Химерные антигенные рецепторы, нацеленные на подобный fc-рецептору белок 5, и их применение

Владельцы патента RU 2779747:


Изобретение относится к области биотехнологии, в частности к химерному антигенному рецептору (CAR), который связывается с подобным Fc-рецептору белком 5 (FcRL5), а также к содержащим его композиции и набору. Также раскрыта молекула нуклеиновой кислоты, кодирующая вышеуказанный CAR, а также содержащие ее клетка и вектор. Изобретение эффективно для лечения опухоли, экспрессирующей FcRL5. 16 н. и 76 з.п. ф-лы, 27 ил., 240 табл., 10 пр.



По настоящей заявке испрашивается приоритет на основании предварительной патентной заявки США с серийным № 62/088164, поданной 5 декабря 2014 г., полное содержание которой включено в настоящий документ посредством ссылки и по отношению к которой испрашивается приоритет.


Настоящее изобретение относится к способам и композициям для лечения рака. Изобретение относится к химерным антигенным рецепторам (CAR), которые специфически нацелены на подобный Fc-рецептору белок 5 (FcRL5), например, домен 9 из FcRL5, иммунореактивным клеткам, содержащим такие CAR, и способам применения таких клеток для лечения рака (например, множественной миеломы).


Клеточная иммунотерапия является терапией, обладающей потенциалом для излечения рака. T-клетки и другие иммунные клетки могут быть модифицированы для нацеливания на опухолевые антигены путем введения генетического материала, кодирующего искусственные или синтетические рецепторы для антигена, называемые химерными антигенными рецепторами (CAR), которые специфичны для выбранных антигенов. Недавно таргетированная T-клеточная терапия с использованием CAR зарекомендовала себя как клинически успешный подход к лечению злокачественных заболеваний крови.

Множественная миелома (MM) является вторым по распространенности злокачественным заболеванием крови (Siegel et al., CA:a cancer journal for clinicians 63, 11-30 (2013)). Примерно 25% пациентов имеют цитогенетику с высокой степенью риска, что предвещает средний период выживания менее 2 лет (Boyd et al., Genes, chromosomes & cancer 50, 765-774 (2011); Shaughnessy et al., Blood 109, 2276-2284 (2007)). Несмотря на достигнутый в последнее время прогресс, независимо от цитогенетики, заболевание по-прежнему считается неизлечимым, за исключением иммунотерапевтического эффекта «трансплантат против миеломы» (GvM) аллогенного трансплантата. Однако использование аллогенных трансплантатов ограничено несоответствием требованиям и высокой частотой связанной с трансплантацией заболеваемости и смертности (Gahrton et al., The New England journal of medicine 325, 1267-1273 (1991)). Аналогично эффекту GvM, потенциально излечивающий эффект T-клеток может быть достигнут с минимальной токсичностью за счет аутологичной адоптивной T-клеточной терапии.

Предположительно, миелома является идеальным заболеванием для тестирования адоптивной T-клеточной терапии. Во-первых, аллогенные трансплантаты продемонстрировали, что T-клетки могут быть средством радикального лечения, даже при минимальной сопутствующей химиотерапии, или без нее, например, после немиелоаблативной трансплантации или пост-трансплантационных инфузий донорских лимфоцитов. Во-вторых, кондиционирующая химиотерапия, возможно, через механизм истощения регуляторных T-клеток (Treg), повышает эффективность адоптивной T-клеточной терапии (Brentjens et al., Blood 118, 4817-4828 (2011) и Pegram et al., Blood 119, 4133-4141 (2012)), в силу этого период сразу после аутологичной трансплантации может быть оптимальным моментом для введения T-клеток, и миелома является одним из нескольких заболеваний, при которых аутологичная трансплантация стволовых клеток является стандартом лечения. В-третьих, иммуномодулирующее лекарственное средство леналидомид может повышать эффективность терапии на основе CAR, как было показано на мышах (Bertilaccio et al., Blood 122, 4171 (2013)), и леналидомид обычно используют для лечения MM. В-четвертых, адоптивная T-клеточная терапия лучше всего работает в случае заболеваний, поражающих преимущественно костный мозг, таких как ALL (Brentjens et al., Science translational medicine 5, 177ra138 (2013); Davila et al., Science translational medicine 6, 224ra225 (2014)), по сравнению с солидными опухолями или экстрамедуллярным CLL (Brentjens et al. (2011)), и аналогично ALL, миелома является заболеванием костного мозга.

Хотя есть множество причин ожидать, что адоптивная T-клеточная терапия может быть эффективной при MM, применение адоптивной T-клеточной терапии при миеломе также связано с особыми проблемами. В отличие от других B-клеточных злокачественных новообразований, экспрессия CD19 имеет место лишь у 2% пациентов с миеломой (Bataille et al., Haematologica 91, 1234-1240 (2006)). Более того, в отличие от CD19, все обычные внеклеточные иммунофенотипические маркеры при миеломе (CD138, CD38 и CD56) также экспрессируются на других важных типах клеток, и CAR для любой из этих мишеней приводили бы к неприемлемой токсичности «внеопухолевых мишеней» (Brentjens et al. (2013)), которая может быть фатальной даже в случае мишеней, антитела к которым хорошо переносятся, как было в ситуации с нацеленными на HER2 CAR (Morgan et al., Molecular therapy: the journal of the American Society of Gene Therapy 18, 843-851 (2010)). Соответственно, существует потребность в новых терапевтических стратегиях для конструирования CAR, нацеленных на антигены, которые на высоком уровне экспрессируются в клетках MM и ограниченно экспрессируются в нормальных тканях, для лечения множественной миеломы; стратегиях, которые могут приводить к эффективной эрадикации опухолей с минимальной токсичностью и иммуногенностью.


Настоящее изобретение, в целом, относится к химерным антигенным рецепторам (CAR), специфически нацеленным на подобный Fc-рецептору белок 5 (FcRL5), иммунореактивным клеткам, содержащим такие CAR, и применению таких CAR и иммунореактивных клеток для лечения множественной миеломы.

Настоящее изобретение относится к CAR. В одном неограничивающем примере CAR содержит внеклеточный антигенсвязывающий домен, трансмембранный домен и внутриклеточный домен, при этом внеклеточный антигенсвязывающий домен специфически связывается с FcRL5. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен связывается с доменом 9 из FcRL5.

В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен представляет собой одноцепочечный вариабельный фрагмент (scFv). В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен представляет собой scFv мыши. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен представляет собой scFv человека. В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен представляет собой Fab, который, необязательно, является сшитым. В конкретных неограничивающих вариантах осуществления внеклеточный связывающий домен представляет собой F(ab)2. В конкретных неограничивающих вариантах осуществления любая из вышеуказанных молекул может находиться в слитом белке с гетерологичной последовательностью, образуя внеклеточный антигенсвязывающий домен. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен специфически связывается с FcRL5 с аффинностью связывания (Kd), составляющей от примерно 1×10-11 M до примерно 3×10-6 M, от 1×10-10 M до примерно 3×10-6 M или от 1×10-9 M до примерно 3×10-6 M. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен специфически связывается с доменом 8 или 9 из FcRL5 с Kd, составляющей от примерно 1×10-9 M до примерно 3×10-6 M.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917 и SEQ ID NO: 921, при этом внеклеточный антигенсвязывающий домен связывается с FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915 и SEQ ID NO: 919, при этом внеклеточный антигенсвязывающий домен связывается с FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917 и SEQ ID NO: 921; и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915 и SEQ ID NO: 919, при этом внеклеточный антигенсвязывающий домен связывается с FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917, SEQ ID NO: 921, а также их консервативных модификаций.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915, SEQ ID NO: 919, а также их консервативных модификаций.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 915. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 917. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 919. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 921. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 144. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 143. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 216. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 215. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 220. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 219. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 236. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 235. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 268. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 267. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 116. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 115. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 172. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 171.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917, SEQ ID NO: 921, а также их консервативных модификаций; и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915, SEQ ID NO: 919, а также их консервативных модификаций.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 915; и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 917. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 919; и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 921. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 144, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 143. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 216, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 215. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 220, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 219. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 236, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 235. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 268, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 267. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 116, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 115. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 172, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 171.

В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен содержит обе из указанных тяжелой и легкой цепей, необязательно, с последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. Например, в конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 915, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 917, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 919, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 92, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 144, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 143, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 216, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 215, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 220, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 219, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 236, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 235, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 268, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 267, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 116, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 115, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 172, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 171, необязательно, с (c) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 311, 317, 323, 328, 334, 337, 342, 347, 351, 356, 362, 368, 374, 376, 380, 384, 389, 394, 396, 400, 405, 408, 412, 415, 422, 427, 432, 437, 442, 446, 451, 453, 456, 458, 459, 463, 464, 467, 473, 476, 482, 486, 489, 492, 494, 497, 502, 507, 512, 517, 522, 527, 529, 532, 536, 539, 543, 546, 550, 553, 555, 561, 567, 570, 574, 577, 578, 579, 584, 578, 587, 591, 925 и 931; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 314, 320, 325, 331, 339, 345, 350, 353, 359, 365, 371, 377, 383, 386, 392, 395, 399, 402, 407, 410, 414, 418, 419, 424, 430, 435, 439, 443, 449, 452, 455, 457, 462, 465, 470, 479, 485, 488, 491, 493, 495, 499, 505, 509, 514, 519, 524, 528, 530, 531, 535, 541, 542, 545, 549, 554, 558, 564, 569, 573, 576, 581, 592, 928 и 934.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 309, 315, 321, 326, 332, 335, 340, 346, 354, 360, 366, 372, 378, 387, 393, 403, 411, 420, 425, 436, 440, 444, 471, 480, 500, 510, 515, 520, 525, 537, 551, 559, 565, 582, 589, 923 и 929; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 310, 316, 322, 327, 333, 336, 341, 355, 361, 367, 373, 379, 388, 404, 412, 421, 426, 431, 441, 445, 450, 466, 472, 475, 481, 496, 501, 506, 511, 516, 521, 526, 538, 552, 560, 566, 583, 590, 924 и 930; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 311, 317, 323, 328, 334, 337, 342, 347, 351, 356, 362, 368, 374, 376, 380, 384, 389, 394, 396, 400, 405, 408, 412, 415, 422, 427, 432, 437, 442, 446, 451, 453, 456, 458, 459, 463, 464, 467, 473, 476, 482, 486, 489, 492, 494, 497, 502, 507, 512, 517, 522, 527, 529, 532, 536, 539, 543, 546, 550, 553, 555, 561, 567, 570, 574, 577, 578, 579, 584, 578, 587, 591, 925 и 931; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 312, 318, 324, 329, 338, 343, 348, 352, 357, 363, 369, 381, 390, 397, 401, 406, 416, 423, 428, 433, 447, 460, 468, 474, 477, 483, 490, 498, 503, 508, 518, 533, 540, 544, 547, 556, 562, 568, 571, 580, 585, 588, 926 и 932; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 313, 319, 330, 344, 349, 358, 364, 370, 382, 385, 391, 398, 409, 417, 429, 434, 438, 448, 454, 461, 469, 478, 484, 487, 504, 513, 523, 534, 429, 448, 548, 557, 563, 572, 575, 586, 927 и 933; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 314, 320, 325, 331, 339, 345, 350, 353, 359, 365, 371, 377, 383, 386, 392, 395, 399, 402, 407, 410, 414, 418, 419, 424, 430, 435, 439, 443, 449, 452, 455, 457, 462, 465, 470, 479, 485, 488, 491, 493, 495, 499, 505, 509, 514, 519, 524, 528, 530, 531, 535, 541, 542, 545, 549, 554, 558, 564, 569, 573, 576, 581, 592, 928 и 934.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 923, или ее консервативные модификации, (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 924, или ее консервативные модификации, и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 925, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 926, или ее консервативные модификации, (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 927, или ее консервативные модификации, и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 928, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 929, или ее консервативные модификации, (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 930, или ее консервативные модификации, и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 931, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 932, или ее консервативные модификации, (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 933, или ее консервативные модификации, и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 934, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 923, или ее консервативные модификации, (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 924, или ее консервативные модификации, (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 925, или ее консервативные модификации, (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 926, или ее консервативные модификации, (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 927, или ее консервативные модификации, и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 928, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 929, или ее консервативные модификации, (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 930, или ее консервативные модификации, (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 931, или ее консервативные модификации, (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 932, или ее консервативные модификации, (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 933, или ее консервативные модификации, и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 934, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 463 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 419 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 515 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 516 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 517 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 531 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 403 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 404 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 532 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 533 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 534 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 535.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 543 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 544 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 448 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 545 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 372 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 475 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 570 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 571 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 572 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 573 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 440 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 441 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 442 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 329 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 330 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 443 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 309 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 310 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 489 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 490 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 313 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 491 или ее консервативные модификации.

В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 664, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 700, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 702, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 710, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 726, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 650, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит аминокислотную последовательность, приведенную в SEQ ID NO: 678, или ее консервативные модификации.

В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 923, или ее консервативные модификации, CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 924, или ее консервативные модификации, и CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 925, или ее консервативные модификации, и (ii) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 926, или ее консервативные модификации, CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 927, или ее консервативные модификации, и CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 928, или ее консервативные модификации, необязательно, с (iii) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В другом неограничивающем варианте осуществления внеклеточный антигенсвязывающий домен содержит (i) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 929, или ее консервативные модификации, CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 930, или ее консервативные модификации, и CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 931, или ее консервативные модификации, и (ii) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 932, или ее консервативные модификации, CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 933, или ее консервативные модификации, и CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 934, или ее консервативные модификации, необязательно, с (iii) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 463 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 419 или ее консервативные модификации, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 515 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 516 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 517 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 531 или ее консервативные модификации, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 403 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 404 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 532 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 533 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 534 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 535, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 543 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 544 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 448 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 545 или ее консервативные модификации, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 372 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 475 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 570 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 571 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 572 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 573 или ее консервативные модификации, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 440 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 441 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 442 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 329 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 330 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 443 или ее консервативные модификации, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 309 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 310 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 489 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 490 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 313 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 491 или ее консервативные модификации, необязательно, с (g) последовательностью линкера, например, пептидного линкера, между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи.

В конкретных вариантах осуществления пептидный линкер содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 307 и SEQ ID NO: 897.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен связывается с FcRL5, содержащим аминокислотную последовательность, приведенную в SEQ ID NO: 899. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен связывается с эпитопом, содержащим аминокислотную последовательность, приведенную в SEQ ID NO: 964. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен связывается с эпитопом, содержащим аминокислотную последовательность, приведенную в SEQ ID NO: 965.

В соответствии с настоящим изобретением, внеклеточный антигенсвязывающий домен ковалентно связан с трансмембранным доменом. Внеклеточный антигенсвязывающий домен может содержать сигнальный пептид, который ковалентно связан с 5'-концом внеклеточного антигенсвязывающего домена. В конкретных вариантах осуществления трансмембранный домен CAR содержит полипептид CD8, полипептид CD28, полипептид CD3ζ, полипептид CD4, полипептид 4-1BB, полипептид OX40, полипептид ICOS, полипептид CTLA-4, полипептид PD-1, полипептид LAG-3, полипептид 2B4, полипептид BTLA, синтетический пептид (не на основе белка, связанного с иммунным ответом) или их сочетание. В неограничивающем варианте осуществления трансмембранный домен содержит полипептид CD8. В конкретных вариантах осуществления трансмембранный домен содержит полипептид CD28.

В соответствии с настоящим изобретением, в конкретных вариантах осуществления внутриклеточный домен содержит полипептид CD3ζ. В конкретных вариантах осуществления внутриклеточный домен дополнительно содержит по меньшей мере одну сигнальную область. В конкретных вариантах осуществления по меньшей мере одна сигнальная область содержит полипептид CD28, полипептид 4-1BB, полипептид OX40, полипептид ICOS, полипептид DAP-10, полипептид PD-1, полипептид CTLA-4, полипептид LAG-3, полипептид 2B4, полипептид BTLA, синтетический пептид (не на основе белка, связанного с иммунным ответом) или их сочетание. В конкретных вариантах осуществления сигнальная область представляет собой костимулирующую сигнальную область. В конкретных вариантах осуществления костимулирующая сигнальная область содержит полипептид CD28, полипептид 4-1BB, полипептид OX40, полипептид ICOS, полипептид DAP-10 или их сочетание. В конкретных вариантах осуществления по меньшей мере одна костимулирующая сигнальная область содержит полипептид CD28. В конкретных неограничивающих вариантах осуществления трансмембранный домен содержит полипептид CD28, внутриклеточный домен содержит полипептид CD3ζ и костимулирующий сигнальный домен содержит полипептид CD28. В конкретных неограничивающих вариантах осуществления трансмембранный домен содержит полипептид CD8, внутриклеточный домен содержит полипептид CD3ζ и костимулирующий сигнальный домен содержит полипептид 4-1BB.

В конкретных вариантах осуществления CAR экспрессируется рекомбинантно. CAR может экспрессироваться с вектора. В конкретных вариантах осуществления вектор представляет собой γ-ретровирусный вектор.

Настоящее изобретение также относится к выделенным иммунореактивным клеткам, содержащим вышеописанные CAR. В конкретных вариантах осуществления выделенная иммунореактивная клетка трансдуцирована CAR, например, CAR конститутивно экспрессируется на поверхности иммунореактивной клетки. В конкретных вариантах осуществления выделенная иммунореактивная клетка дополнительно трансдуцирована по меньшей мере одним костимулирующим лигандом, вследствие чего иммунореактивная клетка экспрессирует по меньшей мере один костимулирующий лиганд. В конкретных вариантах осуществления по меньшей мере один костимулирующий лиганд выбирают из группы, состоящей из 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, а также их сочетаний. В конкретных вариантах осуществления выделенная иммунореактивная клетка дополнительно трансдуцирована по меньшей мере одним цитокином, вследствие чего иммунореактивная клетка секретирует по меньшей мере один цитокин. В конкретных вариантах осуществления по меньшей мере один цитокин выбирают из группы, состоящей из IL-2, IL-3, IL-6, IL-7, IL-11, IL-12, IL-15, IL-17, IL-21, а также их сочетаний. В конкретных вариантах осуществления выделенную иммунореактивную клетку выбирают из группы, состоящей из T-клетки, клетки-естественного киллера (NK), цитотоксического T-лимфоцита (CTL), регуляторной T-клетки, человеческой эмбриональной стволовой клетки, лимфоидной клетки-предшественника, клетки-предшественника T-клетки и плюрипотентной стволовой клетки, из которой могут дифференцироваться лимфоидные клетки. В конкретных вариантах осуществления иммунореактивная клетка представляет собой T-клетку.

Настоящее изобретение также относится к молекулам нуклеиновой кислоты, кодирующим раскрытые в настоящем документе CAR, векторам, содержащим молекулы нуклеиновой кислоты, и клеткам-хозяевам, экспрессирующим такие молекулы нуклеиновой кислоты. В конкретных вариантах осуществления молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 951. В конкретных вариантах осуществления молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 952. В конкретных вариантах осуществления вектор представляет собой γ-ретровирусный вектор. В конкретных вариантах осуществления клетка-хозяин представляет собой T-клетку.

Кроме того, настоящее изобретение относится к способам применения вышеописанной иммунореактивной клетки для уменьшения опухолевой нагрузки у субъекта. Например, настоящее изобретение относится к способу уменьшения опухолевой нагрузки у субъекта, включающему введение эффективного количества раскрытой в настоящем документе иммунореактивной клетки субъекту, в результате чего индуцируется гибель опухолевых клеток у субъекта. В конкретных вариантах осуществления способ приводит к уменьшению количества опухолевых клеток. В другом варианте осуществления способ приводит к уменьшению размера опухоли. В другом варианте осуществления способ приводит к уничтожению опухоли у субъекта. В конкретных вариантах осуществления опухоль выбирают из группы, состоящей из множественной миеломы, неходжкинской лимфомы (особенно из клеток мантийной зоны), лимфомы Ходжкина, хронического лимфоцитарного лейкоза (CLL), острого лимфоцитарного лейкоза (ALL), волосатоклеточного лейкоза, лимфомы Беркитта и макроглобулинемии Вальденстрема. В конкретных вариантах осуществления опухоль представляет собой множественную миелому. В конкретных вариантах осуществления субъект является человеком. В конкретных вариантах осуществления иммунореактивная клетка представляет собой T-клетку.

Кроме того, настоящее изобретение относится к способам применения вышеописанной иммунореактивной клетки для увеличения или продления срока выживания субъекта, имеющего неоплазию. Например, настоящее изобретение относится к способу увеличения или продления срока выживания субъекта, имеющего неоплазию, включающему введение эффективного количества раскрытой в настоящем документе иммунореактивной клетки субъекту, в результате чего увеличивается или продлевается срок выживания субъекта. В конкретных вариантах осуществления неоплазию выбирают из группы, состоящей из множественной миеломы, неходжкинской лимфомы (особенно из клеток мантийной зоны), лимфомы Ходжкина, хронического лимфоцитарного лейкоза (CLL), острого лимфоцитарного лейкоза (ALL), волосатоклеточного лейкоза, лимфомы Беркитта и макроглобулинемии Вальденстрема. В конкретных вариантах осуществления неоплазия представляет собой множественную миелому. В конкретных вариантах осуществления способ приводит к уменьшению или уничтожению опухолевой нагрузки у субъекта.

