другого субъекта), имеющего TAM-ассоциированный рак и/или c-Met-ассоциированный рак, соответственно. В некоторых вариантах осуществления способ выбора лечения может использоваться как часть клинического исследования, которое включает введение различных методов лечения TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих. В некоторых вариантах осуществления анализ представляет собой анализ in vitro. Некоторые варианты осуществления этих способов дополнительно включают введение субъекту по меньшей мере одного дополнительного противоракового средства или терапии, например, ингибитора контрольных точек иммунного ответа, ингибитора киназ, иммунотерапии, химиотерапии, лучевой терапии и/или хирургического вмешательства. В некоторых вариантах осуществления пациент имеет рак, резистентный к одному или нескольким из по меньшей мере одного дополнительного противоракового средства. В одном варианте осуществления, по меньшей мере одно дополнительное противораковое средство не включает соединение формулы I.

В некоторых вариантах осуществления любого из способов или применений, описанных в настоящем документе, можно использовать анализ, чтобы определить, есть ли у пациента аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met. В некоторых вариантах осуществления образец представляет собой биологический образец или образец биопсии (например, образец биопсии, залитый парафином) от пациента. В некоторых вариантах осуществления пациент представляет собой пациента с подозрением на наличие TAM-ассоциированного рака, c-Met-ассоциированного рака или обоих, пациента, имеющего один или несколько симптомов TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих, и/или пациента, у которого есть повышенный риск развития TAM-ассоциированного рака, c-Met-ассоциированного рака, или обоих).

В некоторых вариантах осуществления любых способов, описанных в настоящем документе, соединение формулы I или его фармацевтически приемлемую соль вводят в сочетании с терапевтически эффективным количеством по меньшей мере одного дополнительного противоракового средства, выбранного из одного или нескольких дополнительных методов лечения или терапевтических средств, например средство, который действует по тому же или другому механизму действия. В одном варианте осуществления, соединение формулы I выбрано из соединений, описанных в примерах No. 1-201, или их фармацевтически приемлемых солей. В некоторых вариантах осуществления соединение формулы I выбрано из i) примера No. 1-20; ii) примера No. 21-40; iii) примера No. 41-60; iv) примера No. 61-80; v) примера No. 81-100; vi) примера No. 101-120; vii) примера No. 121-140; viii) примера No. 141-160; ix) примера No. 161-180; x) примера No. 181-201 или его фармацевтически приемлемых солей.

Неограничивающие примеры дополнительных противораковых средств включают иммунонаправленные средства, включая иммунотерапевтические средства, противовирусные средства, терапевтические средства, нацеленные на киназу, противовирусные вакцины, противогормональные средства, ингибиторы пути передачи сигнала, химиотерапевтические или другие противораковые средства, ингибиторы ангиогенеза и лучевая терапия.

Одно или несколько дополнительных противораковых средств, описанных в настоящем документе, можно комбинировать с настоящими соединениями в одной лекарственной форме, или настоящие соединения и по меньшей мере одно дополнительное противораковое средство можно вводить одновременно или последовательно в виде отдельных лекарственных форм.

В одном варианте осуществления, соединение формулы I или его фармацевтически приемлемую соль вводят ежедневно в течение 28 последовательных дней в 28-дневном цикле.

В одном варианте осуществления, соединения формулы I или их фармацевтически приемлемые соли могут быть объединены с иммунонаправленными средствами, включая иммунотерапевтические препараты.

Термин «иммунотерапевтические средства» относится к средству, которое модулирует иммунную систему. В некоторых вариантах осуществления иммунотерапия может увеличить экспрессию и/или активность регулятора иммунной системы. В некоторых вариантах осуществления иммунотерапия может уменьшить экспрессию и/или активность регулятора иммунной системы. В некоторых вариантах осуществления иммунотерапия может задействовать и/или усилить активность иммунных клеток.

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой ингибитор контрольных точек иммунного ответа. Используемый в настоящем описании термин «ингибитор контрольных точек иммунного ответа» или «ингибитор иммунных контрольных точек» относится к молекулам, которые полностью или частично снижают, ингибируют, препятствуют или модулируют экспрессию и/или активность одного или нескольких белков контрольных точек. В некоторых вариантах осуществления иммунотерапия включает один или несколько ингибиторов контрольных точек иммунного ответа. В некоторых вариантах осуществления ингибитора контрольных точек иммунного ответа представляет собой ингибитор CTLA-4 (например, анти-CTLA-4 антитело), ингибитор PD-1 (например, анти-PD-1 моноклональное антитело) или ингибитор PD-L1 (например, анти-PD-Ll моноклональное антитело). В некоторых вариантах осуществления ингибитор CTLA-4 представляет собой ипилимумаб (Yervoy®) или тремелимумаб (CP-675,206). В некоторых вариантах осуществления ингибитор PD-1 представляет собой пембролизумаб (Keytruda®), ниволумаб (Opdivo®), или пидилизумаб. В некоторых вариантах осуществления анти-PD-1 моноклональное антитело представляет собой ниволумаб или пембролизумаба. В некоторых вариантах осуществления анти-PDl антитело представляет собой пембролизумаб. В некоторых вариантах осуществления ингибитор PD-L1 представляет собой атезолизумаб (Tecentriq®), авелумаб (Bavencio®), дурвалумаб (Imfinzi™), MEDI4736, или MPDL3280A. В некоторых вариантах осуществления ингибитор PD-1 или PD-L1 является низкомолекулярным (например, описанные в US 2018/305313 и WO 2018/195321). В некоторых вариантах осуществления ингибитор PD-L1 представляет собой атезолизумаб (Tecentriq®), авелумаб (Bavencio®) или дурвалумаб (Imfinzi™). В некоторых вариантах осуществления ингибитор контрольной точки может нацеливаться на 4-1BB (например, урелумаб (BMS-663513) и PF-05082566 (PF-2566)), CD27 (например, варлилумаб (CDX-1127), CD40 (например, CP-870,893), OX40, TIM-3, ICOS, BTLA, A2AR, B7-H3, B7-H4, BTLA, IDO, KIR, LAG3, TIM-3, и VISTA. Дополнительные неограничивающие примеры ингибиторов контрольных точек иммунного ответа включают улокуплумаб, урелумаб, PF 05082566, TRX518, варлилумаб, CP 870893, PDR001MEDI4736, авелумаб, , BMS 986016, MGA271, IPH2201, эмактузумаб, INCB024360, MEDI6469, галунисертиб, BKT140, бавитуксимаб, лирилумаб, бевацизумаб, MNRP1685A, ламброизумаб, CC 90002, BMS-936559 и MGA271.

В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемую соль комбинируют с ингибитором контрольных точек иммунного ответа, где ингибитор контрольных точек иммунного ответа вводят в один или несколько дней в 28-дневном цикле. В одном варианте осуществления соединение формулы I или его фармацевтически приемлемую соль вводят ежедневно в течение 28 последовательных дней в 28-дневном цикле.

В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемую соль комбинируют с ингибитором контрольных точек иммунного ответа, где ингибитор контрольных точек иммунного ответа вводят один раз в неделю. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят каждые две недели. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят каждые три недели. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят каждые 4 недели. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят в 1 день 28-дневного цикла. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят в дни 1 и 7 в 28-дневном цикле. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят в дни 1, 7 и 14 в 28-дневном цикле. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят в дни 1, 7, 14 и 21 в 28-дневном цикле. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят в дни 1, 7, 14 и 28 в 28-дневном цикле. В одном варианте осуществления соединение формулы I или его фармацевтически приемлемую соль вводят ежедневно в течение 28 последовательных дней в 28-дневном цикле. В одном варианте осуществления, ингибитор контрольных точек иммунного ответа вводят внутривенной инфузией.

В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемую соль комбинируют с ингибитором контрольных точек иммунного ответа, где ингибитор контрольных точек иммунного ответа вводят в день 1 циклов с 1 по 13. В одном варианте осуществления соединение формулы I или его фармацевтически приемлемую соль вводят ежедневно в течение 28 последовательных дней в 28-дневном цикле.

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой клеточную иммунотерапию (например, адоптивную Т-клеточную терапию, терапию дендритными клетками или терапию естественными клетками-киллерами). В некоторых вариантах осуществления клеточная иммунотерапия представляет собой сипулейцел-T (APC8015; Provenge™; Plosker (2011) Drugs 71(1): 101-108). В некоторых вариантах осуществления клеточная иммунотерапия включает клетки, которые экспрессируют химерный антигенный рецептор (CAR). В некоторых вариантах осуществления клеточная иммунотерапия представляет собой CAR-T-клеточную терапию. В некоторых вариантах осуществления CAR-T-клеточная терапия представляет собой тисагенлеклейсел (Kymriah™).

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой препараты антител (например, моноклональное антитело, конъюгированное антитело). В некоторых вариантах осуществления препарат антитела представляет собой бевацизумаб (Mvasti™, Avastin®), трастузумаб (Herceptin®), авелумаб (Bavencio®), ритуксимаб (MabThera™, Rituxan®), эдреколомаб (Panorex), даратумумаб (Darzalex®), оларатумаб (Lartruvo™), офатумумаб (Arzerra®), алемтузумаб (Campath®), цетуксимаб (Erbitux®), ореговомаб, пембролизумаб (Keytruda®), динутуксимаб (Unituxin®), обинутузумаб (Gazyva®), тремелимумаб (CP-675,206), рамуцирумаб (Cyramza®), ублитуксимаб (TG-1101), панитумумаб (Vectibix®), элотузумаб (Empliciti™), авелумаб (Bavencio®), нецитумумаб (Portrazza™), цирмтузумаб (UC-961), ибритутомаб (Zevalin®), изатуксимаб (SAR650984), нимотузумаб, фрезолимумаб (GC1008), лирилумаб (INN), могамулизумаб (Poteligeo®), фиклатузумаб (AV-299), деносумаб (Xgeva®), ганитумаб, урелумаб, пидилизумаба, или аматуксимаб.

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой конъюгат антитело-лекарственное средство. В некоторых вариантах осуществления конъюгат антитело-лекарственное средство представляет собой гемтузумаб озогамицин (Mylotarg™), инотузумаб озогамицин (Besponsa®), брентуксимаб ведотин (Adcetris®), адо-трастузумаб эмтанзин (TDM-1; Kadcyla®), мирветуксимаб соравтанзин (IMGN853), или анетумаб равтансин

В некоторых вариантах осуществления иммунотерапия включает блинатумомаб (AMG103; Blincyto®) или мидостаурин (Rydapt).

В некоторых вариантах осуществления иммунотерапевтическое средство включает токсин. В некоторых вариантах осуществления иммунотерапия представляет собой денилейкин дифтитокс (Ontak®).

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой цитокиновую терапию. В некоторых вариантах осуществления цитокиновая терапия представляет собой терапию интерлейкином (IL-2), терапию интерфероном альфа (IFNα), терапию гранулоцитарным колониестимулирующим фактором (G-CSF), терапию интерлейкином 12 (IL-12), терапию интерлейкином 15 (IL-15), терапию интерлейкином 7 (IL-7) или терапия эритропоэтином-альфа (EPO). В некоторых вариантах осуществления терапия IL-2 представляет собой алдеслейкин (Proleukin®). В некоторых вариантах осуществления терапия IFNα представляет собой IntronA® (Roferon-A®). В некоторых вариантах осуществления терапия G-CSF представляет собой филграстим (Neupogen®).

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой ингибирующее иммунотерапевтическое средство на основе нуклеиновых кислот (например, антисмысловые олигонуклеотиды, малые интерферирующие РНК (миРНК) и короткие шпилечные РНК (шРНК). В некоторых вариантах осуществления ингибирующая иммунотерапия на основе нуклеиновых кислот представляет собой CV9104 (см., например, Rausch et al. (2014) Human Vaccine Immunother. 10(11): 3146-52; and Kubler et al. (2015) J. Immunother. Cancer 3:26).

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой терапию на основе бациллы Кальметта-Герена (BCG). В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой терапию онколитическим вирусом. В некоторых вариантах осуществления терапия онколитическим вирусом представляет собой талимоген лагерпарепвек (T-VEC; Imlygic®).

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой противораковую вакцину. В некоторых вариантах осуществления противораковая вакцина представляет собой вакцину против вируса папилломы человека (HPV). В некоторых вариантах осуществления вакцина против HPV представляет собой Gardasil®, Gardasil9® или Cervarix®. В некоторых вариантах осуществления противораковая вакцина представляет собой вакцина против вируса гепатита B (HBV). В некоторых вариантах осуществления вакцина против HBV представляет собой Engerix-B®, Recombivax HB® или GI-13020 (Tarmogen®). В некоторых вариантах осуществления противораковая вакцина представляет собой Twinrix® или Pediarix®. В некоторых вариантах осуществления противораковая вакцина представляет собой BiovaxID®, Oncophage®, GVAX, ADXS11-001, ALVAC-CEA, PROSTVAC®, Rindopepimut®, CimaVax-EGF, lapuleucel-T (APC8024; Neuvenge™), GRNVAC1, GRNVAC2, GRN-1201, hepcortespenlisimut-L (Hepko-V5), DCVAX®, SCIB1, BMT CTN 1401, PrCa VBIR, PANVAC, ProstAtak®, DPX-Survivac, или viagenpumatucel-L (HS-110).

В некоторых вариантах осуществления иммунотерапевтическое средство представляет собой пептидную вакцину. В некоторых вариантах осуществления пептидная вакцина представляет собой Nelipepimut-S (E75) (NeuVax™), IMA901, или SurVaxM (SVN53-67). В некоторых вариантах осуществления противораковая вакцина представляет собой иммуногенную персональную неоантигенную вакцину (см., например, Ott et al. (2017) Nature 547: 217-221; Sahin et al. (2017) Nature 547: 222-226). В некоторых вариантах осуществления противораковая вакцина представляет собой RGSH4K или NEO-PV-01. В некоторых вариантах осуществления противораковая вакцина представляет собой вакцину на основе ДНК. В некоторых вариантах осуществления вакцина на основе ДНК представляет собой ДНК-вакцина маммаглобин-А (см., например, Kim et al. (2016) OncoImmunology 5(2): e1069940).

В некоторых вариантах осуществления иммунонаправленные средства выбраны из альдеслейкина, интерферона альфа-2b, ипилимумаба, ламбролизумаба, ниволумаба, преднизона и сипулейцел-Т.

Подходящие противовирусные средства, предназначенные для использования в комбинации с соединением формулы I или его фармацевтически приемлемой солью, могут включать нуклеозидные и нуклеотидные ингибиторы обратной транскриптазы (RTI), ненуклеозидные ингибиторы обратной транскриптазы (NRTI), ингибиторы протеаз и другие противовирусные препараты.

Примеры подходящих NRTI включают зидовудин (AZT); диданозин (ddl); залцитабин (ddC); ставудин (d4T); ламивудин (3TC); абакавир (1592U89); адефовир дипивоксил [бис(POM)-PMEA]; лобукавир (BMS-180194); BCH-10652; эмитрицитабин [(-)-FTC]; бета-L-FD4 (также называемый бета-L-D4C и называемый бета-L-2',3'-диклеокси-5-фтор-цитиден); DAPD, ((-)-бета-D-2,6,-диамино-пурин диоксолан); и лоденозин (FddA). Типичные подходящие NNRTI включают невирапин (BI-RG-587); делавирадин (BHAP, U-90152); эфавиренц (DMP-266); PNU- 142721; AG-1549; MKC-442 (1-(этокси-метил)-5-(1-метилэтил)-6-(фенилметил)-(2,4(1H,3H)-пиримидинедион); и (+)-каланолид A (NSC-675451) и B. Типичные подходящие ингибиторы протеаз включают саквинавир (Ro 31-8959); ритонавир (ABT-538); индинавир (MK-639); нелфнавир (AG-1343); ампренавир (141W94); лазинавир (BMS-234475); DMP-450; BMS-2322623; ABT-378; и AG-1 549. Другие противовирусные средства включают гидроксимочевину, рибавирин, IL-2, IL-12, пентафузид, и Yissum Project No. 11607.

Соединения формулы I и их фармацевтически приемлемые соли могут использоваться в комбинации с одним или несколькими другими ингибиторами киназ для лечения заболеваний, таких как рак, на которые влияет один или несколько сигнальных путей.

В некоторых вариантах осуществления пациент, который должен получать лечение с помощью описанной в настоящем документе комбинированной терапии, не получал лечение дополнительным противораковым средством до введения комбинированной терапии. В некоторых вариантах осуществления пациент, который должен получать лечение комбинированной терапией, описанной в настоящем документе, ранее получал лечение по меньшей мере одним дополнительным противораковым средством перед введением соединения формулы I для использования отдельно или в комбинированной терапии, описанной в настоящем документе. В некоторых вариантах осуществления у пациента, подлежащего лечению соединением формулы I в качестве монотерапии или в комбинированной терапии, описанной в настоящем документе, развилась лекарственная резистентность к, или у пациента рак, резистентный к по меньшей мере одному дополнительному противораковому средству.

В одном варианте осуществления, соединения формулы I и их фармацевтически приемлемые соли могут быть объединены с одним или несколькими ингибиторами следующих киназ для лечения рака: PIM (PIM l, PIM 2, PIM 3), IDO, AKT l, AKT2 и AKT3, TGFR, PKA, PKG, PKC, CaM-киназа, киназа фосфорилазы, MEKK, ERK, MAPK, mTOR, EGFR, HER2, HER3, HER4, INS-R, IGF-1R, IR-R, PDGFaR, PDGF R, CSFIR, KIT, FLK-II, KDR/FLK-1, FLK-4, flt-1, FGFR, FGFR1, FGFR2, FGFR3, FGFR4, c-MET, Ron, Sea, TRKA, TRKB, TRKC, FLT3, VEGFR/Flt2, Flt4, EphAl, EphA2, EphA3, EphB2, EphB4, Tie2, Src, Fyn, Lck, Fgr, Btk, FAK, SYK, FRK, JAK, ABL, ALK, и B-Raf.

Соединения формулы I и их фармацевтически приемлемые соли также можно использовать в комбинации с одним или несколькими дополнительными противораковыми средствами, такими как химиотерапевтические средства. Примеры химиотерапевтических средств включают любое из: абареликс, альдеслейкин, алемтузумаб, алитретиноин, аллопуринол, альтретамин, анастрозол, триоксид мышьяка, аспарагиназа, азацитидин, бевацизумаб, бексаротен, блеомицин, бортезомиб, бусульфан для внутривенного введения, бусульфан пероральный, калустерон, капецитабин, карбоплатин, кармустин, цетуксимаб, хлорамбуцил, цисплатин, кладрибин, клофарабин, циклофосфамид, цитарабин, дакарбазин, дактиномицин, далтепарин натрия, дазатиниб, даунорубицин, децитабин, денилейкин, денилейкин дифтитокс, дексразоксан, доцетаксел, доксорубицин, дромостанолона пропионат, экулизумаб, эпирубицин, эрлотиниб, эстрамустин, этопозид фосфат, этопозид, экземестан, фентанилцитрат, филграстим, флоксуридин, флударабин, фторурацил, фулвестрант, гефитиниб, гемцитабин, гемтузумаб озогамицин, гозерелина ацетат, гистрелина ацетат, ибритутомаб тиуксетан, идарубицин, ифосфамид, мезилат иматиниба, интерферон альфа 2а, иринотекан, лапатиниб дитозилат, леналидомид, летрозол, лейковорин, лейпролида ацетат, левамизол, ломустин, меклорэтамин, мегестрола ацетат, мелфалан, меркаптопурин, метотрексат, метоксален, митомицин C, митотан, митоксантрон, фенпропионат нандролона, неларабин, нофетумомаб, оксалиплатин, паклитаксел, памидронат, панитумумаб, пегаспаргаза, пегфилграстим, пеметрексед динатрий, пентостатин, пипоброман, пликамицин, прокарбазин, хинакрин, расбуриказа, ритуксимаб, руксолитиниб, сорафениб, стрептозотоцин, сунитиниб, сунитиниб малеат, тамоксифен, темозоломид, тенипозид, тестолактон, талидомид, тиогуанин, тиотепа, топотекан, торемифен, тозитумомаб, трастузумаб, третиноин, урамустин, валрубицин, винбластин, винкристин, винорелбин, вориностат и золедронат.