Настоящее изобретение также относится к способам получения иммунореактивной клетки, которая связывается с подобным Fc-рецептору белком 5 (FcRL5), например, доменом 9 из FcRL5. В одном неограничивающем примере способ включает введение в иммунореактивную клетку нуклеотидной последовательности, кодирующей химерный антигенный рецептор (CAR), который содержит внеклеточный антигенсвязывающий домен, трансмембранный домен и внутриклеточный домен, при этом внеклеточный антигенсвязывающий домен специфически связывается с подобным Fc-рецептору белком 5 (FcRL5). В конкретном неограничивающем варианте осуществления внеклеточный антигенсвязывающий домен представляет собой scFv.

Настоящее изобретение также относится к фармацевтическим композициям, содержащим эффективное количество раскрытых в настоящем документе иммунореактивных клеток и фармацевтически приемлемый эксципиент. В конкретных вариантах осуществления фармацевтические композиции предназначены для лечения неоплазии. В конкретных вариантах осуществления неоплазию выбирают из группы, состоящей из множественной миеломы, неходжкинской лимфомы (особенно из клеток мантийной зоны), лимфомы Ходжкина, хронического лимфоцитарного лейкоза (CLL), острого лимфоцитарного лейкоза (ALL), волосатоклеточного лейкоза, лимфомы Беркитта и макроглобулинемии Вальденстрема. В конкретных вариантах осуществления неоплазия представляет собой множественную миелому.

Настоящее изобретение также относится к наборам для лечения неоплазии, включающим раскрытые в настоящем документе иммунореактивные клетки. В конкретных вариантах осуществления набор дополнительно включает письменные инструкции по применению иммунореактивной клетки для лечения неоплазии. В конкретных вариантах осуществления неоплазию выбирают из группы, состоящей из множественной миеломы, неходжкинской лимфомы (особенно из клеток мантийной зоны), лимфомы Ходжкина, хронического лимфоцитарного лейкоза (CLL), острого лимфоцитарного лейкоза (ALL), волосатоклеточного лейкоза, лимфомы Беркитта и макроглобулинемии Вальденстрема. В конкретных вариантах осуществления неоплазия представляет собой множественную миелому.


Следующее далее подробное описание, приведенное в качестве примера, но не предназначенное для ограничения изобретения конкретными описанными вариантами осуществления, может быть понятным в сочетании с сопроводительными чертежами.

Фигура 1 показывает экспрессию FcRL5 в различных нормальных тканях и линиях раковых клеток человека.

Фигура 2 показывает скрининг анти-FcRL5 scFv с использованием клеток 3T3, экспрессирующих FcRL5 или FcRL1, 2, 3, 4 или 6.

Фигуры 3A-D. (A) Показаны домены FcRL5, а также растворимая, гликозилфосфатидилинозитол (GPI)-заякоренная и трансмембранная формы FcRL5. (B) Показан вектор, используемый для экспрессии мутантной формы FcRL5, лишенной домена 9 (в настоящем документе также называемой FcRL5Δdom9). (C) Нуклеотидные последовательности полноразмерного FcRL5 и формы FcRL5, лишенной домена 9. (D) Показаны различия в нуклеотидных последовательностях полноразмерного FcRL5 и мутантной формы FcRL5, в которой домен 9 делетирован (в настоящем документе называемой «FcRL5Δdom9»).

Фигура 4 показывает скрининг анти-FcRL5 scFv ET200-39 на клетках 3T3, экспрессирующих FcRL5Δdom9.

Фигура 5 показывает скрининг анти-FcRL5 scFv ET200-104 на клетках 3T3, экспрессирующих FcRL5Δdom9.

Фигура 6 показывает скрининг анти-FcRL5 scFv ET200-105 на клетках 3T3, экспрессирующих FcRL5Δdom9.

Фигура 7 показывает скрининг анти-FcRL5 scFv ET200-109 на клетках 3T3, экспрессирующих FcRL5Δdom9.

Фигура 8 показывает скрининг анти-FcRL5 scFv ET200-117 на клетках 3T3, экспрессирующих FcRL5Δdom9.

Фигура 9A-B. Схематическое изображение химерного антигенного рецептора, нацеленного на FcRL5, в соответствии с неограничивающими вариантами осуществления настоящего изобретения. (A) Схематическое изображение FcRL5-нацеленного CAR с CD28 костимулирующим доменом и CD3дзета. (B) Схематическое изображение FcRL5-нацеленного CAR с костимулирующим доменом 4-1BB и CD3дзета.

Фигура 10 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-31 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 11 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-39 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 12 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-69 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 13 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-104 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 14 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-105 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 15 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-109 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 16 показывает карту вектора химерного антигенного рецептора, нацеленного на FcRL5, с использованием scFV ET200-117 в соответствии с одним неограничивающим вариантом осуществления настоящего изобретения.

Фигура 17 показывает экспрессию FcRL5-нацеленных химерных антигенных рецепторов на поверхности трансдуцированных T-клеток.

Фигура 18 показывает цитотоксичность T-клеток с FcRL5-нацеленным химерным антигенным рецептором в отношении FcRL5-экспрессирующих клеток.

Фигура 19 показывает индукцию секреции цитокинов T-клеток с FcRL5-нацеленным химерным антигенным рецептором.

Фигура 20 показывает пролиферацию T-клеток с FcRL5-нацеленным химерным антигенным рецептором при стимуляции антигеном.

Фигура 21 иллюстрирует технологию CLIPS. Реакция CLIPS происходит между группами брома каркаса CLIPS и тиоловыми группами боковых цепей остатков цистеина. Реакция является быстрой и специфической в мягких условиях. С использованием этой элегантной химии, природные белковые последовательности превращаются в CLIPS-конструкты с целым диапазоном структур. Слева направо: две разные одиночные T2 петли, T3 двойная петля, конъюгированные T2+T3 петли, стабилизированный бета-слой и стабилизированная альфа-спираль (Timmerman et al., J. Mol. Recognit. 2007; 20: 283-29).

Фигура 22 показывает скрининг комбинаторной библиотеки CLIPS. Целевой белок (слева), содержащий прерывистый конформационный эпитоп, превращают в матричную библиотеку (центр). Комбинаторные пептиды синтезируют на запатентованной миникарте и химически преобразуют в CLIPS-конструкты с определенными пространственными структурами (справа).

Фигура 23 показывает T3-петлевой конструкт CLIPSTM.

Фигура 24A-D иллюстрирует технологию тепловых карт. (A) Таблица комбинированных пептидов с двумя подпоследовательностями, обозначенными «Петля 1» и «Петля 2». (B) Данные из A представлены в виде матрицы. (C) Шкала цветовой индикации представленной тепловой карты. (D) Изображение тепловой карты для данных из A.

Фигура 25 показывает анализ методом тепловых карт данных, полученных для герцептина.

Фигура 26 показывает анализ методом тепловых карт данных, полученных для ET200-104.

Фигура 27 показывает 3D-модель аминокислотных остатков 380-731 из FcRL55 с выделенным пептидным фрагментом 657SRPILTFRAPR667.


Настоящее изобретение, в целом, относится к FcRL5-нацеленным химерным антигенным рецепторам (CAR). В одном неограничивающем примере CAR содержит внеклеточный антигенсвязывающий домен, трансмембранный домен внутриклеточный домен, при этом внеклеточный антигенсвязывающий домен специфически связывается с FcRL5. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен специфически связывается с доменом 7, 8 или 9 из FcRL5. Настоящее изобретение также относится к иммунореактивным клеткам (например, T-клетке, клетке-естественному киллеру (NK), цитотоксическому T-лимфоциту (CTL), регуляторной T-клетке, человеческой эмбриональной стволовой клетке, лимфоидной клетке-предшественнику, клетке-предшественнику T-клетки и плюрипотентной стволовой клетке, из которой могут дифференцироваться лимфоидные клетки), экспрессирующим FcRL5-нацеленные CAR, и способам применения таких иммунореактивных клеток для лечения опухоли, например, множественной миеломы.

I. Определения

Если не указано иное, все технические и научные термины, используемые в настоящем документе, имеют то значение, которое им обычно придают специалисты в области, к которой относится данное изобретение. В следующих литературных источниках специалист может найти определения многих терминов, используемых в рамках данного изобретения: Singleton et al., Dictionary of Microbiology and Molecular Biology (2-е издание, 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5-е издание, R. Rieger et al. (eds.), Springer Verlag (1991); и Hale & Marham, The Harper Collins Dictionary of Biology (1991). Следующие термины, используемые в настоящем документе, имеют значения, определенные для них ниже, если не указано иное.

Используемый в настоящем документе термин «примерно» или «приблизительно» означает допустимый диапазон ошибки для конкретной величины, что может определять рядовой специалист в данной области; этот диапазон будет зависеть частично от того, каким образом величину определяют или измеряют, то есть, от ограничений системы измерения. Например, «примерно» может означать «в пределах 3 или более чем 3 стандартных отклонений», в соответствии с практикой в данной области. Альтернативно, «примерно» может означать «диапазон вплоть до 20%, предпочтительно до 10%, более предпочтительно до 5% и даже более предпочтительно до 1% от конкретной величины». Альтернативно, особенно в случае биологических систем или процессов, термин может означать «в пределах порядка величины», предпочтительно в пределах 5-кратного значения, и более предпочтительно, в пределах 2-двукратного значения величины.

Используемый в настоящем документе термин «популяция клеток» означает группу из по меньшей мере двух клеток, имеющих сходные или разные фенотипы. В неограничивающих примерах популяция клеток может включать по меньшей мере примерно 10, по меньшей мере примерно 100, по меньшей мере примерно 200, по меньшей мере примерно 300, по меньшей мере примерно 400, по меньшей мере примерно 500, по меньшей мере примерно 600, по меньшей мере примерно 700, по меньшей мере примерно 800, по меньшей мере примерно 900, по меньшей мере примерно 1000 клеток, имеющих сходные или разные фенотипы.

Используемый в настоящем документе термин «антитело» означает не только интактные молекулы антител, но также и фрагменты молекул антител, которые сохраняют способность связывать иммуноген. Такие фрагменты также хорошо известны в данной области и постоянно используются как in vitro, так и in vivo. Соответственно, используемый в настоящем документе термин «антитело» означает не только интактные молекулы иммуноглобулинов, но также и хорошо известные активные фрагменты F(ab')2 и Fab. Фрагменты F(ab')2 и Fab, которые лишены Fc-фрагмента интактного антитела, быстрее удаляются из системы циркуляции и могут отличаться меньшим неспецифическим связыванием с тканями, чем интактное антитело (Wahl et al., J. Nucl. Med. 24: 316-325 (1983)). Антитела по изобретению включают полноразмерные природные антитела, биспецифические антитела; химерные антитела; Fab, Fab', одноцепочечные фрагменты V-области (scFv), слитые полипептиды и необычные антитела.

Используемый в настоящем документе термин «одноцепочечный вариабельный фрагмент» или «scFv» означает слитый белок из вариабельных областей тяжелой (VH) и легкой (VL) цепей иммуноглобулина (например, мыши или человека), ковалентно связанных, с образованием VH::VL гетеродимера. Тяжелая (VH) и легкая (VL) цепи либо связаны напрямую, либо связаны с помощью закодированного пептидного линкера (например, длиной 10, 15, 20, 25 аминокислот), который соединяет N-конец VH с C-концом VL или C-конец VH с N-концом VL. Как правило, линкер бывает богат остатками глицина для гибкости, а также остатками серина или треонина для растворимости. Линкер может связывать вариабельную область тяжелой цепи и вариабельную область легкой цепи внеклеточного антигенсвязывающего домена. Неограничивающие примеры линкеров приведены в Shen et al., Anal. Chem. 80(6): 1910-1917 (2008) и WO 2014/087010, полное содержание которых включено в настоящий документ посредством ссылки. В конкретных вариантах осуществления линкер представляет собой линкер G4S.

В неограничивающем примере линкер имеет аминокислотную последовательность, приведенную в SEQ ID NO: 897, которая представлена ниже.

GGGGSGGGGSGGGGS [SEQ ID NO: 897]. В конкретных вариантах осуществления нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 897, приведена в SEQ ID NO: 898, которая представлена ниже:


В другом неограничивающем примере линкер имеет аминокислотную последовательность, приведенную в SEQ ID NO: 307, которая представлена ниже:

SRGGGGSGGGGSGGGGSLEMA [SEQ ID NO: 307]. В конкретных вариантах осуществления нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 307, приведена в SEQ ID NO: 305, которая представлена ниже:


Несмотря на удаление константных областей и введение линкера, белки scFv сохраняют специфичность исходного иммуноглобулина. Антитела, представляющие собой одноцепочечный полипептид Fv, могут экспрессироваться с нуклеиновой кислоты, содержащей кодирующие VH и VL последовательности, как описано в Huston, et al. (Proc. Nat. Acad. Sci. USA, 85: 5879-5883, 1988). Смотри также патенты США №№ 5091513, 5132405 и 4956778; и публикации патентов США №№ 20050196754 и 20050196754. Описаны антагонистические scFv, обладающие ингибирующей активностью (смотри, например, Zhao et al., Hyrbidoma (Larchmt) 2008 27(6): 455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4): 2277-85; Giomarelli et al., Thromb Haemost 2007 97(6): 955-63; Fife et al., J Clin Invst 2006 116(8): 2252-61; Brocks et al., Immunotechnology 1997 3(3): 173-84; Moosmayer et al., Ther Immunol 1995 2(10: 31-40). Описаны агонистические scFv, обладающие стимулирующей активностью (смотри, например, Peter et al., J Biol Chem 2003 25278(38): 36740-7; Xie et al., Nat Biotech 1997 15(8): 768-71; Ledbetter et al., Crit Rev Immunol1997 17(5-6): 427-55; Ho et al., BioChim Biophys Acta 2003 1638(3): 257-66).

Используемый в настоящем документе термин «F(ab)» означает фрагмент структуры антитела, который связывается с антигеном, но является одновалентным и не имеет Fc-части, например, при расщеплении антитела ферментом папаином образуются два F(ab)-фрагмента и Fc-фрагмент (например, константная область тяжелой (H) цепи; Fc-область, которая не связывается с антигеном).

Используемый в настоящем документе термин «F(ab')2» означает фрагменты антитела, получаемые при расщеплении пепсином целых IgG антител, причем данный фрагмент имеет две антигенсвязывающие области (ab') (двухвалентные), причем каждая (ab') область содержит две отдельные аминокислотные цепи, часть H-цепи и легкая (L) цепь соединены S-S связью для связывания антигена и при этом оставшиеся части H-цепей связаны вместе. «F(ab')2»-фрагмент может быть разделен на два отдельных Fab'-фрагмента.

Используемый в настоящем документе термин «вектор» означает любой генетический элемент, такой как плазмида, фаг, транспозон, космида, хромосома, вирус, вирион и так далее, который способен к репликации, будучи связан с правильными контрольными элементами, и который может переносить последовательности генов в клетки. Таким образом, термин охватывает клонирующие и экспрессионные векторы, а также вирусные векторы и плазмидные векторы.

Используемый в настоящем документе термин «экспрессионный вектор» означает рекомбинантную нуклеотидную последовательность, то есть, молекулу рекомбинантной ДНК, содержащую нужную кодирующую последовательность и соответствующие нуклеотидные последовательности, необходимые для экспрессии функционально связанной кодирующей последовательности в конкретном организме-хозяине. Нуклеотидные последовательности, необходимые для экспрессии в прокариотах, как правило, включают промотор, оператор (необязательно) и сайт связывания рибосомы, часто наряду с другими последовательностями. В эукариотических клетках, как известно, используются промоторы, энхансеры, а также последовательности терминации и сигналы полиаденилирования.

Используемый в настоящем документе термин «CDR» означает аминокислотные последовательности определяющей комплементарность области антитела, которые представляют собой гипервариабельные области тяжелых и легких цепей иммуноглобулинов. Смотри, например, Kabat et al., Sequences of Proteins of Immunological Interest, 4-е издание, U.S. Department of Health and Human Services, National Institutes of Health (1987). Как правило, антитела содержат по три области CDR, или CDR, в вариабельных областях тяжелой цепи и легкой цепи. CDR предоставляют большинство контактирующих остатков для связывания антитела с антигеном или эпитопом. В конкретных вариантах осуществления границы областей CDR определяют, используя систему Kabat (Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, пятое издание, U.S. Department of Health и Human Services, NIH Publication No. 91-3242).

Используемый в настоящем документе термин «аффинность» означает меру силы связывания. Без привязки к конкретной теории, аффинность зависит от близости, создаваемой стереохимическим соответствием, между антигенсвязывающим центром антитела и антигенными детерминантами, от размера области контакта между ними и от распределения заряженных и гидрофобных групп. Аффинность также включает термин «авидность», который означает силу связи антиген-антитело после образования обратимых комплексов. Методы расчета аффинности антитела для антигена известны в данной области, они включают проведение экспериментов по связыванию для расчета аффинности. Активность антитела в функциональных анализах (например, в анализе методом проточной цитометрии) также является отражением аффинности антитела. Антитела и показатели аффинности можно фенотипически характеризовать и сравнивать с использованием функциональных анализов (например, анализа методом проточной цитометрии).

Молекулы нуклеиновой кислоты, полезные в способах по изобретению, включают любую молекулу нуклеиновой кислоты, которая кодирует полипептид по изобретению или его фрагмент. Такие молекулы нуклеиновой кислоты не обязательно должны быть на 100% идентичны эндогенной нуклеотидной последовательности, однако они, как правило, будут иметь существенную идентичность. Полинуклеотиды, имеющие «существенную идентичность» с эндогенной последовательностью, как правило, способны гибридизоваться с по меньшей мере одной цепью двухцепочечной молекулы нуклеиновой кислоты. «Гибридизация» означает спаривание, с образованием двухцепочечной молекулы, между комплементарными полинуклеотидными последовательностями (например, гена, описанного в настоящем документе) или их частями в разных условиях строгости. (Смотри, например, Wahl, G. M. and S. L. Berger (1987) Methods Enzymol. 152: 399; Kimmel, A. R. (1987) Methods Enzymol. 152: 507).

Например, концентрация соли в строгих условиях, как правило, будет составлять менее примерно 750 мМ NaCl и 75 мМ цитрата тринатрия, предпочтительно менее примерно 500 мМ NaCl и 50 мМ цитрата тринатрия, и более предпочтительно менее примерно 250 мМ NaCl и 25 мМ цитрата тринатрия. Низкую строгость условий гибридизации можно получать в отсутствие органических растворителей, например, формамида, в то время как высокую строгость условий гибридизации можно получать в присутствии по меньшей мере примерно 35% формамида, и более предпочтительно по меньшей мере примерно 50% формамида. Температура в строгих условиях, как правило, включает температуру по меньшей мере примерно 30°C, более предпочтительно по меньшей мере примерно 37°C и наиболее предпочтительно по меньшей мере примерно 42°C. Различные дополнительные параметры, такие как время гибридизации, концентрация детергента, например, додецилсульфата натрия (SDS), а также включение или исключение ДНК-носителя, хорошо известны специалистам в данной области. Комбинируя эти различные условия по мере необходимости, можно добиваться различных уровней строгости. В предпочтительном варианте осуществления гибридизация будет происходить при 30°C в растворе, содержащем 750 мМ NaCl, 75 мМ цитрата тринатрия и 1% SDS. В более предпочтительном варианте осуществления гибридизация будет происходить при 37°C в растворе, содержащем 500 мМ NaCl, 50 мМ цитрата тринатрия, 1% SDS, 35% формамида и 100 мкг/мл денатурированной ДНК спермы лосося (оцДНК). В наиболее предпочтительном варианте осуществления гибридизация будет происходить при 42°C в растворе, содержащем 250 мМ NaCl, 25 мМ цитрата тринатрия, 1% SDS, 50% формамида и 200 мкг/мл оцДНК. Полезные вариации этих условий будут очевидны для специалистов в данной области.

В большинстве случаев строгость условий на этапах промывания после гибридизации также будут варьироваться. Строгость условий при промывании может определяться концентрацией соли и температурой. Как описано выше, строгость условий при промывании можно повышать путем снижения концентрации соли или путем повышения температуры. Например, концентрация соли в строгих условиях на этапах промывания предпочтительно будет составлять менее примерно 30 мМ NaCl и 3 мМ цитрата тринатрия, и наиболее предпочтительно менее примерно 15 мМ NaCl и 1,5 мМ цитрата тринатрия. Температура в строгих условиях на этапах промывания, как правило, будет включать температуру по меньшей мере примерно 25°C, более предпочтительно по меньшей мере примерно 42°C, и еще более предпочтительно по меньшей мере примерно 68°C. В предпочтительном варианте осуществления этапы промывания будут проводиться при 25°C в растворе, содержащем 30 мМ NaCl, 3 мМ цитрата тринатрия и 0,1% SDS. В более предпочтительном варианте осуществления этапы промывания будут проводиться при 42°C в растворе, содержащем 15 мМ NaCl, 1,5 мМ цитрата тринатрия и 0,1% SDS. В более предпочтительном варианте осуществления этапы промывания будут проводиться при 68°C в растворе, содержащем 15 мМ NaCl, 1,5 мМ цитрата тринатрия и 0,1% SDS. Дополнительные вариации этих условий будут очевидны для специалистов в данной области. Методы гибридизации хорошо известны специалистам в данной области и описаны, например, в Benton and Davis (Science 196: 180, 1977); Grunstein and Rogness (Proc. Natl. Acad. Sci., USA 72: 3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); и Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.

Выражение «по существу идентичны» означает, что полипептид или молекула нуклеиновой кислоты проявляет по меньшей мере 50% идентичности с эталонной аминокислотной последовательностью (например, любой из аминокислотных последовательностей, описанных в настоящем документе) или нуклеотидной последовательностью (например, например, любой из нуклеотидных последовательностей, описанных в настоящем документе). Предпочтительно, такая последовательность на по меньшей мере 60%, более предпочтительно 80% или 85%, и более предпочтительно 90%, 95% или даже 99% идентична на аминокислотном или нуклеотидном уровне последовательности, используемой для сравнения.