В некоторых вариантах осуществления ингибиторы пути сигнальной трансдукции включают ингибиторы киназы пути Ras-Raf-MEK-ERK (например, биниметиниб, селуметиниб, энкорафениб, сорафениб, траметиниб, кобиметиниб, дабрафениб и вемурафениб), ингибиторы киназы пути PI3K-AKT-mTOR-S6K (например, эверолимус, рапамицин, перифозин, темсиролимус), и другие ингибиторы киназы, такие как барицитиниб, бригатиниб, капматиниб, данусертиб, ибрутиниб, милциклиб, кверцетин, регорафениб, руксолитиниб, семаксаниб, ((R)-амино-N-[5,6-дигидро-2-(1-метил-1H-пиразол-4-ил)-6-оксо-1H-пирроло[4,3,2-ef][2,3]бензодиазепин-8-ил]-циклогексанацетамид), и TG101209 (N-трет-бутил-3-(5-метил-2-(4-(4-метилпиперазин-1-ил)фениламино)пиримидин-4-иламино)бензолсульфонамид).

Комбинация соединения формулы I в комбинации с биниметинибом, селуметинибом, энкорафенибом, сорафенибом, траметинибом или вемурафенибом приводит к сенсибилизации опухолей, резистентных к биниметинибу, селуметинибу, энкорафенибу, сорафенибу, траметинибу или вемурафенибу соответственно.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба и (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предложена фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) биниметиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) биниметиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) энкорафениб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) энкорафениб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) селуметиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) селуметиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) сорафениб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) сорафениб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) траметиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) траметиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) вемурафениб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) вемурафениб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 37, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 37, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 46, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 46, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 48, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 48, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 55, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 55, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 58, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 58, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 72, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 72, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 76, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 76, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 77, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 77, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 78, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 78, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 83, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 83, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 84, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 84, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 85, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 85, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 91, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 91, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 97, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 97, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 100, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 100, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 103, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 103, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 105, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 105, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 107, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 107, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 108, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 108, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 114, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 114, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 115, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 115, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 119, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 119, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 121, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 121, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 124, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 124, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 125, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 125, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 126, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 126, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 127, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 127, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 129, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 129, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 151, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 151, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 152, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 152, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 163, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 163, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 169, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 169, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 188, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 188, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 190, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 190, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 199, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 199, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 200, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 200, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба, (ii) селуметиниба, (iii) энкорафениба, (iv) сорафениба, (v) траметиниба, (vi) вемурафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) биниметиниба и (ii) энкорафениба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В каждой из вышеуказанных комбинаций соединение формулы I или его фармацевтически приемлемая соль и дополнительное противораковое средство могут быть получены в виде отдельных композиций или дозировок для одновременного, раздельного или последовательного применения для лечения рака, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного противоракового средства вместе эффективны при лечении рака. Также в настоящем документе предложена фармацевтическая композиция, включающая такую комбинацию. В настоящем документе также предложено применение такой комбинации для получения лекарственного средства для лечения рака (например, TAM-ассоциированного рака или c-Met-ассоциированного рака). Также в настоящем документе предложена коммерческая упаковка или продукт, включающий такую комбинацию, как комбинированный препарат для одновременного, раздельного или последовательного применения; и способ лечения рака у пациента, нуждающегося в этом.

Также представлены способы лечения индивидуума, страдающего раком, которые включают введение пациенту, у которого определен или диагностирован рак (например, TAM-ассоциированный рак или c-Met-ассоциированный рак) терапевтически эффективного количества любой из комбинаций.

В настоящем документе также предложены способы лечения пациента, у которого определен или диагностирован TAM-ассоциированный рак или c-Met-ассоциированный, которые включают введение пациенту, у которого определен или диагностирован TAM-ассоциированный рак или c-Met-ассоциированный рак, терапевтически эффективного количества терапевтически эффективного количества любой из комбинаций.

Комбинация соединения формулы I в сочетании с ингибитором EGFR (например, любым из ингибиторов EGFR, описанных в данном документе) приводит к эффективному снижению пролиферации раковых клеток, имеющих резистентность к ингибиторам EGFR, или раковых клеток, имеющих резистентность к ингибиторам c-Met).

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) цетуксимаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) панитумумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) эрлотиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) лапатиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) гефитиниб или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, or 201, или его фармацевтически приемлемую соль или сольват и (b) цетуксимаб (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, или 201, или его фармацевтически приемлемую соль или сольват, и (b) панитумумаб (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, или 201, или его фармацевтически приемлемую соль или сольват и (b) эрлотиниб, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200, или 201, или его фармацевтически приемлемую соль или сольват и (b) лапатиниб, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват и (b) гефитиниб, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 37, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 46, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 48, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 55, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 58, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 72, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 76, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 77, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 78, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 83, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 84, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 85, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 91, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 97, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 100, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 103, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 105, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 107, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 108, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 114, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 115, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 119, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 121, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 124, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 125, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 126, или его фармацевтически приемлемую соль или сольват и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба, и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 127, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 129, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 151, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 152, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 163, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 169, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 188, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 190, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 199, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 200, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) цетуксимаба (или его биосимиляра), (ii) панитумумаба (или его биосимиляра), (iii) эрлотиниба, (iv) лапатиниба и (v) гефитиниба, каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

Комбинация соединения формулы I в сочетании с ингибитором контрольных точек иммунного ответа (например, любым из ингибиторов контрольных точек, описанных в настоящем документе, например, ингибитором PD-1 или PD-L1) приводит к сенсибилизации опухолей к терапии ингибиторами контрольных точек иммунного ответа. Например, соединение формулы I в сочетании с ингибитором контрольных точек иммунного ответа может привести к одному или нескольким (например, двум, трем, четырем или пяти) из увеличения презентации дендритными клетками антигена, увеличения ответа NK-клеток, увеличения направленной миграции Т-клеток, увеличения количества макрофагов 1 типа, что приводит к выработке иммуностимулирующих цитокинов, и усилению как врожденного, так и адаптивного иммунного ответа.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), и (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) ниволумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) пембролизумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) цемиплимаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) пидилизумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) 1141PDCA-170 (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) атезолизумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват и (b) авелумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль или сольват, и (b) дурвалумаб (или его биосимиляр) или его фармацевтически приемлемую соль или сольват.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) ниволумаб (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) пембролизумаб (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) цемиплимаб (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) пидилизумаб (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) 1141PDCA-170 (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) атезолизумаб (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) авелумаба (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, 37, 46, 48, 55, 58, 72, 76, 77, 78, 83, 84, 85, 91, 97, 100, 103, 105, 107, 108, 114, 115, 119, 121, 124, 125, 126, 127, 129, 151, 152, 163, 169, 188, 190, 199, 200 или 201, или его фармацевтически приемлемую соль или сольват, и (b) дурвалумаб (или его биосимиляр), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата и их комбинации.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 25, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 37, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 46, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 48, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 55, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 58, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 72, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 76, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 77, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 78, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 83, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 84, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 85, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 91, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 97, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 100, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 103, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 105, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 107, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 108, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 114, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 115, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 119, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 121, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 124, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 125, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 126, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 127, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), and (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 129, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 151, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 152, или его фармацевтически приемлемую соль или сольват, и ((b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 163, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 169, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 188, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 190, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 199, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 200, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

В одном варианте осуществления, предлагается фармацевтическая комбинация, которая включает (а) соединение примера No. 201, или его фармацевтически приемлемую соль или сольват, и (b) дополнительное противораковое средство, выбранное из группы, состоящей из (i) ниволумаба (или его биосимиляра), (ii) пембролизумаба (или его биосимиляра), (iii) цемиплимаба (или его биосимиляра), (iv) пидилизумаба (или его биосимиляра), (v) 1141PDCA-170 (или его биосимиляра), (vi) атезолизумаба (или его биосимиляра), (vii) авелумаба (или его биосимиляра), и (viii) дурвалумаба (или его биосимиляра), каждый необязательно в форме его фармацевтически приемлемой соли или сольвата, и комбинации любых из них.

Ингибиторы ангиогенеза могут быть эффективными при некоторых опухолях в сочетании с соединениями формулы I или их фармацевтически приемлемыми солями. К ним относятся антитела против VEGF или VEGFR или ингибиторы киназы VEGFR. Антитела или другие терапевтические белки против VEGF включают бевацизумаб и афлиберцепт. Ингибиторы киназ VEGFR и другие ингибиторы антиангиогенеза включают, но не ограничиваются ими, сунитиниб, сорафениб, акситиниб, цедираниб, пазопаниб, регорафениб, бриваниб и вандетаниб.

Неограничивающие примеры лучевой терапии включают радиойодидную терапию, дистанционную лучевую терапию и терапию радием-223.

Неограничивающие примеры хирургического вмешательства включают, например, открытую хирургическую операцию или минимально инвазивную операцию. Оперативное вмешательство может включать, например, удаление всей опухоли, циторедукция опухоли или удаление опухоли, которая вызывает боль или давление у субъекта. Способы выполнения открытой хирургической операции и минимально инвазивной операции у субъекта, страдающего раком, известны в данной области техники.

Соответственно, в настоящем документе также предоставляется способ лечения рака, включающий введение пациенту, нуждающемуся в этом, фармацевтической комбинации для лечения рака, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительное противораковое средство для одновременного, раздельного или последовательного применения для лечения рака, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного противоракового средства вместе эффективны при лечении рака.

В настоящем документе также предоставляется способ лечения рака, включающий введение пациенту, нуждающемуся в этом, фармацевтической комбинации для лечения рака, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительную противораковую терапия, где терапию выбирают из лучевой терапии и хирургического вмешательства. В одном варианте осуществления, дополнительная противораковая терапия представляет собой лучевую терапию. В одном варианте осуществления, дополнительная противораковая терапия представляет собой хирургическое вмешательство.

В некоторых вариантах осуществления дополнительное противораковое средство(а) включает любое из перечисленных выше видов терапии или терапевтических средств, которые являются стандартами лечения раковых заболеваний, где рак представляет собой TAM-ассоциированный рак. В одном варианте осуществления, соединение формулы I, дополнительное противораковое средство представляет собой иммунотерапевтическое средство. В одном варианте осуществления, иммунотерапевтическое средство представляет собой ингибитор CTLA-4 (например, анти-CTLA-4 антитело), ингибитор PD-1 (например, анти-PD-1 моноклональное антитело) или ингибитор PD-L1 (например, анти-PD-Ll моноклональное антитело).

В одном варианте осуществления, в настоящем документе предоставлен способ лечения рака, включающий введение соединения формулы I в комбинации с ингибитором контрольных точек иммунного ответа. В некоторых вариантах осуществления иммунотерапия включает один или несколько ингибиторов контрольных точек иммунного ответа (например, PDR001 или любой из других иллюстративных ингибиторов контрольных точек иммунного ответа, описанных в настоящем документе). В некоторых вариантах осуществления ингибитор контрольных точек иммунного ответа представляет собой ингибитор CTLA-4 (например, анти-CTLA-4 антитело), ингибитор PD-1 (например, анти-PD-1 моноклональное антитело), ингибитор PD-L1 (например, анти-PD-Ll моноклональное антитело), ингибитор NOX2, ингибитор A2A4, ингибитор B7-H3 (например, MGA271), ингибитор B7-H4 (например, анти-B7-H4 антитело, например, описанный в Dangaj et al., Cancer Res. 73(15):4820-4829, 2013), ингибитор IDO (например, коптизин, 1-метил-D-триптофан, NLG-919, индоксимод, 1-DL-метил триптофан, или ингибиторы, описанные в Brastianos et al., JACS 128(50:16046-16047, 2006), ингибитор TIM3, ингибитор LAG3 (например, BMS-986016), ингибитор TIGIT, ингибитор BTLA, ингибитор VISTA (например, 1141PDCA-170), ингибитор ICOS, ингибитор KIR (например, лирилумаб), ингибитор CD39, ингибитор SIGLEC7 или ингибитор SIGLEC9. В некоторых вариантах осуществления ингибитор CTLA-4 представляет собой ипилимумаб (Yervoy®), тремелимумаб (CP-675,206), или аптамеры, описанные в Santulli-Marotto et al., Cancer Res. 63(21):7483-7489, 2003. В некоторых вариантах осуществления ингибитор PD-1 представляет собой пембролизумаб (Keytruda®), ниволумаб (Opdivo®), цемиплимаб (Libtayo®), пидилизумаб или 1141PDCA-170. В некоторых вариантах осуществления анти-PD-1 моноклональное антитело представляет собой ниволумаб или пембролизумаб. В некоторых вариантах осуществления анти-PD-l антитело представляет собой пембролизумаб. В некоторых вариантах осуществления ингибитор PD-L1 представляет собой атезолизумаб (Tecentriq®), авелумаб (Bavencio®), дурвалумаб (Imfinzi™). В некоторых вариантах осуществления ингибитор PD-L1 представляет собой атезолизумаб (Tecentriq®), авелумаб (Bavencio®), или дурвалумаб (Imfinzi™). В одном варианте осуществления, соединение формулы I выбрано из соединений, описанных в примере No. 1-201, или их фармацевтически приемлемых солей. В некоторых вариантах осуществления соединение формулы I выбрано из i) примера No. 1-20; ii) примера No. 21-40; iii) примера No. 41-60; iv) примера No. 61-80; v) примера No. 81-100; vi) примера No. 101-120; vii) примера No. 121-140; viii) примера No. 141-160; ix) примера No. 161-180; x) примера No. 181-201 или его фармацевтически приемлемых солей. В некоторых вариантах осуществления в настоящем документе представлен способ лечения рака, включающий введение пациенту, нуждающемуся в этом, соединения формулы I в комбинации с ингибитором контрольных точек иммунного ответа, при этом пациент дополнительно получает лечение ионизирующим излучением. В одном варианте осуществления, рак сверхэкспрессирует AXL. В одном варианте осуществления, рак не имеет мутации B-RAF. В одном варианте осуществления, рак имеет мутацию B-RAF. В одном варианте осуществления, рак имеет мутацию RAS. В одном варианте осуществления, рак имеет мутацию EGFR. В одном варианте осуществления, рак сверхэкспрессирует MER. В одном варианте осуществления, рак представляет собой рак легких. В одном варианте осуществления, рак представляет собой немелкоклеточный рак легкого (NSCLC). В одном варианте осуществления, рак представляет собой рак толстой кишки. В одном варианте осуществления рак представляет собой рак предстательной железы. В одном варианте осуществления, рак представляет собой меланому. В одном варианте осуществления, рак представляет собой острый лимфобластный лейкоз (ALL). В одном варианте осуществления, рак представляет собой острый миелоидный лейкоз (AML).

Комбинированные методы лечения, как описано в настоящем документе, можно вводить без ограничения порядка, в котором методы лечения назначают пациенту с заболеванием или нарушением, описанным в настоящем документе. Таким образом, в одном варианте осуществления соединение формулы I или его фармацевтически приемлемую соль можно вводить до (например, 5 минут, 15 минут, 30 минут, 45 минут, 1 часа, 2 часов, 4 часов, 6 часов, 12 часов, 24 часов, 36 часов, 48 часов, 72 часов, 96 часов, 1 недели, 2 недель, 3 недель, 4 недель, 5 недель, 6 недель, 8 недель, или 12 недель до), одновременно или после (например, 5 минут, 15 минут, 30 минут, 45 минут, 1 часа, 2 часов, 4 часов, 6 часов, 12 часов, 24 часов, 36 часов, 48 часов, 72 часов, 96 часов, 1 недели, 2 недель, 3 недель, 4 недель, 5 недель, 6 недель, 8 недель, или 12 недель после) введения второго терапевтического средства (например, любого из дополнительных противораковых средств, описанных в настоящем документе) субъекту. В другом варианте осуществления соединение формулы I или его фармацевтически приемлемую соль можно вводить до (например, 5 минут, 15 минут, 30 минут, 45 минут, 1 часа, 2 часов, 4 часов, 6 часов, 12 часов, 24 часов, 36 часов, 48 часов, 72 часов, 96 часов, 1 недели, 2 недель, 3 недель, 4 недель, 5 недель, 6 недель, 8 недель, или 12 недель до), одновременно или после (например, 5 минут, 15 минут, 30 минут, 45 минут, 1 часа, 2 часов, 4 часов, 6 часов, 12 часов, 24 часов, 36 часов, 48 часов, 72 часов, 96 часов, 1 недели, 2 недель, 3 недель, 4 недель, 5 недель, 6 недель, 8 недель, или 12 недель после) введения второго терапевтического средства (например, любое из противораковых средств, описанных в настоящем документе).

В одном варианте осуществления, в настоящем документе представлен способ лечения рака, включающий повышение чувствительности указанного рака к антимитотическому лекарственному средству путем введения соединения формулы I. В одном варианте осуществления, антимитотическое лекарственное средство представляет собой химиотерапевтическое средство на основе таксана, такой как доцетаксел.

В одном варианте осуществления, соединения формулы I можно использовать в сочетании с другими средствами для лечения пациентов, у которых есть первичная или приобретенная резистентность по меньшей мере к одному дополнительному противораковому средству.

В одном варианте осуществления способов, раскрытых в настоящем документе, лечения рака, соединения формулы I можно использовать в качестве монотерапии для лечения пациентов, у которых развилась первичная или приобретенная резистентность по меньшей мере к одному дополнительному противораковому средству.

В одном варианте осуществления, соединения формулы I могут быть использованы для преодоления резистентности по меньшей мере к одному дополнительному противораковому средству при раке. В одном варианте осуществления, соединение формулы I используется в комбинации по меньшей мере с одним дополнительным противораковым средством, к которому у рака развилась резистентность.

В одном варианте осуществления, соединения формулы I могут быть использованы для задержки резистентности по меньшей мере к одному дополнительному противораковому средству. В одном варианте осуществления, соединение формулы I используется в комбинации по меньшей мере с одним дополнительным противораковым средством.

Используемый в настоящем описании термин «резистентность» относится к истории болезни, когда рак не отвечает на таргетную терапию или иммунотерапию. Например, резистентность рака можно наблюдать, например, по снижению скорости увеличения опухолевой массы у субъекта, отсутствию уменьшения опухолевой массы у субъекта, увеличению дозы терапевтического средства в течение времени, необходимого для достижения того же терапевтического эффекта у пациента, и необходимости совместного введения дополнительного противоракового средства для достижения того же терапевтического эффекта, что и предыдущее введение терапевтического средства в качестве монотерапии.

Используемый в настоящем описании термин «первичная резистентность», также известная как истинная резистентность, относится к клиническому сценарию, при котором рак не отвечает на таргетную терапию или иммунотерапию, то есть рак резистентен к терапии, не подвергаясь ранее воздействию этой терапии.

Используемый в настоящем описании термин «приобретенная резистентность» относится к клиническому сценарию, в котором рак первоначально ответил на таргетную терапию или иммунотерапию, но по прошествии определенного периода времени рак перестает отвечать на лечение (например, рак рецидивирует и прогрессирует).

В одном варианте осуществления раскрытых в настоящем документе способов лечения рака соединения формулы I можно использовать в качестве монотерапии для лечения пациентов, у которых развилась первичная или приобретенная резистентность по меньшей мере к одному дополнительному противораковому средству.

В одном варианте осуществления раскрытых в настоящем документе способов лечения рака соединения формулы I могут использоваться в комбинации по меньшей мере с одним дополнительным противораковым средством для лечения пациентов, у которых развилась первичная или приобретенная резистентность к одному или нескольким из по меньшей мере одного дополнительного противоракового средства (например, направленное терапевтическое средство).

Направленные терапевтические средства включают ингибиторы или антитела против EGFR, HER2, VEGFR, c-Met, Ret, IGFR1, PDGFR, FGFR1, FGFR2, FGFR3, FGFR4, TrkA, TrkB, TrkC, ROS, c-Kit, или Flt-3 и против ассоциированных с раком слитых протеинкиназ, таких как Bcr-Abl и EML4-Alk. Ингибиторы против EGFR включают гефитиниб, эрлотиниб, и назартиниб (см., например, патент США No. 10195208 и J. Med. Chem. 59(14):6671-6689, 2016), и ингибиторы против EGFR/Her2 включают, но не ограничиваются ими, дакомитиниб, афатиниб, лапатиниб и нератиниб. Антитела против EGFR включают, но не ограничиваются ими, цетуксимаб, панитумумаб и нецитумумаб. Ингибиторы c-Met могут использоваться в сочетании с соединениями формулы I или их фармацевтически приемлемыми солями. Ингибиторы c-MET включают онартумзумаб, тивантиниб и INC-280. Ингибиторы против FGFR включают, но не ограничиваются ими, AZD4547, BAY1187982, ARQ087, BGJ398, BIBF1120, TKI258, люцитаниб, довитиниб, TAS-120, JNJ-42756493, и Debiol347. Ингибиторы против Trk включают, но не ограничиваются ими, ларотректиниб (LOXO-101), и энтректиниб (RXDX-101). Ингибиторы против Abl (или Bcr-Abl) включают иматиниб, дазатиниб, нилотиниб и понатиниб, и также ингибиторы против Alk (или EML4-ALK) включают кризотиниб.