Идентичность последовательностей, как правило, определяют с использованием программ анализа последовательностей (например, пакета программ для анализа последовательностей от Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705; программ BLAST, BESTFIT, GAP или PILEUP/PRETTYBOX). Такие программы сопоставляют идентичные или сходные последовательности путем присвоения степени гомологии в случае различных замен, делеций и/или других модификаций. В иллюстративном подходе для определения степени идентичности можно использовать программу BLAST с показателем вероятности от e-3 до e-100, указывающим на близкородственную последовательность.

Используемый в настоящем документе термин «аналог» означает структурно родственный полипептид или молекулу нуклеиновой кислоты, обладающие функцией эталонного полипептида или молекулы нуклеиновой кислоты.

Используемый в настоящем документе термин «лиганд» означает молекулу, которая связывается с рецептором. В частности, лиганд связывает рецептор на другой клетке, делая возможным межклеточное узнавание и/или взаимодействие.

Используемый в настоящем документе термин «заболевание» означает любое состояние или расстройство, которое нарушает или препятствует нормальному функционированию клетки, ткани или органа. Примеры заболеваний включают неоплазию или инфицирование патогенами клетки.

Используемый в настоящем документе термин «эффективное количество» означает количество, достаточное для достижения терапевтического эффекта. В конкретных вариантах осуществления «эффективное количество» представляет собой количество, достаточное для остановки, ослабления или ингибирования непрерывной пролиферации, роста или метастазирования (например, инвазии или миграции) неоплазии.

Используемый в настоящем документе термин «гетерологичные молекула нуклеиновой кислоты или полипептид» означает молекулу нуклеиновой кислоты (например, молекулу кДНК, ДНК или РНК) или полипептид, которые обычно не присутствуют в клетке или образце, полученном из клетки. Такая нуклеиновая кислота может быть из другого организма или она, например, может представлять собой молекулу мРНК, которая обычно не экспрессируется в клетке или образце.

Используемый в настоящем документе термин «иммунореактивная клетка» означает клетку, которая функционирует при иммунном ответе, либо ее предшественника или потомство.

Используемый в настоящем документе термин «модуляция» означает положительное или отрицательное изменение. Иллюстративная модуляция включает изменение на примерно 1%, примерно 2%, примерно 5%, примерно 10%, примерно 25%, примерно 50%, примерно 75% или примерно 100%.

Используемый в настоящем документе термин «увеличение» означает положительное изменение на по меньшей мере примерно 5%, включая, но без ограничения, положительное изменение на примерно 5%, на примерно 10%, на примерно 25%, на примерно 30%, на примерно 50%, на примерно 75% или на примерно 100%.

Используемый в настоящем документе термин «уменьшение» означает отрицательное изменение на по меньшей мере примерно 5%, включая, но без ограничения, отрицательное изменение на примерно 5%, на примерно 10%, на примерно 25%, на примерно 30%, на примерно 50%, на примерно 75% или на примерно 100%.

Используемый в настоящем документе термин «выделенная клетка» означает клетку, которая отделена от молекулярных и/или клеточных компонентов, которые обычно окружают клетку.

Используемый в настоящем документе термин «выделенный», «очищенный» или «биологически чистый» относится к материалу, который в разной степени свободен от компонентов, которые обычно окружают его в его естественном состоянии. «Выделенный» указывает на состояние отделенности от исходного источника или окружающей среды. «Очищенный» указывает на более высокую степень отделенности, чем при выделении. «Очищенный» или «биологически чистый» белок в достаточной степени свободен от других материалов, так что любые примеси существенно не влияют на биологические свойства белка или не вызывают другие неблагоприятные последствия. То есть, нуклеиновая кислота или пептид по данному изобретению являются очищенными, если они по существу свободны от клеточного материала, вирусного материала или культуральной среды в случае получения методами рекомбинантной ДНК, либо химических предшественников или других химических реагентов в случае химического синтеза. Чистоту и гомогенность, как правило, определяют методами аналитической химии, например, электрофорезом в полиакриламидном геле или высокоэффективной жидкостной хроматографией. Термин «очищенный» может указывать на то, что нуклеиновая кислота или белок образуют практически одну полосу в геле при электрофорезе. В случае белка, который может быть подвергнут модификациям, например, фосфорилированию или гликозилированию, различные модификации могут приводить к образованию разных выделенных белков, которые могут быть очищены отдельно.

Используемый в настоящем документе термин «секретируемый» относится к полипептиду, который высвобождается из клетки секреторным путем через эндоплазматический ретикулум, аппарат Гольджи и в виде везикула, который временно сливается с клеточной плазматической мембраной, выводя белки из клетки.

Используемый в настоящем документе термин «специфически связывает» или «специфически связывается с» или «специфически нацелен» означает, что полипептид или его фрагмент узнает и связывает интересующую биологическую молекулу (например, полипептид), но практически не узнает и не связывает другие молекулы в образце, например, биологическом образце, который естественным образом содержит полипептид по изобретению.

Используемый в настоящем документе термин «лечение» или «терапия» означает клиническое вмешательство в попытке изменить течение заболевания у индивидуума или клетки, которые подвергают лечению, и которое может производиться либо в профилактических целях, либо во время клинической патологии. Терапевтические эффекты лечения включают, но не ограничиваются ими, предотвращение возникновения или рецидива заболевания, ослабление симптомов, уменьшение любых прямых или косвенных патологических последствий заболевания, предотвращение метастазирования, снижение скорости прогрессирования заболевания, облегчение или ослабление болезненного состояния, а также достижение ремиссии или более благоприятного прогноза. В случае предотвращения заболевания или нарушения, лечение может предотвращать ухудшение состояния вследствие заболевания у субъекта с текущим или диагностированным заболеванием, или у субъекта, предположительно имеющего заболевание, однако лечение также способно предотвращать начало развития заболевания или симптома заболевания у субъекта, имеющего риск развития заболевания или предположительно имеющего заболевание.

Используемый в настоящем документе термин «субъект» означает любое животное (например, млекопитающее), включая, но без ограничения, людей, приматов, кроме человека, грызунов и тому подобное (например, которые будут получать конкретное лечение или от которых будут получены клетки).

II. Подобный Fc-рецептору белок 5 (FcRL5)

Подобный Fc-рецептору белок 5 (FcRL5) (также известный как «CD307e» или «IRTA2») является обоснованной мишенью при лечении множественной миеломы, поскольку он экспрессируется на B-клетках и плазматических клетках. FcRL5 связывается с Fc-фрагментом IgG и участвует в сигнализации рецептора B-клетки и пролиферации B-клетки (Franco et al., Journal of immunology 190, 5739-5746 (2013); Dement-Brown et al., Journal of leukocyte biology 91, 59-67 (2012). Установлено, что FcRL5 является альтернативой CD138 в качестве FACS маркера для злокачественных плазматических клеток из свежих или замороженных образцов, полученных от пациента, с величиной средней относительной СИФ, составляющей 10-55 (n=23) (Ise et al., Leukemia 21, 169-174 (2007)). В другом исследовании методом FACS была подтверждена экспрессия на клеточной поверхности FcRL5 в первичных образах от пациентов в большинстве случаев хронического лимфоцитарного лейкоза (CLL) и лимфомы из клеток мантийной зоны, а также во всех изученных случаях множественной миеломы (MM) (n=8) (Ise et al. (2007)). Третья группа исследователей обнаружила интенсивное поверхностное окрашивание на плазматических клетках из нормального костного мозга (n=7), в случаях MGUS (n=16) и в случаях MM (n=16), (величины СИФ сходные во всех трех группах, ~1000-кратное возрастание по сравнению с контролем по изотипу) (Elkins et al., Molecular cancer therapeutics 11, 2222-2232 (2012)). Ген FcRL5 находится в хромосомном участке 1q21 и, как установлено, играет определенную роль в аномалиях 1q21 при B-клеточных злокачественных новообразованиях (Hatzivassiliou et al., Immunity 14, 277-289 (2001)). Амплификация 1q21 обнаружена у 48% пациентов с MM во время диагностирования и у 67% пациентов при рецидиве, и она коррелирует с более неблагоприятным прогнозом (An et al., Haematologica 99, 353-359 (2014)). Конъюгат антитело-лекарственное средство, нацеленный на FcRL5, был эффективным для лечения в in vivo мышиной модели MM (Elkins et al. (2012)).

Неограничивающий примеры аминокислотных последовательностей FcRL5 человека можно найти в базе данных GenBank под регистрационными номерами: AAI01070.1; XP_011508332.1; XP_011508334.1; XP_011508333.1; XP_011508332.1 и NP_001182317.1.

В конкретных неограничивающих вариантах осуществления FcRL5 представляет собой человеческий FcRL5, имеющий аминокислотную последовательность, приведенную в SEQ ID NO: 899, или его фрагменты. SEQ ID NO: 899 представлена ниже:


В конкретных вариантах осуществления FcRL5 содержит 9 иммуноглобулин (Ig)-подобных доменов, например, домен 1, домен 2, домен 3, домен 4, домен 5, домен 6, домен 7, домен 8 и домен 9 (смотри фигуру 3A и 3C). В конкретных вариантах осуществления домен 9 из FcRL5 содержит аминокислотную последовательность, приведенную в SEQ ID NO: 900. SEQ ID NO: 900 представлена ниже.


В конкретных вариантах осуществления домен 9 из FcRL5 может содержать аминокислотную последовательность, приведенную в SEQ ID NO: 963, или ее фрагменты. SEQ ID NO: 963 представлена ниже:


В конкретных вариантах осуществления домен 1 может содержать аминокислоты 23-100 из SEQ ID NO: 899; домен 2 может содержать аминокислоты 105-185 из SEQ ID NO: 899; домен 3 может содержать аминокислоты 191-273 из SEQ ID NO: 899; домен 4 может содержать аминокислоты 287-373 из SEQ ID NO: 899; домен 5 может содержать аминокислоты 380-466 из SEQ ID NO: 899; домен 6 может содержать аминокислоты 490-555 из SEQ ID NO: 899; домен 7 может содержать аминокислоты 565-638 из SEQ ID NO: 899; домен 8 может содержать аминокислоты 658-731 из SEQ ID NO: 899 и домен 9 может содержать аминокислоты 754-835 из SEQ ID NO: 899.

В конкретных вариантах осуществления домен 9 из FcRL5 содержит аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности SEQ ID NO: 900 или 963.

III. Химерный антигенный рецептор (CAR).

Химерные антигенные рецепторы (CAR) представляют собой сконструированные рецепторы, которые сообщают или придают интересующую специфичность иммунной эффекторной клетке. CAR можно использовать для придания специфичности моноклонального антитела T-клетке; при этом перенос их кодирующей последовательности осуществляют с помощью ретровирусных векторов.

Известно три поколения CAR. CAR «первого поколения», как правило, состоят из внеклеточного антигенсвязывающего домена (например, одноцепочечных вариабельных фрагментов (scFv)), слитого с трансмембранным доменом, слитым с цитоплазматическим/внутриклеточным доменом цепи T-клеточного рецептора. CAR «первого поколения», как правило, имеют внутриклеточный домен из CD3ξ-цепи, который является основным передатчиком сигналов от эндогенных TCR. CAR «первого поколения» могут обеспечивать узнавание de novo антигена и вызывать активацию как CD4+, так и CD8+ T-клеток через их сигнальный домен CD3ζ-цепи в одной слитой молекуле, независимо от опосредованного HLA представления антигена. В CAR «второго поколения» добавлены внутриклеточные домены из разных костимулирующих молекул (например, CD28, 4-1BB, ICOS, OX40) к цитоплазматическому хвосту CAR для обеспечения дополнительных сигналов для T-клетки. CAR «второго поколения» включают те, которые обеспечивают как костимуляцию (например, CD28 или 4-1BB), так и активацию (CD3ζ). Доклинические исследования показали, что CAR «второго поколения» способны повышать противоопухолевую активность T-клеток. Например, устойчивая эффективность T-клеток, модифицированных CAR «второго поколения», была продемонстрирована в клинических испытаниях по таргетированию молекулы CD19 у пациентов с хроническим лимфобластным лейкозом (CLL) и острым лимфобластным лейкозом (ALL). CAR «третьего поколения» включают те, которые обеспечивают множественную костимуляцию (например, CD28 и 4-1BB) и активацию (CD3ζ).

В соответствии с настоящим изобретением, CAR содержат внеклеточный антигенсвязывающий домен, трансмембранный домен и внутриклеточный домен, при этом внеклеточный антигенсвязывающий домен связывается с FcRL5. В конкретном неограничивающем варианте осуществления внеклеточный антигенсвязывающий домен представляет собой scFv. В конкретном неограничивающем варианте осуществления внеклеточный антигенсвязывающий домен представляет собой Fab, который, необязательно, является сшитым. В конкретном неограничивающем варианте осуществления внеклеточный связывающий домен представляет собой F(ab)2. В конкретном неограничивающем варианте осуществления любая из вышеуказанных молекул может находиться в слитом белке с гетерологичной последовательностью, образуя внеклеточный антигенсвязывающий домен.

В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен описанного в настоящем документе CAR имеет высокую специфичность связывания, а также высокую аффинность связывания с FcRL5 или доменом 9 из FcRL5. В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен CAR по настоящему изобретению имеет высокую специфичность связывания, а также высокую аффинность связывания с доменом 8 из FcRL5. В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен CAR по настоящему изобретению имеет высокую специфичность связывания, а также высокую аффинность связывания с доменом 7 из FcRL5. Например, в таких вариантах осуществления внеклеточный антигенсвязывающий домен CAR (представляющий собой, например, scFv или его аналог) связывается с FcRL5 (или доменом 8, или доменом 9 из FcRL5) с константой диссоциации (KD), составляющей примерно 3×10-6 M или менее. В конкретных вариантах осуществления KD составляет примерно 1×10-6 M или менее, примерно 1×10-7 M или менее, примерно 1×10-8 M или менее, или примерно 1×10-9 M или менее, примерно 1×10-10 M или менее, или примерно 1×10-11 M или менее. В конкретных вариантах осуществления Kd составляет от примерно 1×10-11 M до примерно 3×10-6 M, от 1×10-10 M до примерно 3×10-6 M или от примерно 1×10-9 M до примерно 3×10-6 M, например, от примерно 1×10-9 M до примерно 1×10-8 M, от примерно 1×10-8 M до примерно 1×10-7 M или от примерно 1×10-7 M до примерно 1×10-6 M, или от примерно 1×10-6 M до примерно 3×10-6 M.

Связывание внеклеточного антигенсвязывающего домена (представляющего собой, например, scFv или его аналог) раскрытого в настоящем документе CAR с FcRL5 (или доменом 8, или доменом 9 из FcRL5) можно подтверждать, например, твердофазным иммуноферментным анализом (ELISA), радиоиммунным анализом (RIA), FACS-анализом, биоанализом (например, ингибированием роста) или вестерн-блоттингом. Каждый из этих анализов, как правило, позволяет обнаруживать наличие конкретных интересующих комплексов белок-антитело за счет использования меченого реагента (например, антитела или scFv), специфичного для интересующего комплекса. Например, scFv можно метить радиоактивной меткой и использовать в радиоиммунном анализе (RIA) (смотри, например, публикацию Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, содержание которой включено в настоящий документ посредством ссылки). Радиоактивный изотоп можно обнаруживать, например, с помощью γ-счетчика или сцинтилляционного счетчика, или авторадиографии. В конкретных вариантах осуществления FcRL5-нацеленный внеклеточный антигенсвязывающий домен мечен флуоресцентным маркером. Неограничивающие примеры флуоресцентных маркеров включают зеленый флуоресцентный белок (GFP), синий флуоресцентный белок (например, EBFP, EBFP2, азурит и mKa1ama1), циановый флуоресцентный белок (например, ECFP, лазурный и CyPet) и желтый флуоресцентный белок (например, YFP, цитрин, Венера и YPet). В конкретных вариантах осуществления FcRL5-нацеленный scFv человека мечен GFP.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен раскрытого в настоящем документе CAR содержит одноцепочечный вариабельный фрагмент (scFv). В одном конкретном варианте осуществления внеклеточный антигенсвязывающий домен раскрытого в настоящем документе CAR содержит scFv человека, который специфически связывается с FcRL5 человека. В другом конкретном варианте осуществления внеклеточный антигенсвязывающий домен раскрытого в настоящем документе CAR содержит scFv мыши, который специфически связывается с FcRL5 человека. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен раскрытого в настоящем документе CAR содержит scFv, который специфически связывается с по меньшей мере частью домена 7 из FcRL5. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен раскрытого в настоящем документе CAR содержит scFv, который специфически связывается с по меньшей мере частью домена 8 из FcRL5. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен раскрытого в настоящем документе CAR содержит scFv, который специфически связывается с по меньшей мере частью домена 9 из FcRL5. Например, и без ограничения, домен 9 из FcRL5 содержит аминокислотную последовательность, приведенную в SEQ ID NO: 900 или 963, или ее фрагменты.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен представляет собой scFv мыши, полученный из двух коммерчески доступных мышиных гибридом, который связывает разные внеклеточные эпитопы на FcRL5 человека, которые были охарактеризованы в публикациях Franco et al., Journal of Immunology (2013); 190: 5739-5746; Ise et al., Clinical cancer research: an official journal of the American Association for Cancer Research (2005); 11: 87-96; и Ise et al., Clinical chemistry and laboratory medicine: CCLM/FESCC (2006); 44: 594-602, полное содержание каждой из которых включено в настоящий документ посредством ссылки. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен представляет собой scFv мыши, полученный из вариабельной области тяжелой цепи и вариабельной области легкой цепи антитела, которое связывается с FcRL5 человека, например, антитела F56 и F119, как описано в публикации Ise et al. (2005), полное содержание которой включено в настоящий документ посредством ссылки.

Внеклеточный антигенсвязывающий домен CAR

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917 и SEQ ID NO: 921, при этом scFv антитело связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915 и SEQ ID NO: 919.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 915, которая представлена ниже.


Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 915, приведена в SEQ ID NO: 916, которая представлена ниже.


В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 917, которая представлена ниже.


Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 917, приведена в SEQ ID NO: 918, которая представлена ниже.


В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 919, которая представлена ниже.


Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 919, приведена в SEQ ID NO: 920, которая представлена ниже.


В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 921, которая представлена ниже.


Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 921, приведена в SEQ ID NO: 922, которая представлена ниже.