В одном варианте осуществления, в настоящем документе представлены способы лечения пациента, страдающего раком, который ранее получал лечение первым ингибитором киназы, где первый ингибитор киназы не является соединением формулы I, включающие введение указанному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и предварительно вводимого первого ингибитора киназы. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и предварительно вводимого первого ингибитора киназы. В одном варианте осуществления, соединение формулы I и предварительно вводимый первый ингибитор киназы вводят отдельными дозами последовательно в любом порядке. В одном варианте осуществления, ингибитор киназы представляет собой ингибитор EGFR. В одном варианте осуществления, ингибитор EGFR представляет собой эрлотиниб или лапатиниб. В одном варианте осуществления, ингибитор киназы представляет собой ингибитор PI3Kα. В одном варианте осуществления, ингибитор PI3Kα представляет собой алпелисиб. В одном варианте осуществления, ингибитор киназы представляет собой ингибитор MEK. В одном варианте осуществления, ингибитор MEK представляет собой биниметиниб, U0126 или PD 325901. В одном варианте осуществления, ингибитор киназы представляет собой ингибитор FGFR. В одном варианте осуществления, ингибитор киназы представляет собой ингибитор ALK. В одном варианте осуществления, ингибитор киназы представляет собой ингибитор IGFR1. В одном варианте осуществления, рак представляет собой рак молочной железы (например, трижды негативный рак молочной железы), рак головы и шеи (например, плоскоклеточный рак головы и шеи), немелкоклеточный рак легкого, колоректальный рак, плоскоклеточный рак пищевода или меланому.

В одном варианте осуществления, в настоящем документе представлены способы лечения пациента, страдающего раком, который ранее получал лечение антителом к EGFR, включающие введение указанному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и предварительно вводимого антитела к EGFR. В одном варианте осуществления, соединение формулы I и предварительно вводимое антитело к EGFR вводят отдельными дозами последовательно в любом порядке. В одном варианте осуществления, антитело к EGFR представляет собой цетуксимаб. В одном варианте осуществления, рак представляет собой рак молочной железы, рак головы и шеи, или немелкоклеточный рак легкого

В одном варианте осуществления, в настоящем документе представлены способы лечения пациента, страдающего раком, который ранее получал лечение первым ингибитором киназы, где первый ингибитор киназы не является соединением формулы I, включающие (а) определение, что указанный рак сверхэкспрессирует киназу ТАМ и/или киназу c-Met (например, по сравнению с нераковой тканью или клеткой у пациента или другого субъекта) и (b) после (а) введения указанному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. В одном варианте осуществления, стадия определения того, сверхэкспрессирует ли рак киназу ТАМ и/или киназу c-Met, включает стадию выполнения анализа образца, полученного от пациента, для определения, есть ли у пациента аномальная (например, повышенная) экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met (например, по сравнению с нераковой тканью или клеткой от пациента или другого субъекта), например, AXL и/или MER и/или TYRO3 и/или c-Met. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует AXL. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует MER. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует TYRO3. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует c-Met-киназу. В одном варианте осуществления, способ дополнительно включает получение образца от пациента. В одном варианте осуществления, образец представляет собой биопсийный образец. В одном варианте осуществления, анализ выбран из группы, состоящей из секвенирования, иммуногистохимии, твердофазного иммуноферментного анализа, и флуоресцентной гибридизации in situ (FISH). В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор EGFR. В одном варианте осуществления, ингибитора EGFR представляет собой эрлотиниб или лапатиниб. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор PI3Kα. В одном варианте осуществления, ингибитор PI3Kα представляет собой алпелисиб. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор MEK. В одном варианте осуществления, ингибитора MEK представляет собой биниметиниб, U0126 или PD 325901. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор FGFR. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор ALK. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор IGFR1. В одном варианте осуществления, рак представляет собой рак молочной железы (например, трижды негативный рак молочной железы), рак головы и шеи (например, плоскоклеточный рак головы и шеи), немелкоклеточный рак легкого, колоректальный рак, плоскоклеточный рак пищевода, или меланому. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и первого ингибитора киназы. В одном варианте осуществления, соединение формулы I и ранее назначенный ингибитор киназы вводят отдельными дозами последовательно в любом порядке.

В одном варианте осуществления, в настоящем документе предоставлен способ лечения субъекта, страдающего раком, где способ включает (а) определение того, что раковая клетка в образце, полученном от субъекта, страдающего раком, и которому ранее вводили одну или несколько доз первого ингибитора киназы, где первый ингибитор киназы не является соединением формулы I, сверхэкспрессирует одну или несколько киназ ТАМ и/или киназу c-Met (например, по сравнению с нераковой тканью или клеткой от субъекта или другого субъекта); и (b) введение субъекту соединения формулы I или его фармацевтически приемлемой соли или сольвата в качестве монотерапии или в сочетании с ранее вводимым первым ингибитором киназы. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует AXL. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует MER. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует TYRO3. В одном варианте осуществления, рак, который ранее лечили первым ингибитором киназы, сверхэкспрессирует c-Met-киназу. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор EGFR. В одном варианте осуществления, ингибитор EGFR представляет собой эрлотиниб или лапатиниб. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор PI3Kα. В одном варианте осуществления, ингибитор PI3Kα представляет собой алпелисиб. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор MEK. В одном варианте осуществления, ингибитор MEK представляет собой биниметиниб, U0126 или PD 325901. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор FGFR. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор ALK. В одном варианте осуществления, первый ингибитор киназы представляет собой ингибитор IGFR1. В одном варианте осуществления, рак представляет собой рак молочной железы (например, трижды негативный рак молочной железы), рак головы и шеи (например, плоскоклеточный рак головы и шеи), немелкоклеточный рак легкого, колоректальный рак, плоскоклеточный рак пищевода, или меланому. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и первого ингибитора киназы. В одном варианте осуществления, соединение формулы I и ранее назначенный ингибитор киназы вводят отдельными дозами последовательно в любом порядке.

В одном варианте осуществления раскрытых в настоящем документе способов лечения рака, соединения формулы I можно использовать в качестве монотерапии для лечения пациентов, у которых развилась первичная или приобретенная резистентность к химиотерапии.

В одном варианте осуществления раскрытых в настоящем документе способов лечения рака, соединения формулы I могут использоваться в комбинации с химиотерапевтическим средством для лечения пациентов, у которых развилась первичная или приобретенная резистентность к химиотерапевтическому средству.

В одном варианте осуществления, в настоящем документе представлены способы лечения пациента, страдающего раком, который ранее получал лечение химиотерапевтическим средством, включающие введение указанному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и ранее вводимого химиотерапевтического средства. В одном варианте осуществления, химиотерапевтический препарат выбран из химиотерапии на основе таксана (например, доцетаксел), дексаметазона и цитарабина. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение соединением формулы I в комбинации с ранее вводимым химиотерапевтическим препаратом. В одном варианте осуществления, соединение формулы I и ранее вводимое химиотерапевтическое средство вводят в виде отдельных доз последовательно в любом порядке. В одном варианте осуществления, рак выбран из лейкозов (включая острый миелоидный лейкоз и хронический миелоидный лейкоз, B-клеточный острый лимфобластный лейкоз и T-клеточный острый лимфобластный лейкоз), немелкоклеточного рака легкого, протоковой аденокарциномы поджелудочной железы, астроцитомы, аденокарциномы легкого, рака яичников, меланомы и мультиформной глиобластомы.

В одном варианте осуществления, в настоящем документе представлены способы лечения пациента, страдающего раком, который ранее получал лечение химиотерапевтическим средством, включающие (а) определение, что указанный рак сверхэкспрессирует киназу ТАМ и/или киназу c-Met (например, по сравнению с нераковой тканью или клеткой у пациента или другого субъекта) и (b) после (а) введение указанному пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли. В одном варианте осуществления, стадия определения того, сверхэкспрессирует ли рак киназу ТАМ и/или киназу c-Met, включает стадию выполнения анализа образца, полученного от пациента, для определения, есть ли у пациента аномальная экспрессия, уровень и/или активность одной или нескольких киназ ТАМ и/или киназы c-Met, например, AXL и/или MER, и/или TYRO3 и/или киназы c-Met. В одном варианте осуществления, способ дополнительно включает получение образца от пациента. В одном варианте осуществления, образец представляет собой биопсийный образец. В одном варианте осуществления, анализ выбран из группы, состоящей из секвенирования, иммуногистохимии, твердофазного иммуноферментного анализа и флуоресцентной гибридизации in situ (FISH). В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и ранее вводимого химиотерапевтического средства. В одном варианте осуществления, химиотерапевтический препарат выбран из химиотерапии на основе таксана (например, доцетаксел), дексаметазона и цитарабина. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение соединением формулы I в комбинации с ранее вводимым химиотерапевтическим препаратом. В одном варианте осуществления, соединение формулы I и ранее вводимое химиотерапевтическое средство вводят в виде отдельных доз последовательно в любом порядке. В одном варианте осуществления, рак выбран из лейкозов (включая острый миелоидный лейкоз и хронический миелоидный лейкоз, B-клеточный острый лимфобластный лейкоз и T-клеточный острый лимфобластный лейкоз), немелкоклеточного рака легкого, протоковой аденокарциномы поджелудочной железы, астроцитомы, аденокарциномы легкого, рака яичников, меланомы и мультиформной глиобластомы.