В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 144. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 144, приведена в SEQ ID NO: 142.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 143. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 143, приведена в SEQ ID NO: 141.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 216. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 216, приведена в SEQ ID NO: 214.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 215. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 215, приведена в SEQ ID NO: 213.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 220. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 220, приведена в SEQ ID NO: 218.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 219. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 219, приведена в SEQ ID NO: 217.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 236. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 236, приведена в SEQ ID NO: 234.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 235. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 235, приведена в SEQ ID NO: 232.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 268. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 268, приведена в SEQ ID NO: 266.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 267. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 267, приведена в SEQ ID NO: 265.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 172. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 172, приведена в SEQ ID NO: 170.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 171. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 171, приведена в SEQ ID NO: 169.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 116. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 116, приведена в SEQ ID NO: 114.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 115. Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 115, приведена в SEQ ID NO: 113.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917, SEQ ID NO: 921, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 917 и SEQ ID NO: 921, при этом внеклеточный связывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 3, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 4.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 7, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 8.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 11, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 12.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 15, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 16.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 19, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 20.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 23, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 24.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 27, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 28.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 31, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 32.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 35, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 36.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 39, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 40.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 43, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 44.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 47, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 48.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 51, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 52.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 55, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 56.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 59, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 60.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 63, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 64.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 67, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 68.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 71, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 72.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 75, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 76.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 79, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 80.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 83, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 84.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 87, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 88.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 91, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 92.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 95, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 96.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 99, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 100.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 103, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 104.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 107, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 108.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 111, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 112.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 115, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 116.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 119, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 120.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 123, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 124.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 127, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 128.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 131, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 132.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 135, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 136.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 139, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 140.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 143, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 144.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 147, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 148.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 151, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 152.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 155, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 156.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 159, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 160.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 163, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 164.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 167, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 168.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 171, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 172.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 175, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 176.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 179, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 180.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 183, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 184.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 187, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 188.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 191, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 192.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 195, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 196.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 199, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 200.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 203, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 204.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 207, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 208.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 211, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 212.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 215, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 216.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 219, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 220.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 223, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 224.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 227, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 228.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 231, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 232.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 235, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 236.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 239, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 240.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 243, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 244.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 247, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 248.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 251, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 252.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 255, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 256.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 259, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 260.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 263, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 264.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 267, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 268.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 271, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 272.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 275, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 276.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 279, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 280.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 283, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 284.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 287, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 288.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 291, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 292.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 279, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 280.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 283, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 284.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 287, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 288.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 291, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 292.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 295, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 296.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 299, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 300.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 303, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 304.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 915, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 917.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 919, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 921.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельные области тяжелой и легкой цепи, содержащие аминокислотные последовательности, которые гомологичны аминокислотным последовательностям, описанным в настоящем документе и приведенным в таблицах 1-76. Например, и без ограничения, внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917 и SEQ ID NO: 921.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915 и SEQ ID NO: 919.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 3, SEQ ID NO: 7, SEQ ID NO: 11, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 35, SEQ ID NO: 39, SEQ ID NO: 43, SEQ ID NO: 47, SEQ ID NO: 51, SEQ ID NO: 55, SEQ ID NO: 59, SEQ ID NO: 63, SEQ ID NO: 67, SEQ ID NO: 71, SEQ ID NO: 75, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 87, SEQ ID NO: 91, SEQ ID NO: 95, SEQ ID NO: 99, SEQ ID NO: 103, SEQ ID NO: 107, SEQ ID NO: 111, SEQ ID NO: 115, SEQ ID NO: 119, SEQ ID NO: 123, SEQ ID NO: 127, SEQ ID NO: 131, SEQ ID NO: 135, SEQ ID NO: 139, SEQ ID NO: 143, SEQ ID NO: 147, SEQ ID NO: 151, SEQ ID NO: 155, SEQ ID NO: 159, SEQ ID NO: 163, SEQ ID NO: 167, SEQ ID NO: 171, SEQ ID NO: 175, SEQ ID NO: 179, SEQ ID NO: 183, SEQ ID NO: 187, SEQ ID NO: 191, SEQ ID NO: 195, SEQ ID NO: 199, SEQ ID NO: 203, SEQ ID NO: 207, SEQ ID NO: 211, SEQ ID NO: 215, SEQ ID NO: 219, SEQ ID NO: 223, SEQ ID NO: 227, SEQ ID NO: 231, SEQ ID NO: 235, SEQ ID NO: 239, SEQ ID NO: 243, SEQ ID NO: 247, SEQ ID NO: 251, SEQ ID NO: 255, SEQ ID NO: 259, SEQ ID NO: 263, SEQ ID NO: 267, SEQ ID NO: 271, SEQ ID NO: 275, SEQ ID NO: 279, SEQ ID NO: 283, SEQ ID NO: 287, SEQ ID NO: 291, SEQ ID NO: 295, SEQ ID NO: 299, SEQ ID NO: 303, SEQ ID NO: 917 и SEQ ID NO: 921; и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, выбранной из группы, состоящей из SEQ ID NO: 4, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 16, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 28, SEQ ID NO: 32, SEQ ID NO: 36, SEQ ID NO: 40, SEQ ID NO: 44, SEQ ID NO: 48, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68, SEQ ID NO: 72, SEQ ID NO: 76, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 96, SEQ ID NO: 100, SEQ ID NO: 104, SEQ ID NO: 108, SEQ ID NO: 112, SEQ ID NO: 116, SEQ ID NO: 120, SEQ ID NO: 124, SEQ ID NO: 128, SEQ ID NO: 132, SEQ ID NO: 136, SEQ ID NO: 140, SEQ ID NO: 144, SEQ ID NO: 148, SEQ ID NO: 152, SEQ ID NO: 156, SEQ ID NO: 160, SEQ ID NO: 164, SEQ ID NO: 168, SEQ ID NO: 172, SEQ ID NO: 176, SEQ ID NO: 180, SEQ ID NO: 184, SEQ ID NO: 188, SEQ ID NO: 192, SEQ ID NO: 196, SEQ ID NO: 200, SEQ ID NO: 204, SEQ ID NO: 208, SEQ ID NO: 212, SEQ ID NO: 216, SEQ ID NO: 220, SEQ ID NO: 224, SEQ ID NO: 228, SEQ ID NO: 232, SEQ ID NO: 236, SEQ ID NO: 240, SEQ ID NO: 244, SEQ ID NO: 248, SEQ ID NO: 252, SEQ ID NO: 256, SEQ ID NO: 260, SEQ ID NO: 264, SEQ ID NO: 268, SEQ ID NO: 272, SEQ ID NO: 276, SEQ ID NO: 280, SEQ ID NO: 284, SEQ ID NO: 288, SEQ ID NO: 292, SEQ ID NO: 296, SEQ ID NO: 300, SEQ ID NO: 304, SEQ ID NO: 915 и SEQ ID NO: 919.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 143, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 144, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 215, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 216, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 219, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 220, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 235, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 236, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 267, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 268, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 915, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 917, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 919, и (b) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 921, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 115, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 116, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) вариабельную область легкой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 171, и (b) вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, которая по меньшей мере на 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% гомологична аминокислотной последовательности, приведенной в SEQ ID NO: 172, при этом внеклеточный антигенсвязывающий домен связывается с полипептидом FcRL5.

Внеклеточный антигенсвязывающий домен (например, scFv), содержащий области VH и/или VL, имеющие высокую степень (то есть, 80% или более) гомологии с областями VH и VL последовательностей, приведенных выше, можно получать путем мутагенеза (например, сайт-направленного или ПЦР-опосредованного мутагенеза), с последующим тестированием закодированных измененных scFv на сохранение функции (то есть, аффинности связывания) с использованием анализов связывания, описанных в настоящем документе. В конкретных вариантах осуществления последовательность VL, имеющая по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности, имеет замены (например, консервативные замены для получения консервативных модификаций последовательности), вставки или делеции относительно эталонной последовательности, однако внеклеточный антигенсвязывающий домен (например, scFv), содержащий данную последовательность, сохраняет способность связываться с FcRL5. В конкретных вариантах осуществления последовательность VH, имеющая по меньшей мере 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% или 99% идентичности, имеет замены (например, консервативные замены), вставки или делеции относительно эталонной последовательности, однако внеклеточный антигенсвязывающий домен (например, scFv), содержащий данную последовательность, сохраняет способность связываться с FcRL5. В конкретных вариантах осуществления в общей сложности от примерно 1 до примерно 10 аминокислот были заменены, вставлены и/или делетированы в раскрытых последовательностях. Например, и без ограничения, последовательность VH или последовательность VL может иметь до примерно одного, до примерно двух, до примерно трех, до примерно четырех, до примерно пяти, до примерно шести, до примерно семи, до примерно восьми, до примерно девяти или до примерно десяти аминокислотных остатков, которые модифицированы и/или заменены. Неограничивающие примеры консервативных модификаций приведены ниже, например, в таблице 231.

Настоящее изобретение также относится к внеклеточным антигенсвязывающим доменам (например, scFv), которые содержат CDR вариабельной области тяжелой цепи и вариабельной области легкой цепи, например, CDR1, CDR2 и CDR3, приведенные в настоящем документе в таблицах 229 и 230. Границы областей CDR определены с использованием системы Kabat (Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, пятое издание, U.S. Department of Health и Human Services, NIH Publication No. 91-3242). Настоящее изобретение также относится к внеклеточным антигенсвязывающим доменам (например, scFv), которые имеют консервативные модификации последовательностей антитела, раскрытых в настоящем документе. Например, и без ограничения, внеклеточные антигенсвязывающие домены (например, scFv) по настоящему изобретению содержат вариабельную область тяжелой цепи, содержащую последовательности CDR1, CDR2 и CDR3, и вариабельную область легкой цепи, содержащую последовательности CDR1, CDR2 и CDR3, при этом одна или более из этих последовательностей CDR содержат конкретные аминокислотные последовательности, раскрытые в настоящем документе, или их консервативные модификации, и при этом внеклеточные антигенсвязывающие домены сохраняют желательные функциональные свойства. Смотри таблицы 229 и 230.

В конкретных вариантах осуществления настоящее изобретение относится к внеклеточному антигенсвязывающему домену (например, scFv), содержащему вариабельную область легкой цепи, при этом вариабельная область легкой цепи содержит: (a) CDR1, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 312, 3118, 324, 329, 338, 343, 348, 352, 357, 363, 369, 381, 390, 397, 401, 406, 416, 423, 428, 433, 447, 460, 468, 474, 477, 483, 490, 498, 503, 508, 518, 533, 540, 544, 547, 556, 562, 568, 571, 580, 585, 588, 926 и 932, а также их консервативных модификаций; (b) CDR2, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs:313, 319, 330, 344, 349, 358, 364, 370, 382, 385, 391, 398, 409, 417, 429, 434, 438, 448, 454, 461, 469, 478, 484, 487, 504, 513, 523, 534, 429, 448, 548, 557, 563, 572, 575, 586, 927 и 933, а также их консервативных модификаций; и (c) CDR3, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 314, 320, 325, 331, 339, 345, 350, 353, 359, 365, 371, 377, 383, 386, 392, 395, 399, 402, 407, 410, 414, 418, 419, 424, 430, 435, 439, 443, 449, 452, 455, 457, 462, 465, 470, 479, 485, 488, 491, 493, 495, 499, 505, 509, 514, 519, 524, 528, 530, 531, 535, 541, 542, 545, 549, 554, 558, 564, 569, 573, 576, 581, 592, 928 и 934, а также их консервативных модификаций.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, при этом вариабельная область тяжелой цепи содержит: (a) CDR1, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 309, 315, 321, 326, 332, 335, 340, 346, 354, 360, 366, 372, 378, 387, 393, 403, 411, 420, 425, 436, 440, 444, 471, 480, 500, 510, 515, 520, 525, 537, 551, 559, 565, 582, 589, 923 и 929, а также их консервативных модификаций; (b) CDR2, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 310, 316, 322, 327, 333, 336, 341, 355, 361, 367, 373, 379, 388, 404, 412, 421, 426, 431, 441, 445, 450, 466, 472, 475, 481, 496, 501, 506, 511, 516, 521, 526, 538, 552, 560, 566, 583, 590, 924 и 930, а также их консервативных модификаций; и (c) CDR3, содержащую аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 311, 317, 323, 328, 334, 337, 342, 347, 351, 356, 362, 368, 374, 376, 380, 384, 389, 394, 396, 400, 405, 408, 412, 415, 422, 427, 432, 437, 442, 446, 451, 453, 456, 458, 459, 463, 464, 467, 473, 476, 482, 486, 489, 492, 494, 497, 502, 507, 512, 517, 522, 527, 529, 532, 536, 539, 543, 546, 550, 553, 555, 561, 567, 570, 574, 577, 578, 579, 584, 578, 587, 591, 925 и 931, а также их консервативных модификаций.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 463 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 419 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 515 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 516 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 517 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 531 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 403 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 404 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 532 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 533 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 534 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 535 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 543 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 544 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 448 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 545 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 372 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 475 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 570 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 571 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 572 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 573 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 440 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 441 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 442 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 329 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 330 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 443 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 309 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 310 или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 489 или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 490 или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 313 или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 491 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 923, или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 924, или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 925, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 926, или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 927, или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 928, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 929, или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 930, или ее консервативные модификации; и (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 931, или ее консервативные модификации. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен содержит (a) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 932, или ее консервативные модификации; (b) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 933, или ее консервативные модификации; и (c) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 934, или ее консервативные модификации.

Настоящее изобретение относится к внеклеточному антигенсвязывающему домену (например, scFv), содержащему вариабельную область тяжелой цепи, содержащую последовательности CDR1, CDR2 и CDR3, и вариабельную область легкой цепи, содержащую последовательности CDR1, CDR2 и CDR3, при этом: (a) CDR3 вариабельной области тяжелой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 311, 317, 323, 328, 334, 337, 342, 347, 351, 356, 362, 368, 374, 376, 380, 384, 389, 394, 396, 400, 405, 408, 412, 415, 422, 427, 432, 437, 442, 446, 451, 453, 456, 458, 459, 463, 464, 467, 473, 476, 482, 486, 489, 492, 494, 497, 502, 507, 512, 517, 522, 527, 529, 532, 536, 539, 543, 546, 550, 553, 555, 561, 567, 570, 574, 577, 578, 579, 584, 578, 587, 591, 925 и 931, а также их консервативных модификаций; и (b) CDR3 вариабельной области легкой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 314, 320, 325, 331, 339, 345, 350, 353, 359, 365, 371, 377, 383, 386, 392, 395, 399, 402, 407, 410, 414, 418, 419, 424, 430, 435, 439, 443, 449, 452, 455, 457, 462, 465, 470, 479, 485, 488, 491, 493, 495, 499, 505, 509, 514, 519, 524, 528, 530, 531, 535, 541, 542, 545, 549, 554, 558, 564, 569, 573, 576, 581, 592, 928 и 934, а также их консервативных модификаций; при этом внеклеточный антигенсвязывающий домен специфически связывается с FcRL5 человека.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 463 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 419 или ее консервативные модификации; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 517 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 531 или ее консервативные модификации; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 532 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 535 или ее консервативные модификации; при этом антитело или его антигенсвязывающий фрагмент специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 543 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 545 или ее консервативные модификации; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 570 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 573 или ее консервативные модификации; при этом антитело или его антигенсвязывающий фрагмент специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 925, или ее консервативные модификации; и (b) и CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 928, или ее консервативные модификации; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 931, или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 934, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 442 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 443 или ее консервативные модификации; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 489 или ее консервативные модификации; и (b) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 491 или ее консервативные модификации; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления настоящее изобретение относится к внеклеточному антигенсвязывающему домену (например, scFv), содержащему вариабельную область тяжелой цепи, содержащую последовательности CDR1, CDR2, и CDR3, и вариабельную область легкой цепи, содержащую последовательности CDR1, CDR2, и CDR3, при этом: (a) CDR1 вариабельной области тяжелой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 309, 315, 321, 326, 332, 335, 340, 346, 354, 360, 366, 372, 378, 387, 393, 403, 411, 420, 425, 436, 440, 444, 471, 480, 500, 510, 515, 520, 525, 537, 551, 559, 565, 582, 589, 923 и 929, а также их консервативных модификаций; (b) CDR2 вариабельной области тяжелой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 310, 316, 322, 327, 333, 336, 341, 355, 361, 367, 373, 379, 388, 404, 412, 421, 426, 431, 441, 445, 450, 466, 472, 475, 481, 496, 501, 506, 511, 516, 521, 526, 538, 552, 560, 566, 583, 590, 924 и 930, а также их консервативных модификаций; (c) CDR3 вариабельной области тяжелой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 311, 317, 323, 328, 334, 337, 342, 347, 351, 356, 362, 368, 374, 376, 380, 384, 389, 394, 396, 400, 405, 408, 412, 415, 422, 427, 432, 437, 442, 446, 451, 453, 456, 458, 459, 463, 464, 467, 473, 476, 482, 486, 489, 492, 494, 497, 502, 507, 512, 517, 522, 527, 529, 532, 536, 539, 543, 546, 550, 553, 555, 561, 567, 570, 574, 577, 578, 579, 584, 578, 587, 591, 925 и 931, а также их консервативных модификаций; (d) CDR1 вариабельной области легкой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 312, 3118, 324, 329, 338, 343, 348, 352, 357, 363, 369, 381, 390, 397, 401, 406, 416, 423, 428, 433, 447, 460, 468, 474, 477, 483, 490, 498, 503, 508, 518, 533, 540, 544, 547, 556, 562, 568, 571, 580, 585, 588, 926 и 932, а также их консервативных модификаций; (e) CDR2 вариабельной области легкой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs:313, 319, 330, 344, 349, 358, 364, 370, 382, 385, 391, 398, 409, 417, 429, 434, 438, 448, 454, 461, 469, 478, 484, 487, 504, 513, 523, 534, 429, 448, 548, 557, 563, 572, 575, 586, 927 и 933, а также их консервативных модификаций; и (f) CDR3 вариабельной области легкой цепи содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NOs: 314, 320, 325, 331, 339, 345, 350, 353, 359, 365, 371, 377, 383, 386, 392, 395, 399, 402, 407, 410, 414, 418, 419, 424, 430, 435, 439, 443, 449, 452, 455, 457, 462, 465, 470, 479, 485, 488, 491, 493, 495, 499, 505, 509, 514, 519, 524, 528, 530, 531, 535, 541, 542, 545, 549, 554, 558, 564, 569, 573, 576, 581, 592, 928 и 934, а также их консервативных модификаций; при этом внеклеточный антигенсвязывающий домен специфически связывает FcRL5.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 463 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 419 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 515 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 516 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 517 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 318 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 319 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 531 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 403 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 404 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 532 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 533 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 534 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 535 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 411 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 412 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 543 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 544 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 448 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 545 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 372 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 475 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 570 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 571 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 572 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 573 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 923, или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 924, или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 925, или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 926, или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 927, или ее консервативные модификации; и (f) и CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 928, или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 929, или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 930, или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 931, или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 932, или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 933, или ее консервативные модификации, и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 934, или ее консервативные модификации.

В конкретных вариантах осуществления раскрытое в настоящем документе анти-FcRL5 антитело или его антигенсвязывающий фрагмент содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 440 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 441 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 442 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 329 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 330 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 443 или ее консервативные модификации.

В конкретных вариантах осуществления раскрытое в настоящем документе анти-FcRL5 антитело или его антигенсвязывающий фрагмент содержит: (a) CDR1 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 309 или ее консервативные модификации; (b) CDR2 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 310 или ее консервативные модификации; (c) CDR3 вариабельной области тяжелой цепи, содержащую аминокислотную последовательность SEQ ID NO: 489 или ее консервативные модификации; (d) CDR1 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 490 или ее консервативные модификации; (e) CDR2 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 313 или ее консервативные модификации; и (f) CDR3 вариабельной области легкой цепи, содержащую аминокислотную последовательность SEQ ID NO: 491 или ее консервативные модификации.

Используемый в настоящем документе термин «консервативные модификации последовательности» означает аминокислотные модификации, которые существенно не затрагивают или не изменяют характеристики связывания раскрытого в настоящем документе CAR (например, внеклеточного антигенсвязывающего домена), содержащего аминокислотную последовательность. Такие консервативные модификации включают аминокислотные замены, добавления и делеции. Модификации могут быть внесены в человеческий scFv по настоящему изобретению стандартными методами, известными в данной области, такими как сайт-направленный мутагенез и ПЦР-опосредованный мутагенез. Аминокислоты могут быть разделены на группы на основании их физико-химических свойств, таких как заряд и полярность.

Консервативные аминокислотные замены являются такими заменами, при которых аминокислотный остаток заменен аминокислотой, относящейся к той же группе. Например, аминокислоты могут быть разделены на группы на основании заряда: положительно заряженные аминокислоты включают лизин, аргинин, гистидин; отрицательно заряженные аминокислоты включают аспарагиновую кислоту, глутаминовую кислоту; нейтральные аминокислоты включают аланин, аспарагин, цистеин, глутамин, глицин, изолейцин, лейцин, метионин, фенилаланин, пролин, серин, треонин, триптофан, тирозин и валин. Кроме того, аминокислоты могут быть разделены на группы на основании полярности: полярные аминокислоты включают аргинин (основная полярная), аспарагин, аспарагиновую кислоту (кислая полярная), глутаминовую кислоту (кислая полярная), глутамин, гистидин (основная полярная), лизин (основная полярная), серин, треонин и тирозин; неполярные аминокислоты включают аланин, цистеин, глицин, изолейцин, лейцин, метионин, фенилаланин, пролин, триптофан и валин. Таким образом, один или более аминокислотных остатков в области CDR можно заменять другими аминокислотными остатками из той же группы, и измененное антитело можно тестировать на сохранение функции (то есть, функций, описанных в пунктах (c)-(l), выше) в функциональных анализах, описанных в настоящем документе. В конкретных вариантах осуществления не более одного, не более двух, не более трех, не более четырех, не более пяти остатков в конкретной последовательности или области CDR изменены. Иллюстративные консервативные аминокислотные замены приведены в таблице 231.

Таблица 231

Исходный остаток Иллюстративные консервативные аминокислотные замены
Ala (A) Val; Leu; Ile
Arg (R) Lys; Gln; Asn
Asn (N) Gln; His; Asp, Lys; Arg
Asp (D) Glu; Asn
Cys (C) Ser; Ala
Gln (Q) Asn; Glu
Glu (E) Asp; Gln
Gly (G) Ala
His (H) Asn; Gln; Lys; Arg
Ile (I) Leu; Val; Met; Ala; Phe
Leu (L) Ile; Val; Met; Ala; Phe
Lys (K) Arg; Gln; Asn
Met (M) Leu; Phe; Ile
Phe (F) Trp; Leu; Val; Ile; Ala; Tyr
Pro (P) Ala
Ser (S) Thr
Thr (T) Val; Ser
Trp (W) Tyr; Phe
Tyr (Y) Trp; Phe; Thr; Ser
Val (V) Ile; Leu; Met; Phe; Ala

В конкретных неограничивающих вариантах осуществления внеклеточный антигенсвязывающий домен CAR может содержать линкер, соединяющий вариабельную область тяжелой цепи и вариабельную область легкой цепи внеклеточного антигенсвязывающего домена. Используемый в настоящем документе термин «линкер» означает функциональную группу (например, химическую группу или полипептид), которая ковалентно связывает два или более пептидов, или нуклеиновых кислот так, что они становятся связанными друг с другом. Используемый в настоящем документе термин «пептидный линкер» означает одну или более аминокислот, используемых для связывания между собой двух белков (например, для связывания доменов VH и VL). Неограничивающие примеры пептидных линкеров описаны в Shen et al., Anal. Chem. 80(6): 1910-1917 (2008).

В одном неограничивающем примере линкер представляет собой линкер G4S, который содержит аминокислотную последовательность, приведенную в SEQ ID NO: 897. В конкретных вариантах осуществления нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 897, приведена в SEQ ID NO: 898. В одном неограничивающем примере линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 307. В конкретных вариантах осуществления нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 307, приведена в SEQ ID NO: 305.

В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 901, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 902, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 903, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 904, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 905, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 906, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 907, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 908, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 909, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 910, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 911, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 912, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 913, которая представлена ниже.


В конкретных вариантах осуществления линкер содержит аминокислотную последовательность, приведенную в SEQ ID NO: 914, которая представлена ниже.

AAA [SEQ ID NO: 914].