В одном варианте осуществления, в настоящем документе представлен способ лечения субъекта, страдающего раком, где способ включает (а) определение того, что раковая клетка в образце, полученном от субъекта, страдающего раком, и которому ранее вводили одну или несколько доз химиотерапевтического средства, сверхэкспрессирует одну или несколько киназ ТАМ и/или киназу c-Met (например, по сравнению с нераковой тканью или клеткой от субъекта или другого субъекта); и (b) введение соединения формулы I или его фармацевтически приемлемой соли или сольвата в качестве монотерапии или в сочетании с ранее вводимым химиотерапевтическим средством или другим химиотерапевтическим средством. В одном варианте осуществления, рак, который ранее лечили химиотерапевтическим средством, сверхэкспрессирует AXL. В одном варианте осуществления, рак, который ранее лечили химиотерапевтическим средством, сверхэкспрессирует MER. В одном варианте осуществления, рак, который ранее лечили химиотерапевтическим средством, сверхэкспрессирует TYRO3. В одном варианте осуществления, рак, который ранее лечили химиотерапевтическим средством, сверхэкспрессирует c-Met-киназу. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение комбинацией соединения формулы I и ранее вводимого химиотерапевтического средства. В одном варианте осуществления, химиотерапевтический препарат выбран из химиотерапии на основе таксана (например, доцетаксел), дексаметазона и цитарабина. В одном варианте осуществления, пациент получает лечение соединением формулы I в качестве отдельно взятого средства. В одном варианте осуществления, пациент получает лечение соединением формулы I в комбинации с ранее вводимым химиотерапевтическим препаратом. В одном варианте осуществления, соединение формулы I и ранее вводимое химиотерапевтическое средство вводят в виде отдельных доз последовательно в любом порядке. В одном варианте осуществления, рак выбран из лейкозов (включая острый миелоидный лейкоз и хронический миелоидный лейкоз, B-клеточный острый лимфобластный лейкоз и T-клеточный острый лимфобластный лейкоз), немелкоклеточного рака легкого, протоковой аденокарциномы поджелудочной железы, астроцитомы, аденокарциномы легкого, рака яичников, меланомы и мультиформной глиобластомы.

В настоящем документе также представлена (i) фармацевтическая комбинация для лечения рака у пациента, нуждающегося в этом, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) по меньшей мере одно дополнительное противораковое средство (например, любое из примеров дополнительных противораковых средств, описанных в настоящем документе или известных в данной области), для одновременного, раздельного или последовательного применения для лечения рака, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного противоракового средства вместе эффективны при лечении рака; (ii) фармацевтическая композиция, включающая такую комбинацию; (iii) использование такой комбинации для получения лекарственного средства для лечения рака; и (iv) коммерческая упаковка или продукт, включающий такую комбинацию, как комбинированный препарат для одновременного, раздельного или последовательного применения; и к способу лечения рака у пациента, нуждающегося в этом. В одном варианте осуществления пациент представляет собой человека. В некоторых вариантах осуществления рак представляет собой TAM-ассоциированный рак.

Термин «фармацевтическая комбинация», используемый в настоящем документе, относится к фармацевтической лекарственной форме, полученной в результате смешивания или объединения более чем одного активного ингредиента, и включает как фиксированные, так и нефиксированные комбинации активных ингредиентов. Термин «фиксированная комбинация» означает, что соединение формулы I или его фармацевтически приемлемую соль и по меньшей мере одно дополнительное противораковое средство (например, химиотерапевтическое средство) вводят пациенту одновременно в форме одной композиции или дозы. Термин «нефиксированная комбинация» означает, что соединение формулы I или его фармацевтически приемлемую соль и по меньшей мере одно дополнительное противораковое средство (например, химиотерапевтическое средство) сформулированы в виде отдельных композиций или доз, так что их можно вводить пациенту, нуждающемуся в этом, одновременно, раздельно или последовательно, без каких-либо конкретных временных ограничений, где такое введение обеспечивает эффективные уровни двух или более соединений в организме пациента. Это также относится к смеси препаратов, например введение трех или более активных ингредиентов

Соответственно, в настоящем документе также представлен способ лечения рака, включающий введение пациенту, нуждающемуся в этом, фармацевтической комбинации для лечения рака, которая включает (а) соединение формулы I или его фармацевтически приемлемую соль, и (b) дополнительное противораковое средство, для одновременного, раздельного или последовательного применения для лечения рака, где количества соединения формулы I или его фармацевтически приемлемой соли и дополнительного противоракового средства вместе эффективны при лечении рака. В одном варианте осуществления, соединение формулы I или его фармацевтически приемлемую соль и дополнительное противораковое средство вводят одновременно в виде отдельных доз. В одном варианте осуществления, соединение формулы I или его фармацевтически приемлемую соль и дополнительное противораковое средство вводят отдельными дозами последовательно в любом порядке, в совместно терапевтически эффективных количествах, например в суточных или дискретных дозах. В одном варианте осуществления, соединение формулы I или его фармацевтически приемлемую соль и дополнительное противораковое средство вводят одновременно в виде комбинированной дозы.

Соответственно, в настоящем документе также представлены способы ингибирования, предупреждения, содействия в профилактике или уменьшения симптомов метастазирования рака у пациента, нуждающегося в этом, включающий введение пациенту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или его фармацевтической композиции. Такие методы можно применять при лечении одного или нескольких видов рака, описанных в настоящем документе. В некоторых вариантах осуществления рак представляет собой TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. В некоторых вариантах осуществления соединение формулы I или его фармацевтически приемлемую соль используют в комбинации с дополнительным противораковым средством, включая иммунотерапию.

Термин «метастазирование» является известным в данной области термином и означает образование дополнительной опухоли (например, солидной опухоли) на участке, удаленном от первичной опухоли у субъекта или пациента, где дополнительная опухоль включает такие же или аналогичные раковые клетки, как первичная опухоль.

Также представлены способы снижения риска развития метастазов или дополнительных метастазов у пациента, страдающего TAM-ассоциированным раком, c-Met-ассоциированным раком, или обоими, которые включают: выбор, определение или диагностику у пациента TAM-ассоциированного рака, c-Met-ассоциированного рака или обоих, и введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли пациенту, выбранному, определенному или диагностированному, как имеющий TAM-ассоциированный рак, c-Met-ассоциированный рак, или оба. Также представлены способы снижения риска развития метастазов или дополнительных метастазов у пациента, страдающего TAM-ассоциированным раком, c-Met-ассоциированным раком, или обоими, которые включают введение терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли или растворителя пациенту, страдающему TAM-ассоциированным раком, c-Met-ассоциированным раком или обоими. Снижение риска развития метастаза или дополнительного метастаза у пациента, страдающего TAM-ассоциированным раком, c-Met-ассоциированным раком или обоими, можно сравнить с риском развития метастаза или дополнительного метастаза у пациента до лечения, или по сравнению с пациентом или группой пациентов, страдающих аналогичным или тем же TAM-ассоциированным раком, c-Met-ассоциированным раком или обеими, которые не получали никакого лечения или получали другое лечение.

Фраза «риск развития метастазов» означает риск того, что у субъекта или пациента с первичной опухолью разовьется дополнительная опухоль (например, солидная опухоль) на участке, удаленном от первичной опухоли у субъекта или пациента в течение установленного периода времени, где дополнительная опухоль включает те же или аналогичные раковые клетки, что и первичная опухоль. Способы снижения риска развития метастазов у субъекта или пациента, страдающего раком, описаны в настоящем документе.

Фраза «риск развития дополнительных метастазов» означает риск того, что у субъекта или пациента, имеющего первичную опухоль и одну или несколько дополнительных опухолей на участках, удаленных от первичной опухоли (где одна или несколько дополнительных опухолей включают те же или подобные раковые клетки, что и первичная опухоль), разовьется одна или несколько дополнительных опухолей, удаленных от первичной опухоли, где дополнительные опухоли включают те же или аналогичные раковые клетки, что и первичная опухоль. Способы снижения риска развития дополнительных метастазов описаны в настоящем документе.

Также представлен способ ингибирования активности киназы ТАМ и/или ингибирования активности киназы c-Met в клетке (например, клетке млекопитающего), включающий приведение в контакт клетки с соединением формулы I или его фармацевтически приемлемой солью, или их фармацевтической композицией. В одном варианте осуществления, приведение в контакт осуществляется in vitro. В одном варианте осуществления, приведение в контакт осуществляется in vivo. В одном варианте осуществления, приведение в контакт осуществляется in vivo, где способ включает введение эффективного количества соединения формулы I или его фармацевтически приемлемой соли субъекту, имеющему клетку, обладающую активностью киназы ТАМ и/или активностью киназы c-Met. В некоторых вариантах осуществления клетка является раковой клеткой (например, раковой клеткой человека). В одном варианте осуществления, раковая клетка представляет собой любой рак, как описано в настоящем документе. В некоторых вариантах осуществления раковая клетка представляет собой ТАМ-ассоциированную раковую клетку. В некоторых вариантах осуществления раковая клетка представляет собой c-Met-ассоциированную раковую клетку. В некоторых вариантах осуществления раковая клетка представляет собой как ТАМ-ассоциированную раковую клетку, так и c-Met-ассоциированную раковую клетку.

В некоторых вариантах осуществления клетка млекопитающего находится in vitro. В некоторых вариантах осуществления клетка млекопитающего находится in vivo. В некоторых вариантах осуществления клетка млекопитающего находится ex vivo.

В настоящем документе также предложен способ ингибирования пролиферации клеток in vitro или in vivo, включающий приведение клетки в контакт с эффективным количеством соединения формулы I или его фармацевтически приемлемой соли, или его фармацевтической композиции, как определено в настоящем документе.

В настоящем документе также предложены способы снижения иммунной толерантности у субъекта, нуждающегося в этом, которые включают введение субъекту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или его фармацевтической композиции, как определено в настоящем документе. Используемый в настоящем описании термин “иммунная толерантность” относится к снижению (например, от 1% до примерно 99% снижения, или любого из поддиапазонов этого диапазона, описанного в настоящем документе) одного или нескольких из: процессинга связанных с опухолью антигенов антигенпредставляющими клетками (например, дендритными клетками), презентации антигенов специфическим в отношении опухолевых антигенов T-клеткам, активации и пролиферации специфических в отношении опухолевых антигенов T-клеток и поддержание Т-клеточного ответа у субъекта (например, в солидной опухоли у субъекта), например, по сравнению с контролем (например, соответствующий уровень у аналогичного субъекта, у которого нет рака)). В некоторых вариантах осуществления этих способов у субъекта был определен или диагностирован рак (например, TAM-ассоциированный рак (например, любой из типичных видов TAM-ассоциированного рака, описанных в настоящем документе), c-Met-ассоциированный рак (например, любой из типичных видов c-Met-ассоциированного рака, описанных в настоящем документе), или оба). В некоторых примерах снижение иммунной толерантности у субъекта может быть обнаружено путем наблюдения от примерно 1% до примерно 99% (например, от примерно 1% до примерно 95%, от примерно 1% до примерно 90%, от примерно 1% до примерно 85%, от примерно 1% до примерно 80%, от примерно 1% до примерно 75%, от примерно 1% до примерно 70%, от примерно 1% до примерно 65%, от примерно 1% до примерно 60%, от примерно 1% до примерно 55%, от примерно 1% до примерно 50%, от примерно 1% до примерно 45%, от примерно 1% до примерно 40%, от примерно 1% до примерно 35%, от примерно 1% до примерно 30%, от примерно 1% до примерно 25%, от примерно 1% до примерно 20%, от примерно 1% до примерно 15%, от примерно 1% до примерно 10%, от примерно 1% до примерно 5%, от примерно 5% до примерно 99%, от примерно 5% до примерно 90%, от примерно 5% до примерно 85%, от примерно 5% до примерно 80%, от примерно 5% до примерно 75%, от примерно 5% до примерно 70%, от примерно 5% до примерно 65%, от примерно 5% до примерно 60%, от примерно 5% до примерно 55%, от примерно 5% до примерно 50%, от примерно 5% до примерно 45%, от примерно 5% до примерно 40%, от примерно 5% до примерно 35%, от примерно 5% до примерно 30%, от примерно 5% до примерно 25%, от примерно 5% до примерно 20%, от примерно 5% до примерно 10%, от примерно 10% до примерно 99%, от примерно 10% до примерно 95%, от примерно 10% до примерно 90%, от примерно 10% до примерно 85%, от примерно 10% до примерно 80%, от примерно 10% до примерно 75%, от примерно 10% до примерно 70%, от примерно 10% до примерно 65%, от примерно 10% до примерно 60%, от примерно 10% до примерно 55%, от примерно 10% до примерно 50%, от примерно 10% до примерно 45%, от примерно 10% до примерно 40%, от примерно 10% до примерно 35%, от примерно 10% до примерно 30%, от примерно 10% до примерно 25%, от примерно 10% до примерно 20%, от примерно 10% до примерно 15%, от примерно 15% до примерно 99%, от примерно 15% до примерно 95%, от примерно 15% до примерно 90%, от примерно 15% до примерно 85%, от примерно 15% до примерно 80%, от примерно 15% до примерно 75%, от примерно 15% до примерно 70%, от примерно 15% до примерно 65%, от примерно 15% до примерно 60%, от примерно 15% до примерно 55%, от примерно 15% до примерно 50%, от примерно 15% до примерно 45%, от примерно 15% до примерно 40%, от примерно 15% до примерно 35%, от примерно 15% до примерно 30%, от примерно 15% до примерно 25%, от примерно 15% до примерно 20%, от примерно 20% до примерно 99%, от примерно 20% до примерно 95%, от примерно 20% до примерно 90%, от примерно 20% до примерно 85%, от примерно 20% до примерно 80%, от примерно 20% до примерно 75%, от примерно 20% до примерно 70%, от примерно 20% до примерно 65%, от примерно 20% до примерно 60%, от примерно 20% до примерно 55%, от примерно 20% до примерно 50%, от примерно 20% до примерно 45%, от примерно 20% до примерно 40%, от примерно 20% до примерно 35%, от примерно 20% до примерно 30%, от примерно 20% до примерно 25%, от примерно 25% до примерно 99%, от примерно 25% до примерно 95%, от примерно 25% до примерно 90%, от примерно 25% до примерно 85%, от примерно 25% до примерно 80%, от примерно 25% до примерно 75%, от примерно 25% до примерно 70%, от примерно 25% до примерно 65%, от примерно 25% до примерно 60%, от примерно 25% до примерно 55%, от примерно 25% до примерно 50%, от примерно 25% до примерно 45%, от примерно 25% до примерно 40%, от примерно 25% до примерно 35%, от примерно 25% до примерно 30%, от примерно 30% до примерно 99%, от примерно 30% до примерно 95%, от примерно 30% до примерно 90%, от примерно 30% до примерно 85%, от примерно 30% до примерно 80%, от примерно 30% до примерно 75%, от примерно 30% до примерно 70%, от примерно 30% до примерно 65%, от примерно 30% до примерно 60%, от примерно 30% до примерно 55%, от примерно 30% до примерно 50%, от примерно 30% до примерно 45%, от примерно 30% до примерно 40%, от примерно 30% до примерно 35%, от примерно 35% до примерно 99%, от примерно 35% до примерно 95%, от примерно 35% до примерно 90%, от примерно 35% до примерно 85%, от примерно 35% до примерно 80%, от примерно 35% до примерно 75%, от примерно 35% до примерно 70%, от примерно 35% до примерно 65%, от примерно 35% до примерно 60%, от примерно 35% до примерно 55%, от примерно 35% до примерно 50%, от примерно 35% до примерно 45%, от примерно 35% до примерно 40%, от примерно 40% до примерно 99%, от примерно 40% до примерно 95%, от примерно 40% до примерно 90%, от примерно 40% до примерно 85%, от примерно 40% до примерно 80%, от примерно 40% до примерно 75%, от примерно 40% до примерно 70%, от примерно 40% до примерно 65%, от примерно 40% до примерно 60%, от примерно 40% до примерно 55%, от примерно 40% до примерно 50%, от примерно 40% до примерно 45%, от примерно 45% до примерно 99%, от примерно 45% до примерно 95%, от примерно 45% до примерно 90%, от примерно 45% до примерно 85%, от примерно 45% до примерно 80%, от примерно 45% до примерно 75%, от примерно 45% до примерно 70%, от примерно 45% до примерно 65%, от примерно 45% до примерно 60%, от примерно 45% до примерно 55%, от примерно 45% до примерно 50%, от примерно 50% до примерно 99%, от примерно 50% до примерно 95%, от примерно 50% до примерно 90%, от примерно 50% до примерно 85%, от примерно 50% до примерно 80%, от примерно 50% до примерно 75%, от примерно 50% до примерно 70%, от примерно 50% до примерно 65%, от примерно 50% до примерно 60%, от примерно 50% до примерно 55%, от примерно 55% до примерно 99%, от примерно 55% до примерно 95%, от примерно 55% до примерно 90%, от примерно 55% до примерно 85%, от примерно 55% до примерно 80%, от примерно 55% до примерно 75%, от примерно 55% до примерно 70%, от примерно 55% до примерно 65%, от примерно 55% до примерно 60%, от примерно 60% до примерно 99%, от примерно 60% до примерно 95%, от примерно 60% до примерно 90%, от примерно 60% до примерно 85%, от примерно 60% до примерно 80%, от примерно 60% до примерно 75%, от примерно 60% до примерно 70%, от примерно 60% до примерно 65%, от примерно 65% до примерно 99%, от примерно 65% до примерно 95%, от примерно 65% до примерно 90%, от примерно 65% до примерно 85%, от примерно 65% до примерно 80%, от примерно 65% до примерно 75%, от примерно 65% до примерно 70%, от примерно 70% до примерно 99%, от примерно 70% до примерно 95%, от примерно 70% до примерно 90%, от примерно 70% до примерно 85%, от примерно 70% до примерно 80%, от примерно 70% до примерно 75%, от примерно 75% до примерно 99%, от примерно 75% до примерно 95%, от примерно 75% до примерно 90%, от примерно 75% до примерно 85%, от примерно 75% до примерно 80%, от примерно 80% до примерно 99%, от примерно 80% до примерно 95%, от примерно 80% до примерно 90%, от примерно 80% до примерно 85%, от примерно 85% до примерно 99%, от примерно 85% до примерно 95%, от примерно 85% до примерно 90%, от примерно 90% до примерно 99%, от примерно 90% до примерно 95%, или от примерно 95% до примерно 99%) снижения уровня супрессорных клеток миелоидного происхождения (MDSC) (например, клеток, характеризующихся экспрессией CD33, CD14 и низкими уровнями HLA DR) у субъекта (например, в образце, содержащем кровь, или образце биопсии, полученном от субъекта) (например, по сравнению с уровнем MDSC у субъекта до начала лечения (например, до введения любого из соединений формулы I или любой из описанных в настоящем документе фармацевтических композиций).

В некоторых примерах снижение иммунной толерантности у субъекта может быть определено путем наблюдения от примерно 1% до примерно 99% (или любого из поддиапазонов этого диапазона, описанного в настоящем документе) снижения уровня Treg-клеток (например, клеток, характеризующихся экспрессией CD4, FOXP3 и CD25) у субъекта (например, в образце, содержащем кровь, или образце биопсии, полученном от субъекта) (например, по сравнению с уровнем Treg у субъекта до начала лечения (например, до введения любого из соединений формулы I или любой из описанных в настоящем документе фармацевтических композиций).

В некоторых примерах снижение иммунной толерантности у субъекта может быть определено путем наблюдения от примерно 1% до примерно 99% (или любого из поддиапазонов этого диапазона, описанного в настоящем документе) снижения уровня дендритных клеток со сниженной экспрессией CD80/CD86 у субъекта (например, в образце, содержащем кровь, или образце биопсии, полученном от субъекта) (например, по сравнению с уровнем дендритных клеток со сниженной экспрессией CD80/CD86 у субъекта до начала лечения (например, до введения любого из соединений формулы I или любой из описанных в настоящем документе фармацевтических композиций). Примеры способов определения уровней MDSC, Treg и дендритных клеток со сниженной экспрессией CD80/CD86 включают сортировку клеток с помощью флуоресценции и иммунофлуоресцентную микроскопию.

В настоящем документе также представлены способы ингибирования ангиогенеза у субъекта, нуждающегося в этом, причем способ включает введение субъекту терапевтически эффективного количества соединения формулы I или его фармацевтически приемлемой соли, или их фармацевтической композиции, как определено в настоящем документе. В некоторых вариантах осуществления ангиогенез представляет собой ангиогенез опухоли, и у субъекта был определен или диагностирован рак (например, TAM-ассоциированный рак, рак, связанный с c-Met, или оба). В некоторых вариантах осуществления эти способы приводят к снижению (например, от 1% до примерно 99% снижения, или любого из поддиапазонов этого диапазона, описанного в настоящем документе) скорости развития новых кровеносных сосудов (например, по сравнению со скоростью развития новых кровеносных сосудов у аналогичного субъекта, получавшего плацебо или другое лечение в течение аналогичного периода времени). Примеры методов обнаружения образования новых кровеносных сосудов включают ультразвуковую допплерографию (например, цветовое доплеровское картирование), оптическую диффузионную томографию под ультразвуковым контролем, МРТ, перфузионную КТ (также называемую функциональная мультидетекторная спиральная КТ (f-MDCT)), позитронно-эмиссионную томографию (ПЭТ), динамическую МРТ, МРТ с контрастным усилением динамической восприимчивости (DSC-MRI) и T1-взвешенная динамическая МРТ (DCE-MRI). Неограничивающие методы, которые можно использовать для обнаружения образования новых кровеносных сосудов (ангиогенеза), описаны в Jeswani et al., Cancer Imaging 5(1):131-138, 2005.