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv) содержит вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи. Неограничивающие примеры внеклеточных антигенсвязывающих доменов, например, scFv, по настоящему изобретению, которые содержат вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, приведены в таблицах 77-152. Например, и без ограничения, внеклеточный антигенсвязывающий домен, содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, по настоящему изобретению содержит аминокислотную последовательность, выбранную из группы, состоящей из SEQ ID NO: 594, SEQ ID NO: 596, SEQ ID NO: 598, SEQ ID NO: 600, SEQ ID NO: 602, SEQ ID NO: 604, SEQ ID NO: 606, SEQ ID NO: 608, SEQ ID NO: 610, SEQ ID NO: 612, SEQ ID NO: 614, SEQ ID NO: 616, SEQ ID NO: 618, SEQ ID NO: 620, SEQ ID NO: 622, SEQ ID NO: 624, SEQ ID NO: 626, SEQ ID NO: 628, SEQ ID NO: 630, SEQ ID NO: 632, SEQ ID NO: 634, SEQ ID NO: 636, SEQ ID NO: 638, SEQ ID NO: 640, SEQ ID NO: 642, SEQ ID NO: 644, SEQ ID NO: 646, SEQ ID NO: 648, SEQ ID NO: 650, SEQ ID NO: 652, SEQ ID NO: 654, SEQ ID NO: 656, SEQ ID NO: 658, SEQ ID NO: 660, SEQ ID NO: 662, SEQ ID NO: 664, SEQ ID NO: 666, SEQ ID NO: 668, SEQ ID NO: 670, SEQ ID NO: 672, SEQ ID NO: 674, SEQ ID NO: 676, SEQ ID NO: 678, SEQ ID NO: 680, SEQ ID NO: 682, SEQ ID NO: 684, SEQ ID NO: 686, SEQ ID NO: 688, SEQ ID NO: 690, SEQ ID NO: 692, SEQ ID NO: 694, SEQ ID NO: 696, SEQ ID NO: 698, SEQ ID NO: 700, SEQ ID NO: 702, SEQ ID NO: 704, SEQ ID NO: 706, SEQ ID NO: 708, SEQ ID NO: 710, SEQ ID NO: 712, SEQ ID NO: 714, SEQ ID NO: 716, SEQ ID NO: 718, SEQ ID NO: 720, SEQ ID NO: 722, SEQ ID NO: 724, SEQ ID NO: 726, SEQ ID NO: 728, SEQ ID NO: 730, SEQ ID NO: 732, SEQ ID NO: 734, SEQ ID NO: 736, SEQ ID NO: 738, SEQ ID NO: 740, SEQ ID NO: 742, SEQ ID NO: 744, а также их консервативных модификаций (смотри таблицы 77-152).

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 650 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 664 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 678 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 700 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 702 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 710 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 726 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 650 или ее консервативные модификации.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен (например, scFv), содержащий вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер, содержит аминокислотную последовательность SEQ ID NO: 678 или ее консервативные модификации.

Кроме того, внеклеточный антигенсвязывающий домен может содержать лидер или сигнальный пептид, который направляет образующийся белок в эндоплазматический ретикулум. Сигнальный пептид или лидер может быть необходим, если CAR должен быть гликозилирован и заякорен в клеточной мембране. Сигнальная последовательность или лидер может представлять собой пептидную последовательность (длиной примерно 5, примерно 10, примерно 15, примерно 20, примерно 25 или примерно 30 аминокислот), находящуюся на N-конце заново синтезированных белков, которая направляет их на путь секреции. В неограничивающих примерах сигнальный пептид ковалентно связан с 5'-концом внеклеточного антигенсвязывающего домена. В конкретных вариантах осуществления сигнальный пептид содержит полипептид CD8, содержащий аминокислотную последовательность, приведенную в SEQ ID NO: 26, которая представлена ниже.


Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 935, приведена в SEQ ID NO: 936, которая представлена ниже:


В другом варианте осуществления сигнальный пептид содержит аминокислотную последовательность, приведенную в SEQ ID NO: 937, которая представлена ниже.


Нуклеотидная последовательность, кодирующая аминокислотную последовательность SEQ ID NO: 937, приведена в SEQ ID NO: 938, которая представлена ниже:


В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен, например, scFv человека, содержит вариабельную область тяжелой цепи, вариабельную область легкой цепи, пептидный линкер между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, а также His-метку и HA-метку. В конкретных вариантах осуществления аминокислотная последовательность His-метки и HA-метки содержит аминокислотную последовательность SEQ ID NO: 308. Нуклеотидная последовательность, кодирующая SEQ ID NO: 308, приведена в SEQ ID NO: 306.

В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен, например, scFv человека, связывается с полипептидом FcRL5 человека, содержащим аминокислотную последовательность, приведенную в SEQ ID NO: 899. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен, например, scFv человека, связывается с эпитопом в домене 9 (например, аминокислотами 754-835 из SEQ ID NO: 899). В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен, например, scFv человека, связывается с эпитопом в домене 8 (например, аминокислотами 658-731 из SEQ ID NO: 899). В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен, например, scFv человека, связывается с эпитопом в составе домена 9, содержащим аминокислоты 829-840 из SEQ ID NO: 899. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен, например, scFv человека, связывается с эпитопом в составе домена 8, содержащим аминокислоты 657-667 из SEQ ID NO: 899. Например, и без ограничения, внеклеточный антигенсвязывающий домен, например, scFv человека, связывается с эпитопом, содержащим аминокислотную последовательность RSETVTLYITGL (SEQ ID NO: 964). В конкретных вариантах осуществления антитело или его антигенсвязывающий фрагмент по настоящему изобретению связывается с эпитопом, содержащим аминокислотную последовательность SRPILTFRAPR (SEQ ID NO: 965).

Трансмембранный домен CAR

В конкретных неограничивающих вариантах осуществления трансмембранный домен CAR содержит гидрофобную альфа-спираль, которая проходит через по меньшей мере часть мембраны. Разные трансмембранные домены приводят к разной стабильности рецепторов. После узнавания антигена происходит кластеризация рецепторов и сигнал передается клетке. В соответствии с настоящим изобретением, трансмембранный домен CAR может содержать полипептид CD8, полипептид CD28, полипептид CD3ζ, полипептид CD4, полипептид 4-1BB, полипептид OX40, полипептид ICOS, полипептид CTLA-4, полипептид PD-1, полипептид LAG-3, полипептид 2B4, полипептид BTLA, синтетический пептид (не на основе белка, связанного с иммунным ответом) или их сочетание.

В конкретных вариантах осуществления трансмембранный домен раскрытого в настоящем документе CAR содержит полипептид CD28. Полипептид CD28 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или 100% гомологична последовательности, имеющей регистрационный № NCBI: P10747 или NP_006130 (SEQ ID NO: 939), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены. В неограничивающих вариантах осуществления полипептид CD28 может иметь аминокислотную последовательность, которая представляет собой непрерывный фрагмент из SEQ ID NO: 939, имеющий длину по меньшей мере 20 или по меньшей мере 30, или по меньшей мере 40, или по меньшей мере 50 и вплоть до 220 аминокислот. Альтернативно или дополнительно, в неограничивающих различных вариантах осуществления полипептид CD28 имеет аминокислотную последовательность из аминокислот 1-220, 1-50, 50-100, 100-150, 150-200 или 200-220 из SEQ ID NO: 939. В конкретных вариантах осуществления CAR, раскрытый в настоящем документе, содержит трансмембранный домен, содержащий полипептид CD28, и внутриклеточный домен, содержащий костимулирующую сигнальную область, которая содержит полипептид CD28. В конкретных вариантах осуществления полипептид CD28, содержащийся в трансмембранном домене и внутриклеточном домене, имеет аминокислотную последовательность из аминокислот 114-220 из SEQ ID NO: 939.

SEQ ID NO: 939 приведена ниже:





В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты CD28» означает полинуклеотид, кодирующий полипептид CD28. В конкретных вариантах осуществления молекула нуклеиновой кислоты CD28, кодирующая полипептид CD28, содержащийся в трансмембранном домене и внутриклеточном домене (например, костимулирующей сигнальной области) раскрытого в настоящем документе CAR (аминокислоты 114-220 из SEQ ID NO: 939), содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 940, которая представлена ниже.


В конкретных вариантах осуществления трансмембранный домен раскрытого в настоящем документе CAR содержит полипептид CD8. Полипептид CD8 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или 100% гомологична последовательности, имеющей регистрационный № NCBI: AAH25715 (SEQ ID NO: 960), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены. В неограничивающих вариантах осуществления полипептид CD8 может иметь аминокислотную последовательность, которая представляет собой непрерывный фрагмент из SEQ ID NO: 960, имеющий длину по меньшей мере 20 или по меньшей мере 30, или по меньшей мере 40, или по меньшей мере 50, или по меньшей мере 70, или по меньшей мере 100, или по меньшей мере 150, или по меньшей мере 200 и вплоть до 235 аминокислот. Альтернативно или дополнительно, в неограничивающих различных вариантах осуществления полипептид CD8 имеет аминокислотную последовательность из аминокислот 1-235, 1-50, 50-100, 100-150, 150-200, 130-210 или 200-235 из SEQ ID NO: 960. В конкретных вариантах осуществления полипептид CD8, содержащийся в трансмембранном домене, имеет аминокислотную последовательность из аминокислот 137-207 из SEQ ID NO: 960.

SEQ ID NO: 960 приведена ниже:

1 malpvtalll plalllhaar psqfrvspld rtwnlgetve lkcqvllsnp tsgcswlfqp

61 rgaaasptfl lylsqnkpka aegldtqrfs gkrlgdtfvl tlsdfrrene gcyfcsalsn

121 simyfshfvp vflpakpttt paprpptpap tiasqplslr peacrpaagg avhtrgldfa

181 cdiyiwapla gtcgvlllsl vitlycnhrn rrrvckcprp vvksgdkpsl saryv [SEQ ID NO: 960]

В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты CD8» означает полинуклеотид, кодирующий полипептид CD8. В конкретных вариантах осуществления молекула нуклеиновой кислоты CD8, кодирующая полипептид CD8, содержащийся в трансмембранном домене и внутриклеточном домене (например, костимулирующей сигнальной области) раскрытого в настоящем документе CAR (аминокислоты 137-207 из SEQ ID NO: 960), содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 961, которая представлена ниже.


В конкретных неограничивающих вариантах осуществления CAR также может содержать область спейсера, который связывает внеклеточный антигенсвязывающий домен с трансмембранным доменом. Область спейсера может быть достаточно гибкой, чтобы позволять антигенсвязывающему домену ориентироваться в разных направлениях для облегчения узнавания антигена. Область спейсера может представлять собой шарнирную область из IgG1, либо область CH2CH3 иммуноглобулина и части CD3.

Внутриклеточный домен CAR

В конкретных неограничивающих вариантах осуществления внутриклеточный домен CAR может содержать полипептид CD3ζ, который может активировать или стимулировать клетку (например, клетку лимфоидной линии, например, T-клетку). CD3ζ содержит три ITAM и передает сигнал активации клетке (например, клетке лимфоидной линии, например, T-клетке) после связывания антигена. Полипептид CD3ζ может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100% гомологична последовательности, приведенной в SEQ ID NO: 941, или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены. В неограничивающих вариантах осуществления полипептид CD3ζ может иметь аминокислотную последовательность, которая представляет собой непрерывный фрагмент из SEQ ID NO: 941, имеющий длину по меньшей мере 20, или по меньшей мере 30, или по меньшей мере 40, или по меньшей мере 50 и вплоть до 163 аминокислот. Альтернативно или дополнительно, в неограничивающих различных вариантах осуществления полипептид CD3ζ имеет аминокислотную последовательность из аминокислот 1-163, 1-50, 50-100, 100-150, или 150-163 из SEQ ID NO: 941. В конкретных вариантах осуществления полипептид CD3ζ, содержащийся в внутриклеточном домене раскрытого в настоящем документе CAR, имеет аминокислотную последовательность из аминокислот 52-163 из SEQ ID NO: 941.

SEQ ID NO: 941 приведена ниже:




В соответствии с настоящим изобретением «молекула нуклеиновой кислоты CD3ζ» означает полинуклеотид, кодирующий полипептид CD3ζ. В конкретных вариантах осуществления молекула нуклеиновой кислоты CD3ζ, кодирующая полипептид CD3ζ, содержащийся в внутриклеточном домене раскрытого в настоящем документе CAR (аминокислоты 52-163 из SEQ ID NO: 941), содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 942, которая представлена ниже.


В конкретных неограничивающих вариантах осуществления внутриклеточный домен CAR дополнительно содержит по меньшей мере одну сигнальную область. По меньшей мере одна сигнальная область может содержать полипептид CD28, полипептид 4-1BB, полипептид OX40, полипептид ICOS, полипептид DAP-10, полипептид PD-1, полипептид CTLA-4, полипептид LAG-3, полипептид 2B4, полипептид BTLA, синтетический пептид (не на основе белка, связанного с иммунным ответом) или их сочетание.

В конкретных вариантах осуществления сигнальная область представляет собой костимулирующую сигнальную область. В конкретных вариантах осуществления костимулирующая область содержит по меньшей мере одну костимулирующую молекулу, которая может обеспечивать оптимальную активацию лимфоцитов. Используемый в настоящем документе термин «костимулирующие молекулы» означает молекулы клеточной поверхности, отличные от антигенных рецепторов или их лигандов, которые необходимы для эффективного ответа лимфоцитов на антиген. По меньшей мере одна костимулирующая сигнальная область может содержать полипептид CD28, полипептид 4-1BB, полипептид OX40, полипептид ICOS, полипептид DAP-10 или их сочетание. Костимулирующая молекула может связываться с костимулирующим лигандом, представляющим собой белок, экспрессируемый на клеточной поверхности, который при связывании с его рецептором продуцирует костимулирующий ответ, то есть, внутриклеточный ответ, который влияет на стимуляцию, возникающую, когда антиген связывается с молекулой его CAR. Костимулирующие лиганды включают, но не ограничиваются ими, CD80, CD86, CD70, OX40L, 4-1BBL, CD48, TNFRSF14 и PD-L1. В качестве одного примера, лиганд 4-1BB (то есть, 4-1BBL) может связываться с 4-1BB (также известным как «CD137»), обеспечивая внутриклеточный сигнал, который в сочетании с сигналом CAR индуцирует эффекторную клеточную функцию CAR+ T-клетки. CAR, содержащие внутриклеточный домен, который содержит костимулирующую сигнальную область, содержащую 4-1BB, ICOS или DAP-10, описаны в патенте США 7446190 (например, нуклеотидная последовательность, кодирующая 4-1BB, приведена в SEQ ID NO: 15, нуклеотидная последовательность, кодирующая ICOS, приведена в SEQ ID NO: 16 и нуклеотидная последовательность, кодирующая DAP-10, приведена в SEQ ID NO: 17 в патенте США 7446190), полное содержание которого включено в настоящий документ посредством ссылки. В конкретных вариантах осуществления внутриклеточный домен CAR содержит костимулирующую сигнальную область, которая содержит полипептид CD28. В конкретных вариантах осуществления внутриклеточный домен CAR содержит костимулирующую сигнальную область, которая содержит две костимулирующие молекулы: CD28 и 4-1BB или CD28 и OX40.

4-1BB может действовать в качестве лиганда фактора некроза опухолей (TNF) и имеет стимулирующую активность. Полипептид 4-1BB может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или 100% гомологична последовательности, имеющей регистрационный № NCBI: P41273 или NP_001552 (SEQ ID NO: 943), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены. В конкретных вариантах осуществления полипептид 4-1BB, содержащийся в внутриклеточном домене раскрытого в настоящем документе CAR, имеет аминокислотную последовательность из аминокислот 214-255 из SEQ ID NO: 943. SEQ ID NO: 943 приведена ниже:






В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты 4-1BB» означает полинуклеотид, кодирующий полипептид 4-1BB. В конкретных вариантах осуществления молекула нуклеиновой кислоты 4-1BB, кодирующая полипептид 4-1BB, содержащийся в внутриклеточном домене раскрытого в настоящем документе CAR (аминокислоты 214-255 из SEQ ID NO: 943), содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 962, которая представлена ниже.


Полипептид OX40 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или 100% гомологична последовательности, имеющей регистрационный № NCBI: P43489 или NP_003318 (SEQ ID NO: 944), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 944 приведена ниже:






В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты OX40» означает полинуклеотид, кодирующий полипептид OX40.

Полипептид ICOS может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или 100% гомологична последовательности, имеющей регистрационный № NCBI: NP_036224 (SEQ ID NO: 945), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 945 приведена ниже:





В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты ICOS» означает полинуклеотид, кодирующий полипептид ICOS.

CTLA-4 представляет собой ингибирующий рецептор, экспрессируемый активированными T-клетками, который при связывании с соответствующими ему лигандами (CD80 и CD86; B7-1 и B7-2, соответственно) опосредует ингибирование или анергию активированной T-клетки. Как в доклинических, так и в клинических исследованиях, блокирование CTLA-4 путем системной инфузии антител приводило к усилению эндогенного противоопухолевого ответа, хотя в клинических исследованиях сопровождалось значительной непредвиденной токсичностью.

CTLA-4 содержит внеклеточный V-домен, трансмембранный домен и цитоплазматический хвост. Были охарактеризованы альтернативно сплайсированные варианты, кодирующие разные изоформы. Мембраносвязанная изоформа функционирует в виде гомодимера, связанного дисульфидной связью, в то время как растворимая изоформа функционирует в виде мономера. Внутриклеточный домен аналогичен таковому у CD28 в том, что он не имеет собственной каталитической активности и содержит один мотив YVKM, способный связывать PI3K, PP2A и SHP-2, и один богатый остатками пролина мотив, способный связывать SH3-содержащие белки. Одна функция CTLA-4 в ингибировании T-клеточных ответов, судя по всему, осуществляется непосредственно через дефосфорилирование SHP-2 и PP2A TCR-проксимальных сигнальных белков, таких как CD3 и LAT. CTLA-4 также может влиять на сигнализацию опосредованно, за счет конкуренции с CD28 за связывание CD80/86. Также показано, что CTLA-4 связывается и/или взаимодействует с PI3K, CD80, AP2M1 и PPP2R5A.

В соответствии с настоящим изобретением, полипептид CTLA-4 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100% гомологична последовательности UniProtKB/Swiss-Prot с регистрационным №: P16410.3 (SEQ ID NO: 946) (гомологию между ними можно определять с использованием стандартных программ, таких как BLAST или FASTA), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 946 приведена ниже:




В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты CTLA-4» означает полинуклеотид, кодирующий полипептид CTLA-4.

PD-1 является отрицательным иммунорегулятором активированных T-клеток при взаимодействии с соответствующими ему лигандами PD-L1 и PD-L2, экспрессируемыми на эндогенных макрофагах и дендритных клетках. PD-1 представляет собой мембранный белок I типа из 268 аминокислот. PD-1 имеет два лиганда, PD-L1 и PD-L2, которые являются представителями семейства B7. Структура белка содержит внеклеточный домен IgV, за которым следует трансмембранная область и внутриклеточный хвост. Внутриклеточный хвост содержит два сайта фосфорилирования, находящиеся в тирозинсодержащем ингибиторном мотиве иммунорецепторов и тирозинсодержащем переключающем мотиве иммунорецепторов, PD-1 отрицательно регулирует сигналы TCR. SHP-I и SHP-2 фосфатазы связываются с цитоплазматическим хвостом PD-1 после связывания лиганда. Повышающая регуляция PD-L1 является одним из механизмов, позволяющих опухолевым клеткам ускользать от иммунной системы хозяина. В доклинических и клинических исследованиях блокирование PD-1 антагонистическими антителами индуцировало противоопухолевые ответы, опосредованные эндогенной иммунной системой хозяина.

В соответствии с настоящим изобретением, полипептид PD-1 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100% гомологична последовательности с регистрационным № NCBI: NP_005009.2 (SEQ ID NO: 947), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 947 приведена ниже:






В соответствии с настоящим изобретением «молекула нуклеиновой кислоты PD-1» означает полинуклеотид, кодирующий полипептид PD-1.

Белок активации лимфоцитов 3 (LAG-3) является отрицательным иммунорегулятором иммунных клеток. LAG-3 принадлежит к суперсемейству иммуноглобулинов (Ig) и содержит 4 внеклеточных Ig-подобных домена. Ген LAG3 содержит 8 экзонов. Данные относительно последовательности, организации экзонов/интронов и хромосомной локализации указывают на близкое родство LAG3 с CD4. LAG3 также имеет название CD223 (кластер дифференцировки 223).

В соответствии с настоящим изобретением, полипептид LAG-3 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100% гомологична последовательности UniProtKB/Swiss-Prot с регистрационным №: P18627.5 (SEQ ID NO: 948), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 948 приведена ниже:










В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты LAG-3» означает полинуклеотид, кодирующий полипептид LAG-3.

Рецептор 2B4 (2B4) клеток-естественных киллеров на NK-клетках и подмножествах T-клеток опосредует не рестриктированное по MHC уничтожение клеток. В настоящее время функцию 2B4 продолжают изучать, при этом считается, что изоформа 2B4-S является активирующим рецептором, а изоформа 2B4-L является отрицательным иммунорегулятором иммунных клеток. 2B4 блокируется при связывании его высокоаффинного лиганда, CD48. 2B4 содержит тирозинсодержащий переключающий мотив, молекулярный переключатель, позволяющий белку связываться с разными фосфатазами. 2B4 также имеет название CD244 (кластер дифференцировки 244).

В соответствии с настоящим изобретением, полипептид 2B4 может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100% гомологична последовательности UniProtKB/Swiss-Prot с регистрационным №: Q9BZW8.2 (SEQ ID NO: 949), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 949 приведена ниже:








В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты 2B4» означает полинуклеотид, кодирующий полипептид 2B4.

Экспрессия аттенюатора B- и T-лимфоцитов (BTLA) индуцируется в процессе активации T-клеток, и BTLA остается экспрессированным на Th1 клетках, но не на Th2 клетках. Подобно PD1 и CTLA4, BTLA взаимодействует с гомологом B7, B7H4. Однако, в отличие от PD-1 и CTLA-4, BTLA вызывает ингибирование T-клеток при взаимодействии с представителями семейства рецепторов фактора некроза опухолей (TNF-R), а не только представителями семейства B7 рецепторов клеточной поверхности. BTLA является лигандом для представителя 14 суперсемейства (рецепторов) фактора некроза опухолей (TNFRSF14), также известного как медиатор проникновения вируса герпеса (HVEM). Комплексы BTLA-HVEM отрицательно регулируют T-клеточные иммунные ответы. Показано, что активация BTLA приводит к ингибированию функции специфичных в отношении рака человеческих CD8+ T-клеток. BTLA также имеет название CD272 (кластер дифференцировки 272).

В соответствии с настоящим изобретением, полипептид BTLA может иметь аминокислотную последовательность, которая по меньшей мере на примерно 85%, примерно 90%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или примерно 100% гомологична последовательности UniProtKB/Swiss-Prot с регистрационным №: Q7Z6A9.3 (SEQ ID NO: 950), или ее фрагментам, и/или может, необязательно, иметь одну, две или три консервативные аминокислотные замены.

SEQ ID NO: 950 приведена ниже:






В соответствии с настоящим изобретением, «молекула нуклеиновой кислоты BTLA» означает полинуклеотид, кодирующий полипептид BTLA.

В конкретных вариантах осуществления CAR содержит внеклеточную антигенсвязывающую область, которая специфически связывается с FcRL5 человека, трансмембранный домен, содержащий полипептид CD28, и внутриклеточный домен, содержащий полипептид CD3ζ и костимулирующую сигнальную область, которая содержит полипептид CD28, как показано на фигуре 9. Как показано на фигуре 9, CAR также содержит сигнальный пептид или лидер, ковалентно связанный с 5'-концом внеклеточного антигенсвязывающего домена. Сигнальный пептид содержит полипептид CD8.

В конкретных вариантах осуществления CAR по настоящему изобретению может дополнительно содержать индуцируемый промотор для экспрессии нуклеотидных последовательностей в клетках человека. Промоторы, используемые для экспрессии генов CAR, могут быть конститутивными промоторами, такими как промотор гена убиквитина C (UbiC).

Настоящее изобретение также относится к выделенной молекуле нуклеиновой кислоты, кодирующей FcRL5-нацеленный CAR, описанный в настоящем документе, или его функциональную часть. В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты кодирует раскрытый в настоящем документе FcRL5-нацеленный CAR, содержащий scFv, который специфически связывается с FcRL5 человека, трансмембранный домен, содержащий полипептид CD28, и внутриклеточный домен, содержащий полипептид CD3ξ и костимулирующую сигнальную область, содержащую полипептид CD28. В конкретных вариантах осуществления scFv представляет собой полностью человеческий scFv. В конкретных вариантах осуществления scFv представляет собой scFv мыши. В конкретных неограничивающих вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 951, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 951, кодирует FcRL-5-нацеленный CAR, содержащий scFv мыши, который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 915, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 917, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 897, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD28, и внутриклеточный домен, содержащий полипептид CD3ξ и костимулирующую сигнальную область, содержащую полипептид CD28.

В другом конкретном неограничивающем примере выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 952, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 952, кодирует FcRL-5-нацеленный CAR, содержащий scFv мыши, который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 919, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 921, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 897, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD28, и внутриклеточный домен, содержащий полипептид CD3ξ и костимулирующую сигнальную область, содержащую полипептид CD28.

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 953, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 953, кодирует FcRL-5-нацеленный CAR (обозначенный 31 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-998 из SEQ ID NO: 953), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 116, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 115, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 270-998 из SEQ ID NO: 953 кодируют scFv человека. Нуклеотиды 1008-1220 из SEQ ID NO: 953 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1221-1346 из SEQ ID NO: 953 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1347-1685 из SEQ ID NO: 953 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 953 приведены в таблице 232.

Таблица 232

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 953 Число нуклеотидов
Анти-FcRL5 scFv 31 207..998 792
CD8a ТМ 1008..1220 213
4-1BB 1221..1346 126
CD3дзета 1347..1685 339
LTR 1965..2434 470
M13 прям. 3133..3149 17
AmpR промотор 3624..3728 105
AmpR 3729..4589 861
ori 4760..5348 589
Сайт связывания CAP 5636..5657 22
lac промотор 5672..5702 31
lac оператор 5710..5726 17
M13 обр. 5734..5750 17
LTR 6159..6752 594
MMLV Psi 6815..7172 358
gag (укороченный) 7237..7653 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 954, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 954, кодирует FcRL-5-нацеленный CAR (обозначенный 39 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-1013 из SEQ ID NO: 954), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 144, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 143, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 207-1013 из SEQ ID NO: 954 кодируют scFv человека. Нуклеотиды 1023-1235 из SEQ ID NO: 954 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1236-1361 из SEQ ID NO: 954 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1362-1700 из SEQ ID NO: 954 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 954 приведены в таблице 233.

Таблица 233

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 954 Число нуклеотидов
Анти-FcRL5 scFv 39 207..1013 807
CD8a TM 1023..1235 213
4-1BB 1236..1361 126
CD3дзета 1362..1700 339
LTR 1980..2449 470
M13 прям. 3148..3164 17
AmpR промотор 3639..3743 105
AmpR 3744..4604 861
ori 4775..5363 589
Сайт связывания CAP 5651..5672 22
lac промотор 5687..5717 31
lac оператор 5725..5741 17
M13 обр. 5749..5765 17
LTR 6174..6767 594
MMLV Psi 6830..7187 358
gag (укороченный) 7252..7668 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 955, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 955, кодирует FcRL-5-нацеленный CAR (обозначенный 69 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-1037 из SEQ ID NO: 955), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 172, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 171, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 207-1037 из SEQ ID NO: 955 кодируют scFv человека. Нуклеотиды 1047-1259 из SEQ ID NO: 955 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1260-1385 из SEQ ID NO: 955 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1386-1724 из SEQ ID NO: 955 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 955 приведены в таблице 234.

Таблица 234

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 955 Число нуклеотидов
Анти-FcRL5 scFv 69 207..1037 831
CD8a TM 1047..1259 213
4-1BB 1260..1385 126
CD3дзета 1386..1724 339
LTR 2004..2473 470
M13 прям. 3172..3188 17
AmpR промотор 3663..3767 105
AmpR 3768..4628 861
ori 4799..5387 589
Сайт связывания CAP 5675..5696 22
lac промотор 5711..5741 31
lac оператор 5749..5765 17
M13 обр. 5773..5789 17
LTR 6198..6791 594
MMLV Psi 6854..7211 358
gag (укороченный) 7276..7692 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 956, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 956, кодирует FcRL-5-нацеленный CAR (обозначенный 104 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-1010), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 216, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 215, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 207-1010 из SEQ ID NO: 956 кодируют scFv человека. Нуклеотиды 1020-1232 из SEQ ID NO: 956 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1233-1358 из SEQ ID NO: 956 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1359-1697 из SEQ ID NO: 956 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 956 приведены в таблице 235.

Таблица 235

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 956 Число нуклеотидов
Анти-FcRL5 scFv 104 207..1010 804
CD8a TM 1020..1232 213
4-1BB 1233..1358 126
CD3дзета 1359..1697 339
LTR 1977..2446 470
M13 прям. 3145..3161 17
AmpR промотор 3636..3740 105
AmpR 3741..4601 861
ori 4772..5360 589
Сайт связывания CAP 5648..5669 22
lac промотор 5684..5714 31
lac оператор 5722..5738 17
M13 обр. 5746..5762 17
LTR 6171..6764 594
MMLV Psi 6827..7184 358
gag (укороченный) 7249..7665 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 957, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 957, кодирует FcRL-5-нацеленный CAR (обозначенный 105 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-1019), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 220, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 219, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 207-1019 из SEQ ID NO: 957 кодируют scFv человека. Нуклеотиды 1029-1241 из SEQ ID NO: 957 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1242-1367 из SEQ ID NO: 957 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1368-1706 из SEQ ID NO: 957 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 957 приведены в таблице 236.

Таблица 236

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 957 Число нуклеотидов
Анти-FcRL5 scFv 105 207..1019 813
CD8a TM 1029..1241 213
4-1BB 1242..1367 126
CD3дзета 1368..1706 339
LTR 1986..2455 470
M13 прям. 3154..3170 17
AmpR промотор 3645..3749 105
AmpR 3750..4610 861
ori 4781..5369 589
Сайт связывания CAP 5657..5678 22
lac промотор 5693..5723 31
lac оператор 5731..5747 17
M13 обр. 5755..5771 17
LTR 6180..6773 594
MMLV Psi 6836..7193 358
gag (укороченный) 7258..7674 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 958, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 958, кодирует FcRL-5-нацеленный CAR (обозначенный 109 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-1031), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 236, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 235, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 207-1031 из SEQ ID NO: 958 кодируют scFv человека. Нуклеотиды 1041-1253 из SEQ ID NO: 958 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1254-1379 из SEQ ID NO: 958 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1380-1718 из SEQ ID NO: 958 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 958 приведены в таблице 237.

Таблица 237

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 958 Число нуклеотидов
Анти-FcRL5 scFv 109 207..1031 825
CD8a TM 1041..1253 213
4-1BB 1254..1379 126
CD3дзета 1380..1718 339
LTR 1998..2467 470
M13 прям. 3166..3182 17
AmpR промотор 3657..3761 105
AmpR 3762..4622 861
ori 4793..5381 589
Сайт связывания CAP 5669..5690 22
lac промотор 5705..5735 31
lac оператор 5743..5759 17
M13 обр. 5767..5783 17
LTR 6192..6785 594
MMLV Psi 6848..7205 358
gag (укороченный) 7270..7686 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты содержит нуклеотидную последовательность, приведенную в SEQ ID NO: 959, которая представлена ниже:


Выделенная молекула нуклеиновой кислоты, имеющая нуклеотидную последовательность SEQ ID NO: 959, кодирует FcRL-5-нацеленный CAR (обозначенный 117 FcRL5-нацеленный BBz CAR), содержащий полностью человеческий scFv (кодируемый нуклеотидами 207-1025 из SEQ ID NO: 959), который содержит вариабельную область тяжелой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 268, вариабельную область легкой цепи, содержащую аминокислотную последовательность, приведенную в SEQ ID NO: 267, и линкер, имеющий аминокислотную последовательность SEQ ID NO: 307, расположенный между вариабельной областью тяжелой цепи и вариабельной областью легкой цепи, трансмембранный домен, содержащий полипептид CD8, содержащий аминокислоты 137-207 из SEQ ID NO: 960, и внутриклеточный домен, содержащий полипептид CD3ξ, содержащий аминокислоты 52-163 из SEQ ID NO: 941, и костимулирующую сигнальную область, содержащую полипептид 4-1BB, содержащий аминокислоты 214-255 из SEQ ID NO: 943. Нуклеотиды 207-1025 из SEQ ID NO: 959 кодируют scFv человека. Нуклеотиды 1035-1247 из SEQ ID NO: 959 кодируют полипептид CD8, содержащийся в трансмембранном домене. Нуклеотиды 1248-1373 из SEQ ID NO: 959 кодируют полипептид 4-1BB, содержащийся в внутриклеточном домене. Нуклеотиды 1374-1712 из SEQ ID NO: 959 кодируют полипептид CD3дзета, содержащийся в внутриклеточном домене. Другие фрагменты SEQ ID NO: 959 приведены в таблице 238.

Таблица 238

Фрагменты Положения в нуклеотидной последовательности SEQ ID NO: 959 Число нуклеотидов
Анти-FcRL5 scFv 117 207..1025 819
CD8a TM 1035..1247 213
4-1BB 1248..1373 126
CD3дзета 1374..1712 339
LTR 1992..2461 470
M13 прям. 3160..3176 17
AmpR промотор 3651..3755 105
AmpR 3756..4616 861
ori 4787..5375 589
Сайт связывания CAP 5663..5684 22
lac промотор 5699..5729 31
lac оператор 5737..5753 17
M13 обр. 5761..5777 17
LTR 6186..6779 594
MMLV Psi 6842..7199 358
gag (укороченный) 7264..7680 417

В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты кодирует функциональную часть раскрытого в настоящем документе FcRL5-нацеленного CAR. Используемый в настоящем документе термин «функциональная часть» означает любую часть, долю или фрагмент раскрытого в настоящем документе FcRL5-нацеленного CAR, которые сохраняют биологическую активность FcRL5-нацеленного CAR (исходного CAR). Например, функциональные части включают части, доли или фрагменты раскрытого в настоящем документе FcRL5-нацеленного CAR, которые сохраняют способность узнавать клетку-мишень, лечить заболевание, например, множественную миелому, в аналогичной, такой же, или даже более высокой степени, что и исходный CAR. В конкретных вариантах осуществления выделенная молекула нуклеиновой кислоты, кодирующая функциональную часть раскрытого в настоящем документе FcRL5-нацеленного CAR, может кодировать белок, содержащий, например, примерно 10%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% и 95%, или более, исходного CAR, например, нуклеотидных последовательностей, приведенных в SEQ ID NO: 951, SEQ ID NO: 952, SEQ ID NO: 953, SEQ ID NO: 954, SEQ ID NO: 955, SEQ ID NO: 956, SEQ ID NO: 957, SEQ ID NO: 958 или SEQ ID NO: 959.

III. Иммунореактивные клетки

Настоящее изобретение относится к иммунореактивным клеткам, экспрессирующим CAR, который содержит внеклеточный антигенсвязывающий домен, трансмембранный домен и внутриклеточный домен, при этом внеклеточный антигенсвязывающий домен специфически связывается с FcRL5 (например, FcRL5 человека), как описано выше. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен специфически связывается с доменом 7 из FcRL5. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен специфически связывается с доменом 8 из FcRL5. В конкретных вариантах осуществления внеклеточный антигенсвязывающий домен специфически связывается с доменом 9 из FcRL5. Иммунореактивные клетки могут быть трансдуцированы раскрытым в настоящем документе CAR, вследствие чего клетки экспрессируют CAR. Настоящее изобретение также относится к способам применения таких клеток для лечения опухоли, например, множественной миеломы (MM). Иммунореактивные клетки по настоящему изобретению могут представлять собой клетки лимфоидной линии. Клетки лимфоидной линии, включающие B, T-клетки и клетки-естественные киллеры (NK), обеспечивают продуцирование антител, регуляцию клеточной иммунной системы, обнаружение чужеродных агентов в крови, обнаружение клеток, чужеродных для хозяина, и тому подобное. Неограничивающие примеры иммунореактивных клеток лимфоидной линии включают T-клетки, клетки-естественные киллеры (NK), цитотоксические T-лимфоциты (CTL), регуляторные T-клетки, эмбриональные стволовые клетки и плюрипотентные стволовые клетки (например, те, из которых могут дифференцироваться лимфоидные клетки). T-клетки могут представлять собой лимфоциты, которые созревают в тимусе и несут основную ответственность за клеточно-опосредованный иммунитет. T-клетки являются частью адаптивной иммунной системы. T-клетки по настоящему изобретению могут быть T-клетками любого типа, включая, но без ограничения, T-хелперные клетки, цитотоксические T-клетки, T-клетки памяти (включая центральные T-клетки памяти, T-клетки памяти, подобные стволовым клеткам (или подобные стволовым клеткам T-клетки памяти), и два типа эффекторных T-клеток памяти: например, TEM клетки и TEMRA клетки), регуляторные T-клетки (также известные как супрессорные T-клетки), T-клетки - естественные киллеры, связанные со слизистой оболочкой инвариантные T-клетки и γδ-T-клетки. В конкретных вариантах осуществления CAR-экспрессирующие T-клетки экспрессируют Foxp3, что необходимо для достижения и поддержания фенотипа регуляторных T-клеток. Клетки-естественные киллеры (NK) могут представлять собой лимфоциты, являющиеся частью клеточно-опосредованного иммунитета и действующие в рамках врожденного иммунного ответа. NK-клетки не нуждаются в предварительной активации для оказания своего цитотоксического действия на клетки-мишени. Цитотоксические T-клетки (CTL или T-клетки-киллеры) относятся к подгруппе T-лимфоцитов, способных вызывать гибель инфицированных соматических или опухолевых клеток.

Иммунореактивные клетки по настоящему изобретению могут экспрессировать внеклеточный антигенсвязывающий домен (например, scFV, Fab, который, необязательно, является сшитым, или F(ab)2), который специфически связывается с FcRL5 (например, FcRL5 человека), для лечения множественной миеломы. Такие иммунореактивные клетки можно вводить субъекту (например, субъекту-человеку), который нуждается в этом, для лечения множественной миеломы. В конкретных вариантах осуществления иммунореактивная клетка представляет собой T-клетку. T-клетка может представлять собой CD4+ T-клетку или CD8+ T-клетку. В конкретных вариантах осуществления T-клетка представляет собой CD4+ T-клетку. В конкретных вариантах осуществления T-клетка представляет собой CD8+ T-клетку.

Раскрытая в настоящем документе иммунореактивная клетка может быть дополнительно трансдуцирована по меньшей мере одним костимулирующим лигандом, вследствие чего иммунореактивная клетка совместно экспрессирует или индуцируется для совместной экспрессии FcRL5-специфичного CAR и по меньшей мере одного костимулирующего лиганда. Взаимодействие между FcRL5-специфичним CAR и по меньшей мере одним костимулирующим лигандом обеспечивает не специфичный для антигена сигнал, важный для полной активации иммунореактивной клетки (например, T-клетки). Костимулирующие лиганды включают, но не ограничиваются ими, лиганды-представители суперсемейства факторов некроза опухолей (TNF) и суперсемейства иммуноглобулинов (Ig). TNF представляет собой цитокин, который вовлечен в системное воспаление и стимулирует реакции острой фазы. Его основная роль заключается в регуляции иммунных клеток. Представители суперсемейства TNF имеют целый ряд общих свойств. Большинство представителей суперсемейства TNF синтезируются как трансмембранные белки II типа (внеклеточный C-конец), содержащие короткий цитоплазматический сегмент и относительно длинную внеклеточную область. Представители суперсемейства TNF включают, но не ограничиваются ими, фактор роста нервов (NGF), CD40L (CD40L)/CD154, CD137L/4-1BBL, TNF-α, CD134L/OX40L/CD252, CD27L/CD70, Fas-лиганд (FasL), CD30L/CD153, фактор некроза опухолей-бета (TNFβ)/лимфотоксин-альфа (LTα), лимфотоксин-бета (LTβ), CD257/фактор активации B-клеток (BAFF)/Blys/THANK/Tall-1, глюкокортикоид-индуцируемый лиганд рецептора TNF (GITRL) и TNF-родственный апоптоз-индуцирующий лиганд (TRAIL), LIGHT (TNFSF14). Суперсемейство иммуноглобулинов (Ig) представляет собой большую группу белков клеточной поверхности и растворимых белков, которые вовлечены в процессы узнавания, связывания или адгезии клеток. Эти белки имеют общие структурные свойства с иммуноглобулинами - они имеют домен иммуноглобулинов (складку). Лиганды суперсемейства иммуноглобулинов включают, но не ограничиваются ими, CD80 и CD86, оба лиганда для CD28, PD-L1/(B7-H1), который является лигандом для PD-1. В некоторых вариантах осуществления по меньшей мере один костимулирующий лиганд выбирают из группы, состоящей из 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, а также их сочетаний. В конкретных вариантах осуществления иммунореактивная клетка трансдуцирована одним костимулирующим лигандом, который представляет собой 4-1BBL. В конкретных вариантах осуществления иммунореактивная клетка трансдуцирована двумя костимулирующими лигандами, которые представляют собой 4-1BBL и CD80. CAR, трансдуцированные по меньшей мере одним костимулирующим лигандом, описаны в патенте США № 8389282, полное содержание которого включено в настоящий документ посредством ссылки.

Кроме того, раскрытая в настоящем документе иммунореактивная клетка может быть дополнительно трансдуцирована по меньшей мере одним цитокином, вследствие чего иммунореактивная клетка секретирует по меньшей мере один цитокин, а также экспрессирует FcRL5-специфичний CAR. В конкретных вариантах осуществления по меньшей мере one цитокин выбирают из группы, состоящей из IL-2, IL-3, IL-6, IL-7, IL-11, IL-12, IL-15, IL-17 и IL-21. В конкретных вариантах осуществления цитокин представляет собой IL-12.

FcRL5-специфичные или FcRL5-нацеленные человеческие лимфоциты могут быть использованы в качестве периферических донорских лимфоцитов, например, таких, которые раскрыты в Sadelain, M., et al. 2003 Nat Rev Cancer 3: 35-45 (где описаны периферические донорские лимфоциты, генетически модифицированные для экспрессии CAR), в Morgan, R.A., et al. 2006 Science 314: 126-129 (где описаны периферические донорские лимфоциты, генетически модифицированные для экспрессии полноразмерного узнающего опухолевый антиген T-клеточного рецепторного комплекса, содержащего α и β гетеродимер), в Panelli, M.C., et al. 2000 J Immunol 164: 495-504; Panelli, M.C., et al. 2000 J Immunol 164: 4382-4392 (где описаны культуры лимфоцитов, полученные из инфильтрирующих опухоль лимфоцитов (TILs) в биопсиях опухолей), и в Dupont, J., et al. 2005 Cancer Res 65: 5417-5427; Papanicolaou, G.A., et al. 2003 Blood 102: 2498-2505 (где описаны селективно размноженные in vitro антигенспецифические лейкоциты периферической крови и использование искусственных антигенпредставляющих клеток (AAPC) или активированных дендритных клеток). Иммунореактивные клетки (например, T-клетки) могут быть аутологичными, не аутологичными (например, аллогенными) или полученными in vitro из генетически модифицированных предшественников или стволовых клеток.