В настоящем документе также предложены способы подавления (например, снижения, например, от 1% до примерно 99% снижения, или любого из поддиапазонов этого диапазона, описанного в настоящем документе) резистентности к терапевтическому средству у субъекта, нуждающегося в этом, которые включают введение субъекту терапевтически эффективного количества (i) соединения формулы I или его фармацевтически приемлемой соли, или любой из его фармацевтических композиций, описанных в настоящем документе, и (ii) терапевтического средства, где терапевтическое средство выбрано из группы, состоящей из химиотерапевтического средства, ингибитора PI-3-киназы, ингибитора EGFR, ингибитора HER2/neu, ингибитора FGFR, ингибитора ALK, ингибитора IGF1R, ингибитора VEGFR, ингибитора PDGFR, глюкокортикоида, ингибитора BRAF, ингибитора MEK, ингибитора HER4, ингибитора MET, ингибитора RAF, ингибитора Akt, ингибитора FTL-3 и ингибитора пути МАР-киназы. В некоторых примерах этих способов ингибитор c-Met представляет собой ингибитор c-Met типа 1, например, кризотиниб, капматиниб, NVP-BVU972, AMG 337, бозитиниб, глуметиниб, саволитиниб или тепотиниб. В некоторых примерах этих способов соединение формулы I или его фармацевтически приемлемую соль, или его фармацевтическую композицию и терапевтическое средство вводят субъекту практически в одно и то же время. В некоторых вариантах осуществления этих способов соединение формулы I или его фармацевтически приемлемую соль, или их фармацевтическую композицию, и терапевтическое средство формулируют в единую лекарственную форму. В некоторых вариантах осуществления этих способов (i) соединение формулы I или его фармацевтическую соль, или любую из их фармацевтических композиций, описанных в настоящем документе, вводят субъекту до введения (ii) терапевтического средства субъекту. В некоторых вариантах осуществления этих способов (ii) терапевтическое средство вводят субъекту перед введением (i) соединения формулы I или его фармацевтической соли, или любой из их фармацевтических композиций, описанных в настоящем документе.

В некоторых вариантах осуществления этих способов соединение формулы I или его фармацевтически приемлемую соль, или их фармацевтическую композицию вводят субъекту до введения терапевтического средства субъекту. В некоторых вариантах осуществления этих способов терапевтическое средство вводят субъекту до введения субъекту соединения формулы I или его фармацевтически приемлемой соли или их фармацевтической композиции.

Используемый в настоящем документе термин «резистентность к терапевтическому средству» относится к пониженному или уменьшенному уровню чувствительности к лечению терапевтическим средством (например, химиотерапевтическим средством, ингибитором PI-3-киназы, ингибитором EGFR, ингибитором HER2/neu, ингибитором FGFR, ингибитором ALK, ингибитором IGF1R, ингибитором VEGFR, ингибитором PDGFR, глюкокортикоидом, ингибитором BRAF, ингибитором MEK, ингибитором HER4, ингибитором MET (например, ингибитором c-Met-киназы 1 типа, например, кризотиниб, капматиниб и NVP-BVU972), ингибитором RAF, ингибитором Akt, ингибитором FTL-3 и ингибитором пути МАР-киназы) у субъекта (например, по сравнению с аналогичным субъектом или по сравнению с уровнем чувствительность к терапевтическому средству в более ранний момент времени). Например, резистентность к терапевтическому средству у субъекта может наблюдаться врачом, например, посредством наблюдения необходимости в увеличении величины доз терапевтического средства с течением времени для достижения того же терапевтического эффекта у субъекта, наблюдения необходимости в увеличении количества доз и/или увеличения частоты введения доз терапевтического средства с течением времени для достижения того же терапевтического эффекта у субъекта, снижение наблюдаемого терапевтического ответа на лечение той же дозировкой терапевтического средства с течением времени или наблюдаемое прогрессирование заболевания или рецидив заболевания у субъекта, которому вводят терапевтическое средство

При использовании в качестве фармацевтических препаратов соединения формулы I можно вводить в форме фармацевтических композиций. Эти композиции могут быть получены способом, хорошо известным в фармацевтике, и могут вводиться различными путями, в зависимости от того, требуется ли местное или системное лечение, и от области, подлежащей лечению. Введение может быть местным (включая трансдермальное, эпидермальное, офтальмологическое и на слизистые оболочки, включая интраназальное, вагинальное и ректальное введение), пульмональным (например, путем ингаляции или инсуффляции порошков или аэрозолей, в том числе с помощью небулайзера; интратрахеально или интраназально), пероральным или парентеральным. Пероральное введение может включать лекарственную форму, составленную для введения один раз в день или два раза в день (BID). Парентеральное введение включает внутривенное, внутриартериальное, подкожное, внутрибрюшинное внутримышечное введение или инъекцию или инфузию; или интракраниальное, например интратекальное или интравентрикулярное введение. Парентеральное введение может быть в форме однократной болюсной дозы или может осуществляться, например, с помощью перфузионного насоса непрерывного действия. Фармацевтические композиции и лекарственные формы для местного применения могут включать трансдермальные пластыри, мази, лосьоны, кремы, гели, капли, суппозитории, спреи, жидкости и порошки. Могут быть необходимы или желательны обычные фармацевтические носители, водные, порошковые или масляные основы, загустители и т.п. В одном варианте осуществления, соединение формулы I получают в виде таблетки. В одном варианте осуществления, соединение формулы I получают в виде карсулы. В одном варианте осуществления, соединение формулы I вводят перорально. В одном варианте осуществления, соединение формулы I вводят перорально один раз в день. В одном варианте осуществления, соединение формулы I вводят перорально два раза в день.

В настоящем документе также представлены фармацевтические композиции, которые включают в качестве активного ингредиента соединение формулы I или его фармацевтически приемлемую соль в комбинации с одним или несколькими фармацевтически приемлемыми носителями (эксципиентами). В некоторых вариантах осуществления композиция подходит для местного применения. При получении композиций, представленных в настоящем описании, активный ингредиент обычно смешивают с эксципиентом, разбавляют эксципиентом или заключают в такой носитель в виде, например, капсулы, саше, бумаги или другого контейнера. Когда эксципиент служит разбавителем, он может быть твердым, полутвердым или жидким материалом, который действует как наполнитель, носитель или среда для активного ингредиента. Таким образом, композиции могут быть в форме таблеток, пилюль, порошков, пастилок, саше, облаток, эликсиров, суспензий, эмульсий, растворов, сиропов, аэрозолей (в твердой или жидкой среде), мазей, содержащих, например, до 10% по массе активного соединения, мягких и твердых желатиновых капсул, суппозиториев, стерильных растворов для инъекций и порошков в стерильной упаковке. В одном варианте осуществления, композиция сформулирована для перорального применения. В одном варианте осуществления, композиция сформулирована в виде таблетки или капсулы.

Композиции, включающие соединение формулы I или его фармацевтически приемлемую соль, могут быть сформулированы в виде стандартной лекарственной формы, каждая доза содержит от примерно 5 до примерно 1000 мг (1 г), чаще от примерно 100 мг до примерно 500 мг, активного компонента. Термин «стандартная лекарственная форма» относится к физически дискретным единицам, подходящим в качестве единичных доз для человека и других пациентов, каждая единица содержит заранее определенное количество активного вещества (т.е. соединения формулы I, как представлено в настоящем описании), рассчитанное для получения желаемого терапевтического эффекта, в сочетании с подходящим фармацевтическим эксципиентом.

В некоторых вариантах осуществления композиции, представленные в настоящем документе, включают от примерно 5 мг до примерно 50 мг активного ингредиента. Специалистам в данной области должно быть понятно, что настоящее изобретение включает соединения или композиции, содержащие от примерно 5 мг до примерно 10 мг, от примерно 10 мг до примерно 15 мг, от примерно 15 мг до примерно 20 мг, от примерно 20 мг до примерно 25 мг, от примерно 25 мг до примерно 30 мг, от примерно 30 мг до примерно 35 мг, от примерно 35 мг до примерно 40 мг, от примерно 40 мг до примерно 45 мг, или от примерно 45 мг до примерно 50 мг активного ингредиента.

В некоторых вариантах осуществления композиции, представленные в настоящем документе, включают от примерно 50 мг до примерно 500 мг активного ингредиента. Специалистам в данной области должно быть понятно, что настоящее изобретение включает соединения или композиции, содержащие от примерно 50 мг до примерно 100 мг, от примерно 100 мг до примерно 150 мг, от примерно 150 мг до примерно 200 мг, от примерно 200 мг до примерно 250 мг, от примерно 250 мг до примерно 300 мг, от примерно 350 мг до примерно 400 мг, или от примерно 450 мг до примерно 500 мг активного ингредиента.

В некоторых вариантах осуществления композиции, представленные в настоящем документе, включают от примерно 500 мг до примерно 1000 мг активного ингредиента. Специалистам в данной области техники должно быть понятно, что настоящее изобретение включает соединения или композиции, содержащие от примерно 500 мг до примерно 550 мг, от примерно 550 мг до примерно 600 мг, от примерно 600 мг до примерно 650 мг, от примерно 650 мг до примерно 700 мг, от примерно 700 мг до примерно 750 мг, от примерно 750 мг до примерно 800 мг, от примерно 800 мг до примерно 850 мг, от примерно 850 мг до примерно 900 мг, от примерно 900 мг до примерно 950 мг, или от примерно 950 мг до примерно 1000 мг активного ингредиента.

Активное соединение может быть эффективным в широком диапазоне доз и обычно вводится в фармацевтически эффективном количестве. Однако следует понимать, что фактически вводимое количество соединения обычно определяется врачом в соответствии с соответствующими обстоятельствами, включая состояние, которое необходимо лечить, выбранный способ введения, конкретное вводимое соединение, возраст, массу тела и