В конкретных вариантах осуществления раскрытая в настоящем документе иммунореактивная клетка (например, T-клетка) экспрессирует от примерно 1 до примерно 4, от примерно 2 до примерно 4, от примерно 3 до примерно 4, от примерно 1 до примерно 2, от примерно 1 до примерно 3 или от примерно 2 до примерно 3 копий/клетку вектора для раскрытого в настоящем документе FcRL5-специфичного CAR.

Неочищенным источником CTL может быть любой известный в данной области источник, такой как костный мозг, источник эмбриональных, неонатальных или взрослых, либо других гемопоэтических клеток, например, эмбриональная печень, периферическая кровь или пуповинная кровь. Для разделения клеток можно использовать различные методы. Например, методы отрицательной селекции позволяют исходно удалять клетки, не являющиеся CTL. Моноклональные антитела особенно полезны для идентификации маркеров, ассоциированных с конкретными клеточными линиями дифференцировки и/или стадиями дифференцировки, как для положительной, так и для отрицательной селекции.

Большая часть терминально дифференцированных клеток может быть изначально удалена относительно грубым методом разделения. Например, сначала можно использовать разделение с помощью магнитных гранул для удаления большого числа ненужных клеток. Предпочтительно, по меньшей мере примерно 80%, как правило, по меньшей мере 70% всех гемопоэтических клеток будут удалены до выделения клеток.

Методы разделения включают, но не ограничиваются ими, центрифугирование в градиенте плотности; розеткообразование; связывание с частицами, изменяющими плотность клеток; магнитное разделение с помощью покрытых антителом магнитных гранул; аффинную хроматографию; цитотоксические средства, связанные с, или используемые в сочетании с мАт, включая, но без ограничения, комплемент и цитотоксины; а также пэннинг с помощью антител, закрепленных на твердой матрице, например, планшете, чипе; элютриацию или любой другой подходящий метод.

Методы разделения и анализа включают, но не ограничиваются ими, проточную цитометрию различной степени сложности, например, с использованием нескольких цветовых каналов, каналов для детекции низкоуглового и широкоуглового светорассеяния, импеденсных каналов.

Можно отбирать клетки среди мертвых клеток, используя красители, связывающиеся с мертвыми клетками, такие как пропидия иодид (PI). Предпочтительно, клетки собирают в среду, содержащую 2% эмбриональной телячьей сыворотки (ЭТС) или 0,2% бычьего сывороточного альбумина (БСА), или любую другую подходящую, предпочтительно стерильную, изотоническую среду.

IV. Векторы

Генетическую модификацию иммунореактивных клеток (например, T-клеток, CTL-клеток, NK-клеток) можно осуществлять, трансдуцируя по существу гомогенную композицию клеток рекомбинантным ДНК- или РНК-конструктом. Вектор может представлять собой ретровирусный вектор (например, гамма-ретровирусный), который используют для введения ДНК- или РНК-конструкта в геном клетки-хозяина. Например, полинуклеотид, кодирующий FcRL5-специфичный CAR, может быть клонирован в ретровирусный вектор, и экспрессия может управляться с его эндогенного промотора, с ретровирусного длинного концевого повтора или с альтернативного внутреннего промотора.

Также можно использовать невирусные векторы или РНК. Можно использовать случайную хромосомную интеграцию или направленную интеграцию (например, с использованием нуклеазы, подобных активатору транскрипции эффекторных нуклеаз (TALEN), нуклеаз «цинковых пальцев» (ZFN) и/или коротких палиндромных повторов, регулярно расположенных группами (CRISPR)), или трансгенную экспрессию (например, с использованием природной или химически модифицированной РНК).

Для начальной генетической модификации клеток с целью получения клеток, экспрессирующих FcRL5-специфичный CAR, как правило, для трансдукции используют ретровирусный вектор, однако можно использовать любую другую подходящую вирусную или невирусную систему доставки. Для последующей генетической модификации клеток с целью получения клеток, содержащих антигенпредставляющий комплекс, содержащий по меньшей мере два костимулирующих лиганда, ретровирусный перенос генов (трансдукция) также является эффективным. Также подходящими являются сочетания ретровирусного вектора и соответствующей упаковывающей линии клеток, при этом капсидные белки будут играть функциональную роль при инфицировании клеток человека. Известны различные амфотропные продуцирующие вирусы линии клеток, включая, но без ограничения, PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5: 431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6: 2895-2902) и CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85: 6460-6464). Не амфотропные частицы также являются подходящими, например, частицы, псевдотипированные с оболочкой VSVG, RD114 или GALV, а также любые другие известные в данной области.

Возможные методы трансдукции также включают прямое совместное культивирование клеток с клетками-продуцентами, например, методом, описанным в Bregni, et al. (1992) Blood 80: 1418-1422, либо культивирование только с вирусным супернатантом или с концентрированными маточными растворами вектора с добавлением или без добавления соответствующих факторов роста и поликатионов, например, методом, описанным в Xu, et al. (1994) Exp. Hemat. 22: 223-230; и Hughes, et al. (1992) J. Clin. Invest. 89: 1817.

Трансдуцирующие вирусные векторы можно использовать для экспрессии костимулирующего лиганда (например, 4-1BBL и IL-12) в иммунореактивной клетке. Предпочтительно, выбранный вектор характеризуется высокой эффективностью инфицирования, а также стабильной интеграцией и экспрессией (смотри, например, Cayouette et al., Human Gene Therapy 8: 423-430, 1997; Kido et al., Current Eye Research 15: 833-844, 1996; Bloomer et al., Journal of Virology 71: 6641-6649, 1997; Naldini et al., Science 272: 263 267, 1996; и Miyoshi et al., Proc. Natl. Acad. Sci. U.S.A. 94: 10319, 1997). Другие вирусные векторы, которые можно использовать, включают, например, аденовирусные, лентивирусные и аденоассоциированные вирусные векторы, вирус осповакцины, вирус бычьей папилломы или вирус герпеса, например, вирус Эпштейна-Барр (также смотри, например, векторы, описанные в Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244: 1275-1281, 1989; Eglitis et al., BioTechniques 6: 608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1: 55-61, 1990; Sharp, The Lancet 337: 1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36: 311-322, 1987; Anderson, Science 226: 401-409, 1984; Moen, Blood Cells 17: 407-416, 1991; Miller et al., Biotechnology 7: 980-990, 1989; Le Gal La Salle et al., Science 259: 988-990, 1993; и Johnson, Chest 107: 77S-83S, 1995). Ретровирусные векторы особенно хорошо разработаны и их используют в клинической практике (Rosenberg et al., N. Engl. J. Med 323: 370, 1990; Anderson et al., патент США № 5399346).

В конкретных неограничивающих вариантах осуществления вектор, экспрессирующий раскрытый в настоящем документе FcRL5-нацеленный CAR, представляет собой ретровирусный вектор, например, ретровирусный вектор 293 galv9.

Для экспрессии белка в клетке также можно использовать подходы не на основе вирусов. Например, молекулу нуклеиновой кислоты можно вводить в клетку с помощью липофекции (Feigner et al., Proc. Natl. Acad. Sci. U.S.A. 84: 7413, 1987; Ono et al., Neuroscience Letters 17: 259, 1990; Brigham et al., Am. J. Med. Sci. 298: 278, 1989; Staubinger et al., Methods in Enzymology 101: 512, 1983), асиалооросомукоида-полилизина (Wu et al., Journal of Biological Chemistry 263: 14621, 1988; Wu et al., Journal of Biological Chemistry 264: 16985, 1989) или путем микроинъекции в хирургических условиях (Wolff et al., Science 247: 1465, 1990). Другие не вирусные методы переноса генов включают трансфекцию in vitro с использованием фосфата кальция, ДЭАЭ-декстрана, электропорацию и слияние протопластов. Липосомы также могут быть потенциально полезными для доставки ДНК в клетку. Трансплантацию нормальных генов в пораженные ткани субъекта также можно осуществлять путем переноса нормальной нуклеиновой кислоты в культивируемые клетки ex vivo (например, аутологичные или гетерологичные первичные клетки или их потомство), после чего клетки (или их потомство) инъецируют в целевую ткань или инъецируют системно. Рекомбинантные рецепторы также можно создавать или получать с использованием транспозаз или направленных нуклеаз (например, нуклеаз «цинковые пальцы», мегануклеаз или TALE нуклеаз). Временную экспрессию можно получать за счет введения РНК методом электропорации.

Экспрессия кДНК для использования в методах полинуклеотидной терапии может управляться с любого подходящего промотора (например, промоторов цитомегаловируса (CMV) человека, обезьяньего вируса 40 (SV40) или металлотионеина) и регулироваться любым подходящим регуляторным элементом или интроном млекопитающих (например, структурой энхансер/промотор/интрон фактора элонгации 1α). Например, при необходимости, для управления экспрессией нуклеиновой кислоты можно использовать энхансеры, которые, как известно, предпочтительно управляют экспрессией гена в клетках определенного типа. Используемые энхансеры могут включать, без ограничения, те, которые охарактеризованы как энхансеры, специфичные для ткани или типа клеток. Альтернативно, если геномный клон используют в качестве терапевтического конструкта, регуляция может быть опосредована когнатными регуляторными последовательностями или, в случае необходимости, регуляторными последовательностями, полученными из гетерологичного источника, в том числе, любым из промоторов или регуляторных элементов, описанных выше.

Полученные клетки можно выращивать в условиях, сходных с условиями для не модифицированных клеток, при этом модифицированные клетки можно размножать и использовать для разных целей.

V. Полипептиды, аналоги и полинуклеотиды

Настоящее изобретение также относится к внеклеточным антигенсвязывающим доменам, которые специфически связываются с FcRL5 (например, FcRL5 человека) (например, scFv, таким как scFv, полученный из антител F56 и F119, Fab или (Fab)2), полипептидам CD3ζ, CD8, CD28 и так далее, или их фрагментам, а также полинуклеотидам, кодирующим их, которые модифицированы способами, приводящими к усилению их противоопухолевой активности при экспрессии в иммунореактивной клетке. В конкретных вариантах осуществления настоящее изобретение также относится к внеклеточным антигенсвязывающим доменам, которые специфически связываются с доменом 9 из FcRL5 (например, доменом 7, доменом 8 или доменом 9 из FcRL5 человека) (например, scFv, Fab, или (Fab)2), полипептидам CD3ζ, CD8, CD28 и так далее, или их фрагментам, а также полинуклеотидам, кодирующим их, которые модифицированы способами, приводящими к усилению их противоопухолевой активности при экспрессии в иммунореактивной клетке.

Настоящее изобретение относится к способам оптимизации аминокислотной последовательности или нуклеотидной последовательности за счет внесения изменений в последовательность. Такие изменения могут включать определенные мутации, делеции, вставки или посттрансляционные модификации. Настоящее изобретение также относится к аналогам любого природного полипептида по настоящему изобретению. Аналоги могут отличаться от природного полипептида по настоящему изобретению за счет различий в аминокислотной последовательности, за счет посттрансляционных модификаций или и того, и другого. Аналоги по настоящему изобретению, как правило, могут иметь по меньшей мере примерно 85%, примерно 90%, примерно 91%, примерно 92%, примерно 93%, примерно 94%, примерно 95%, примерно 96%, примерно 97%, примерно 98%, примерно 99% или более идентичности со всей или с частью природной аминокислотной последовательности по настоящему изобретению. Длина сравниваемых последовательностей составляет по меньшей мере 5, 10, 15, 20, 25, 50, 75, 100 или более аминокислотных остатков. Опять-таки, в иллюстративном подходе для определения степени идентичности можно использовать программу BLAST, с показателем вероятности от e-3 до e-100, указывающим на близкородственную последовательность. Модификации включают in vivo и in vitro химическую дериватизацию полипептидов, например, ацетилирование, карбоксилирование, фосфорилирование или гликозилирование; такие модификации могут происходить во время синтеза или процессинга полипептида, или после обработки выделенными модифицирующими ферментами. Аналоги также могут отличаться от природных полипептидов по настоящему изобретению за счет изменений в первичной последовательности. Сюда относятся генетические варианты, как природные, так и индуцированные (например, возникающие в результате случайного мутагенеза при облучении или воздействии этанметилсульфата, или в результате сайт-направленного мутагенеза, описанного в Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual (2-е издание), CSH Press, 1989, или Ausubel et al., выше). Также включены циклизованные пептиды, молекулы и аналоги, которые содержат остатки, отличные от L-аминокислот, например, D-аминокислоты, либо неприродные или синтетические аминокислоты, например, бета (β) или гамма (γ) аминокислоты.

Помимо полноразмерных полипептидов, настоящее изобретение также относится к фрагментам любого из полипептидов или пептидных доменов по настоящему изобретению. Фрагмент может содержать по меньшей мере 5, 10, 13 или 15 аминокислот. В конкретных вариантах осуществления фрагмент содержит по меньшей мере 20 смежных аминокислот, по меньшей мере 30 смежных аминокислот или по меньшей мере 50 смежных аминокислот. В конкретных вариантах осуществления фрагмент содержит по меньшей мере 60-80, 100, 200, 300 или более смежных аминокислот. Фрагменты по настоящему изобретению могут быть получены методами, известными специалистам в данной области, или могут образовываться в результате обычного процессинга белка (например, удаления аминокислот из образующегося полипептида, которые не нужны для биологической активности, или удаления аминокислот в результате альтернативного сплайсинга мРНК или в результате альтернативного процессинга белка).

Небелковые аналоги имеют химическую структуру, разработанную для имитации функциональной активности белка по изобретению. Такие аналоги вводят способами по настоящему изобретению. Такие аналоги могут превосходить по физиологической активности исходный полипептид. Способы конструирования аналогов хорошо известны в данной области, и синтез аналогов можно выполнять такими способами, модифицируя химические структуры таким образом, что полученные аналоги превосходят по анти-неопластической активности исходный полипептид при экспрессии в иммунореактивной клетке. Такие химические модификации включают, но не ограничиваются ими, замещение альтернативных R-групп и варьирование степени насыщенности определенных атомов углерода эталонного полипептида. Белковые аналоги могут быть относительно устойчивы к деградации in vivo, результатом чего является более длительный терапевтический эффект после введения. Анализы для измерения функциональной активности включают, но не ограничиваются ими, те, которые описаны в разделе «Примеры», ниже.

В соответствии с настоящим изобретением, полинуклеотиды, кодирующие внеклеточный антигенсвязывающий домен, который специфически связывается с FcRL5 (например, scFV (например, scFv, полученный из антител F56 и F119), Fab, Fab' или (Fab')2), CD3ζ, CD8, CD28, могут быть модифицированы за счет оптимизации кодонов. Оптимизация кодонов может изменять как природные, так и рекомбинантные последовательности генов, для достижения максимально возможных уровней продуктивности в любой конкретной системе экспрессии. Факторы, играющие роль на разных стадиях экспрессии белка, включают адаптируемость кодонов, структуру мРНК и различные cis-элементы в транскрипции и трансляции. Можно использовать любые подходящие методы или технологии оптимизации кодонов, известные специалистам в данной области, для модификации полинуклеотидов по настоящему изобретению, включая, но без ограничения, OPTIMUMGENE™, Encor оптимизацию и Blue Heron.

VI. Введение

FcRL5-специфичные CAR и экспрессирующие их иммунореактивные клетки по настоящему изобретению можно предоставлять системно или непосредственно субъекту для лечения или предотвращения неоплазии. В конкретных вариантах осуществления FcRL5-специфичные CAR и экспрессирующие их иммунореактивные клетки напрямую инъецируют в интересующий орган (например, орган, затронутый неоплазией). Альтернативно или дополнительно, FcRL5-специфичные CAR и экспрессирующие их иммунореактивные клетки вводят опосредованно в интересующий орган, например, путем введения в систему циркуляции (например, сосудистую сеть опухоли). Средства для экспансии и дифференциации с целью увеличения продуцирования T-клеток in vitro или in vivo могут быть предоставлены до, в процессе или после введения клеток и композиций.

FcRL5-специфичные CAR и экспрессирующие их иммунореактивные клетки по настоящему изобретению можно вводить в любом физиологически приемлемом носителе, обычно внутрисосудистым введением, хотя их также можно вводить в кость или другой удобный участок тела, где клетки могут найти подходящее место для регенерации и дифференциации (например, тимус). Как правило, можно вводить по меньшей мере 1×105 клеток, в конечном итоге доводя количество до 1 x l010 или более. Клеточная популяция, содержащая иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR, может представлять собой очищенную популяцию клеток. Специалисты в данной области могут с легкостью определять процентную долю иммунореактивных клеток в клеточной популяции с использованием различных хорошо известных методов, таких как активированная флуоресценцией сортировка клеток (FACS). Степень чистоты клеточных популяций, содержащих генетически модифицированные иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR, может составлять от примерно 50% до примерно 55%, от примерно 55% до примерно 60%, от примерно 65% до примерно 70%, от примерно 70% до примерно 75%, от примерно 75% до примерно 80%, от примерно 80% до примерно 85%, от примерно 85% до примерно 90%, от примерно 90% до примерно 95% или от примерно 95 до примерно 100%. Дозы могут с легкостью корректировать специалисты в данной области (например, при меньшей степени чистоты может потребоваться более высокая доза). Иммунореактивные клетки можно вводить путем инъекции, с помощью катетера или тому подобным образом. При необходимости, можно дополнительно включать факторы, в том числе, но без ограничения, интерлейкины, например, IL-2, IL-3, IL-6, IL-11, IL-7, IL-12, IL-15, IL-21, а также другие интерлейкины, колониестимулирующий факторы, такие как G-, M- и GM-CSF, интерфероны, например, γ-интерферон.

Композиции по настоящему изобретению включают фармацевтические композиции, содержащие иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR, и фармацевтически приемлемый носитель. Введение может быть аутологичным или не аутологичным. Например, иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR, и содержащие их композиции можно получать от одного субъекта, и вводить тому же субъекту или другому совместимому субъекту. Полученные из периферической крови T-клетки по настоящему изобретению или их потомство (например, полученное in vivo, ex vivo или in vitro) можно вводить локальной инъекцией, включая введение с помощью катетера, системной инъекцией, локализованной инъекцией, внутривенной инъекцией или парентеральным путем введения. Вводимая фармацевтическая композиция по настоящему изобретению (например, фармацевтическая композиция, содержащая иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR) может быть сформулирована в виде инъекционной стандартной дозы (раствора, суспензии, эмульсии).

VII. Препараты

Иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR, и содержащие их композиции по настоящему изобретению можно предоставлять в виде стерильных жидких препаратов, например, изотонических водных растворов, суспензий, эмульсий, дисперсий или вязких композиций, которые могут быть забуферены для достижения выбранного значения pH. Жидкие препараты, как правило, изготавливать легче, чем гели, другие вязкие композиции и твердые композиции. Кроме того, жидкие композиции удобнее вводить, особенно путем инъекции. Вязкие композиции, с другой стороны, могут быть сформулированы в пределах соответствующего диапазона вязкости для обеспечения более длительного контакта с определенными тканями. Жидкие или вязкие композиции могут содержать носители, которые могут представлять собой растворитель или дисперсионную среду, содержащие, например, воду, солевой раствор, фосфатно-солевой буфер, полиол (например, глицерин, пропиленгликоль, жидкий полиэтиленгликоль и тому подобное), а также их подходящие смеси.

Стерильные инъекционные растворы могут быть получены путем включения композиций, содержащих иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR, по настоящему изобретению в необходимое количество соответствующего растворителя с разными количествами других ингредиентов, по мере необходимости. Такие композиции могут находиться в смеси с соответствующим носителем, разбавителем или эксципиентом, таким как стерильная вода, физиологический солевой раствор, глюкоза, декстроза или тому подобное. Композиции также могут быть лиофилизированными. Композиции могут содержать вспомогательные вещества, такие как увлажняющие, диспергирующие средства или эмульгаторы (например, метилцеллюлоза), буферные реагенты для поддержания pH, гелеобразующие или повышающие вязкость добавки, консерванты, ароматизаторы, красители и тому подобное, в зависимости от пути введения и желательного препарата. Для получения соответствующих препаратов без излишнего экспериментирования можно руководствоваться стандартными литературными источниками, такими как «REMINGTON'S PHARMACEUTICAL SCIENCE», 17-е издание, 1985, содержание которого включено в настоящий документ посредством ссылки.

Можно вносить различные добавки, которые повышают стабильность и стерильность композиций, включая противомикробные консерванты, антиоксиданты, хелатирующие агенты и буферы. Предотвращать действие микроорганизмов можно с помощью различных антибактериальных и противогрибковых средств, например, парабенов, хлорбутанола, фенола, сорбиновой кислоты и тому подобного. Продолжительной абсорбции инъекционной фармацевтической формы можно добиваться за счет использования замедляющих абсорбцию средств, например, моностеарата алюминия и желатина. Однако в соответствии с настоящим изобретением, любые используемые растворители, разбавители или добавки должны быть совместимыми с иммунореактивными клетками, экспрессирующими FcRL5-специфичный CAR по настоящему изобретению.

Композиции могут быть изотоническими, то есть, они могут иметь такое же осмотическое давление, как у крови и слезной жидкости. Желательной изотоничности композиций по настоящему изобретению можно добиваться с помощью хлорида натрия или других фармацевтически приемлемых средств, таких как декстроза, борная кислота, натрия тартрат, пропиленгликоль или другие неорганические или органические растворенные вещества. Хлорид натрия является особенно предпочтительным для буферов, содержащих ионы натрия.

Вязкость композиций, при необходимости, можно поддерживать на желательном уровне с помощью фармацевтически приемлемого загустителя. Можно использовать метилцеллюлозу, поскольку она является легко доступной, недорогой и простой в обращении. Другие подходящие загустители включают, например, ксантановую камедь, карбоксиметилцеллюлозу, гидроксипропилцеллюлозу, карбомер и тому подобное. Концентрация загустителя может зависеть от выбранного средства. Важным моментом является использование такого количества, которое позволит достичь желательной вязкости. Очевидно, что выбор соответствующих носителей и других добавок будет зависеть от конкретного пути введения и характера конкретной лекарственной формы, например, жидкой лекарственной формы (например, если композиция будет сформулирована в виде раствора, суспензии, геля или другой жидкой формы, такой как форма с замедленным высвобождением или заполненная жидкостью форма).

Специалисты в данной области понимают, что выбранные компоненты композиций должны быть химически инертными и не влиять на жизнеспособность или эффективность иммунореактивных клеток, описанных в настоящем документе. Это не будет являться проблемой для специалистов в области химии и фармацевтики, или проблем можно будет с легкостью избежать, обращаясь к стандартным руководствам или проводя простые эксперименты (без излишнего экспериментирования) на основании настоящего документа и приведенных в нем литературных источников.

Одним из соображений при терапевтическом применении иммунореактивных клеток по настоящему изобретению является количество клеток, необходимое для достижения оптимального эффекта. Количество вводимых клеток будет варьироваться для субъектов, получающих лечение. В конкретных вариантах осуществления субъекту вводят от примерно 104 до примерно 1010, от примерно 105 до примерно 109 или от примерно 106 до примерно 108 иммунореактивных клеток по настоящему изобретению. Более эффективные клетки можно вводить даже в меньших количествах. В некоторых вариантах осуществления субъекту-человеку вводят по меньшей мере примерно 1×108, примерно 2×108, примерно 3×108, примерно 4×108 и примерно 5×108 иммунореактивных клеток по настоящему изобретению. Точное определение того, что можно считать эффективной дозой, может быть основано на факторах, индивидуальных для каждого субъекта, включая размеры тела, возраст, пол, массу тела и состояние здоровья конкретного субъекта. Дозировки могут быть с легкостью определены специалистами в данной области на основании настоящего документа и общих знаний в данной области.

Квалифицированный специалист может с легкостью определять количество клеток, а также необязательные добавки, растворители, и/или носители в композициях, которые будут введены в соответствии со способами по настоящему изобретению. Как правило, любые добавки (в дополнение к активной клетке(ам) и/или средству(ам)) присутствуют в количестве от примерно 0,001% до примерно 50% по массе от массы раствора в фосфатно-солевом буфере, и активный ингредиент присутствует в количестве, порядок величины которого составляет от микрограмм до миллиграмм, например, от примерно 0,0001 масс% до примерно 5 масс%, от примерно 0,0001 масс% до примерно 1 масс%, от примерно 0,0001 масс% до примерно 0,05 масс%, от примерно 0,001 масс% до примерно 20 масс%, от примерно 0,01 масс% до примерно 10 масс%, или от примерно 0,05 масс% до примерно 5 масс%. Для любой композиции, которую предстоит вводить животному или человеку, и для любого конкретного способа введения следует определять параметры токсичности, например, путем определения летальной дозы (LD) и LD50 в соответствующей животной модели, например, на грызунах, таких как мышь; а также дозу композиции(ий), концентрацию компонентов в ней и сроки введения композиции(ий), которые приводят к подходящей ответной реакции. Такие определения не требуют излишнего экспериментирования и могут быть проведены на базе знаний квалифицированного специалиста, настоящего документа и документов, цитированных в нем. Время для последовательных введений также может быть установлено без излишнего экспериментирования.

VIII. Способы лечения

Микроокружение опухоли. Опухоли имеют микроокружение, враждебное для иммунной системы хозяина, с вовлечением целого ряда механизмов, с помощью которых злокачественные клетки защищаются от узнавания и уничтожения иммунными клетками. Это «враждебное микроокружение опухоли» включает различные иммуносупрессорные факторы, включая инфильтрирующие регуляторные CD4+ T-клетки (Treg), миелоидные супрессорные клетки (MDSC), опухоль-ассоциированные макрофаги (TAM), иммуносупрессорные цитокины, включая IL-10 и TGF-β, а также экспрессию лигандов для иммуносупрессорных рецепторов, экспрессируемых активированными T-клетками (CTLA-4 и PD-1). Эти механизмы иммуносупрессии участвуют в поддержании толерантности и подавлении неадекватных иммунных ответов, однако в микроокружении опухоли эти механизмы предотвращают эффективный противоопухолевый иммунный ответ. В совокупности эти иммуносупрессорные факторы могут вызывать либо заметную анергию, либо апоптоз адоптивно перенесенных модифицированных CAR T-клеток при встрече с целевыми опухолевыми клетками.

Проблемы иммунологии опухолей. Для эффективного противоопухолевого иммунитета необходимо узнавание опухолевых антигенов и беспрепятственное уничтожение опухоли эффекторными иммунными клетками. Опухолевые антигены должны содержать пептидные эпитопы, которые представляются опухолью и могут быть узнаны специфическими цитотоксическими T-лимфоцитами (CTL). Примированные CTL должны размножиться до достаточных количеств и мигрировать в участки опухоли, где они созревают до стадии эффекторов, чтобы выполнять свои функции, которые усиливаются за счет хелперных T-клеток и ослабляются за счет Treg и ингибирующих макрофагов.

Направленная T-клеточная терапия с помощью генетически модифицированных T-лимфоцитов. Генетическое модифицирование T-клеток является новаторской стратегией для потенциального устранения многих ранее выявленных недостатков ранних иммунотерапевтических подходов. В прошлом году исследователи сообщали о впечатляющей полной ремиссии при рецидивирующем (Brentjens et al., Blood 118, 4817-4828 (2011) и Brentjens et al., Science translational medicine 5, 177ra138 (2013)), не поддающемся химиотерапии лейкозе и метастатической меланоме (Hunder et al., N. Engl.J.Med. 358, 2698-2703 (2008); Rosenberg et al., Nat. Rev. Cancer 8, 299-308 (2008); и Dudley et al., J Clin Oncol 26, 5233-5239 (2008)), достигнутой при использовании аутологичных T-клеток периферической крови, нацеленных на определенный антиген (CD19 и NY-ESO-1, соответственно).

Обоснование генетического подхода: Клеточную инженерию можно использовать для перенаправления T-клеток на опухолевые антигены и для усиления функции T-клеток. Одним из стимулов для генетической модификации T-клеток является потенциальная возможность повышения выживаемости и экспансии T-клеток и избегания гибели, анергии T-клеток и иммуносупрессии. Генетическое нацеливание T-клеток также может быть усовершенствовано для предотвращения нежелательного разрушения нормальных тканей.

Химерные антигенные рецепторы (CAR): Специфические для опухоли T-клетки могут быть получены путем переноса генов, кодирующих CAR (Brentjens et al., Clin.Cancer Res. 13, 5426-5435 (2007); Gade et al., Cancer Res. 65, 9080-9088 (2005); Maher et al., Nat.Biotechnol. 20, 70-75 (2002); Kershaw et al., J Immunol 173, 2143-2150 (2004); Sadelain et al., Curr Opin Immunol (2009); и Hollyman et al., J Immunother 32, 169-180 (2009)). CAR второго поколения содержат связывающий опухолевый антиген домен, слитый с внутриклеточным сигнальным доменом, способным активировать T-клетки, и костимулирующим доменом, разработанным для повышения эффективности и персистенции T-клеток (Sadelain et al., Cancer discovery 3, 388-398 (2013)). Таким образом, конструкция CAR позволяет синхронизировать узнавание антигена и передачу сигнала, две функции, которые физиологически осуществляются двумя отдельными комплексами, гетеродимером TCR и комплексом CD3. Внеклеточный антигенсвязывающий домен в CAR, как правило, получают из мышиного моноклонального антитела (мАт), либо из рецепторов или их лигандов. Таким образом, узнавание антигена не рестриктировано MHC (Riviere et al., Curr Hematol Rep 3, 290-297 (2004); и Stephan et al., Nat. Med. 13, 1440-1449 (2007)) и, следовательно, возможно для любого пациента, в организме которого экспрессируется целевой антиген, с использованием одного и того же CAR. Связывание антигена с CAR запускает фосфорилирование активационных тирозинсодержащих мотивов иммунорецепторов (ITAM) во внутриклеточном домене, инициируя сигнальный каскад, необходимый для индукции цитолиза, секреции цитокинов и пролиферации. Поскольку рестриктирование по MHC при узнавании антигена отсутствует, на функцию CAR-направляемых T-клеток не влияет понижающая регуляция HLA или дефекты аппарата процессинга антигена.

Потребности T-клеток для экспансии и выживания: Пролиферация опухоль-специфических T-клеток необходима ex vivo и, возможно, желательна in vivo. Пролиферация T-клеток должна сопровождаться выживанием T-клеток для достижения абсолютной T-клеточной экспансии и персистенции. Для пролиферации в ответ на антиген T-клетки должны получать два сигнала. Один возникает при узнавании TCR комплексов антигенный пептид/MHC, экспонируемых на поверхности антигенпредставляющих клеток (APC) (Sadelain et al., Curr Opin Immunol (2009)). Другой сигнал обеспечивает T-клеточный костимулирующий рецептор, такой как рецепторы CD28 или 4-1BB. Хотя для цитолитической активности T-клеток нет необходимости в сопутствующей костимуляции, существует очень важная потребность в обеспечении костимулирующих сигналов для поддержания противоопухолевых функций адоптивно перенесенных T-клеток, как показано ранее (Maher et al., Nat.Biotechnol. 20, 70-75 (2002); Sadelain et al., Cancer discovery 3, 388-398 (2013); Krause et al., J Exp Med 188, 619-626 (1998); Gong et al., Neoplasia. 1, 123-127 (1999); и Lyddane et al., J.Immunol. 176, 3306-3310 (2006)).

Иммунологический мониторинг: Лимфоциты являются многофункциональными «лекарственными средствами», которые проявляют динамично развивающиеся эффекты после инфузии. При встрече с антигеном опухоль-специфические T-клетки активируются и/или высвобождают белки, которые могут запускать уничтожение опухоли, T-клеточную пролиферацию, а также рекрутинг или иммуномодуляцию других иммунных клеток. Таким образом, определение того, какие белки секретируются из каких клеток, в каком количестве и в какой момент времени, дает глубокое понимание того, почему конкретный пациент отвечает или не отвечает на лечение, и обеспечивает очень важную обратную связь для разработки более эффективных испытаний. Такие системы анализа позволяют проводить непосредственные и значимые сравнения клинических подходов и, таким образом, помогают в разработке рациональных терапевтических стратегий следующего поколения.

Вводимое для лечения количество представляет собой количество, эффективное для достижения желательного результата. Эффективное количество может быть предоставлено одним введением или рядом введений. Эффективное количество может быть предоставлено болюсной инъекцией или непрерывной перфузией.

«Эффективное количество» (или «терапевтически эффективное количество») представляет собой количество, достаточное для достижения полезного или желательного клинического результата при лечении. Эффективное количество можно вводить субъекту в одной или более дозах. В случае лечения, эффективное количество представляет собой количество, достаточное для облегчения, ослабления, стабилизации, обращения вспять или замедления прогрессирования заболевания, либо иным образом уменьшения патологических последствий заболевания. Эффективное количество, как правило, определяет врач на индивидуальной основе, и его определение находится в пределах компетенции специалиста в данной области. Как правило, несколько факторов учитывают при определении соответствующей дозы для достижения эффективного количества. Такие факторы включают возраст, пол и массу тела субъекта, состояние, подвергаемое лечению, степень тяжести состояния, а также форму и эффективную концентрацию вводимых иммунореактивных клеток.

Для адоптивной иммунотерапии с использованием антигенспецифических T-клеток клетки в диапазоне доз от примерно 106 до примерно 1010 (например, примерно 109), как правило, вводят инфузией. После попадания иммунореактивных клеток в организм субъекта и последующей дифференциации индуцируются иммунореактивные клетки, которые специфически направлены против одного конкретного антигена (например, FcRL5). «Индукция» T-клеток может включать инактивацию антигенспецифических T-клеток, например, за счет удаления или анергии. Инактивация особенно полезна для установления или повторного установления толерантности, как, например, при аутоиммунных заболеваниях. Иммунореактивные клетки по настоящему изобретению можно вводить любыми способами, известными в данной области, включая, но без ограничения, плевральное введение, внутривенное введение, подкожное введение, внутриузловое введение, внутриопухолевое введение, интратекальное введение, интраплевральное введение, внутрибрюшинное введение и прямое введение в тимус. В конкретных вариантах осуществления иммунореактивные клетки и содержащие их композиции внутривенно вводят субъекту, который нуждается в этом.

Настоящее изобретение относится к различным способам применения иммунореактивных клеток (например, T-клеток), экспрессирующих FcRL5-специфичный CAR. Например, настоящее изобретение относится к способам уменьшения опухолевой нагрузки у субъекта. В одном неограничивающем примере способ уменьшения опухолевой нагрузки включает введение эффективного количества раскрытой в настоящем документе иммунореактивной клетки субъекту, в результате чего индуцируется гибель опухолевых клеток у субъекта. Раскрытая в настоящем документе иммунореактивная клетка способна приводить к уменьшению количества опухолевых клеток, уменьшению размера опухоли и/или уничтожению опухоли у субъекта. Неограничивающие примеры соответствующей опухоли включают множественную миелому, неходжкинскую лимфому (особенно из клеток мантийной зоны), лимфому Ходжкина, хронический лимфоцитарный лейкоз (CLL), острый лимфоцитарный лейкоз (ALL), волосатоклеточный лейкоз, лимфому Беркитта и макроглобулинемию Вальденстрема.

Настоящее изобретение также относится к способам увеличения или продления срока выживания субъекта, имеющего неоплазию. В одном неограничивающем примере способ увеличения или продления срока выживания субъекта, имеющего неоплазию, включает введение эффективного количества раскрытой в настоящем документе иммунореактивной клетки субъекту, в результате чего увеличивается или продлевается срок выживания субъекта. Способ может приводить к уменьшению или уничтожению опухолевой нагрузки у субъекта. Настоящее изобретение также относится к способам лечения или предотвращения неоплазии у субъекта, включающим введение раскрытой в настоящем документе иммунореактивной клетки субъекту.

Используемый в настоящем документе термин «неоплазия» означает заболевание, характеризующееся патологической пролиферацией клетки или ткани и ее последующей миграцией или инвазией в другие ткани или органы. Неопластический рост, как правило, является неконтролируемым и прогрессирующим, и происходит в условиях, которые не вызвали бы, или вызвали бы прекращение, размножения нормальных клеток. Неоплазии могут поражать разные клетки, ткани или органы, включая, но без ограничения, орган, выбранный из группы, состоящей из мочевого пузыря, толстой кишки, кости, головного мозга, молочной железы, хряща, глии, пищевода, фаллопиевой трубы, желчного пузыря, сердца, кишечника, почки, печени, легких, лимфатических узлов, нервной ткани, яичников, плевры, поджелудочной железы, предстательной железы, скелетных мышц, спинного мозга, селезенки, желудка, яичек, тимуса, щитовидной железы, трахеи, урогенитального тракта, мочеточника, уретры, матки и влагалища, либо ткани или клеток из них. Неоплазии включают такие формы рака, как саркомы, карциномы или плазмацитомы (злокачественная опухоль плазматических клеток).

Раковые опухоли, рост которых можно ингибировать с использованием иммунореактивных клеток по настоящему изобретению, включают формы рака, как правило, отвечающие на иммунотерапию. Неограничивающие примеры рака, который можно лечить, включают множественную миелому, неходжкинскую лимфому (особенно из клеток мантийной зоны), лимфому Ходжкина, хронический лимфоцитарный лейкоз (CLL), острый лимфоцитарный лейкоз (ALL), волосатоклеточный лейкоз, лимфому Беркитта и макроглобулинемию Вальденстрема. В конкретных вариантах осуществления рак представляет собой множественную миелому.

Кроме того, настоящее изобретение относится к способам повышения продуцирования иммуноактивирующих цитокинов в ответ на присутствие раковой клетки в организме субъекта. В одном неограничивающем примере способ включает введение раскрытой в настоящем документе иммунореактивной клетки субъекту. Иммуноактивирующий цитокин может представлять собой гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), IFN-α, IFN-β, IFN-γ, TNF-α, IL-2, IL-3, IL-6, IL-11, IL-7, IL-12, IL-15, IL-21, регуляторный фактор интерферона 7 (IRF7), а также их сочетания. В конкретных вариантах осуществления иммунореактивные клетки, содержащие FcRL5-специфичный CAR по настоящему изобретению, приводят к увеличению продуцирования GM-CSF, IFN-γ и/или TNF-α.

Субъекты-люди, подходящие для терапии, как правило, составляют две группы лечения, которые различаются по клиническим критериям. Субъекты с «запущенным заболеванием» или «высокой опухолевой нагрузкой» являются субъектами, имеющими клинически определяемую опухоль (например, множественную миелому). Клиническими определяемая опухоль представляет собой опухоль, которую можно обнаружить по наличию опухолевой массы (например, при пальпации, на основании результатов КАТ-сканирования, сонограммы, маммограммы или рентгеновского снимка; наличия одних только биохимических или гистопатологических маркеров недостаточно для отнесения к этой популяции). Фармацевтическую композицию по настоящему изобретению вводят данным субъектам для инициации противоопухолевого ответа с целью облегчения их состояния. В идеале, результатом является уменьшение опухолевой массы, однако любое клиническое улучшение является полезным. Клиническое улучшение включает снижение риска или скорости прогрессирования, или уменьшение патологических последствий опухоли (например, множественной миеломы).

Вторая группа подходящих субъектов известна в данной области как «адъювантная группа». К этой группе относятся индивидуумы, которые имели в анамнезе неоплазию (например, множественную миелому), но ответили на другой вид терапии. Предшествующая терапия может включать, но без ограничения, хирургическую резекцию, радиотерапию и традиционную химиотерапию. В результате данные индивидуумы не имеют клинически определяемую опухоль. Однако они могут иметь риск прогрессирования заболевания, либо рядом с зоной исходной опухоли, либо вследствие метастазов. Эту группу можно дополнительно подразделять на подгруппы индивидуумов с высокой степенью риска и с низкой степенью риска. Это разделение проводят на основе признаков, наблюдаемых до или после первичного лечения. Эти особенности известны в клинической практике и соответствующим образом определены для каждой отдельной неоплазии. Признаками, типичными для подгрупп с высокой степенью риска, являются инвазия опухоли (например, множественной миеломы) в соседние ткани или признаки вовлечения лимфатических узлов. Индивидуумы другой группы имеют генетическую предрасположенность к неоплазии (например, множественной миеломе), однако у них пока не проявляются клинические признаки неоплазии (например, множественной миеломы). Например, женщины с положительными результатами теста на генетическую мутацию, связанную с раком молочной железы, но все-еще находящиеся в детородном возрасте, могут решить принимать один или более из антигенсвязывающих фрагментов, описанных в настоящем документе, в качестве профилактической меры для предотвращения развития неоплазии до тех пор, пока не наступит подходящее время для проведения превентивной хирургической операции.

Субъекты могут иметь запущенную форму заболевания (например, множественной миеломы), в этом случае цель лечения может включать облегчение или обращение вспять прогрессирования заболевания и/или ослабление побочных эффектов. Субъекты могут иметь в анамнезе состояние, для которого они уже получали лечение, в этом случае цель лечения, как правило, будет включать уменьшение риска или отсрочку рецидива.

Можно вносить дополнительные модификации в иммунореактивные клетки, экспрессирующие FcRL5-специфичный CAR (например, T-клетки), для предотвращения или минимизации риска иммунологических осложнений (известных как «злокачественная трансформация T-клеток»), например, реакции «трансплантат против хозяина» (GvHD), или в случае, когда здоровые ткани экспрессируют те же целевые антигены, что и клетки опухолей, что приводит к результатам, аналогичным GvHD. Потенциальным решением этой проблемы является введение генно-инженерными методами в CAR-экспрессирующие T-клетки гена самоубийства. Подходящие гены самоубийства включают, но не ограничиваются ими, ген тимидинкиназы вируса простого герпеса (hsv-tk), ген индуцируемой каспазы 9 (iCasp-9), а также ген укороченного полипептида рецептора эпидермального фактора роста (EGFRt) человека. В конкретных вариантах осуществления ген самоубийства представляет собой ген полипептида EGFRt. Полипептид EGFRt может вызывать элиминацию T-клеток при введении анти-EGFR моноклонального антитела (например, цетуксимаба). EGFRt может быть ковалентно связан с 3'-концом внутриклеточного домена FcRL5-специфичного CAR. Ген самоубийства можно включать в вектор, содержащий нуклеиновые кислоты, кодирующие раскрытый в настоящем документе FcRL5-специфичный CAR. В этой ситуации введение пролекарства, предназначенного для активации гена самоубийства (например, AP1903 для активации iCasp-9) в случае злокачественной трансформации T-клеток (например, GVHD), запускает апоптоз CAR-экспрессирующих T-клеток с активированным геном самоубийства.

IX. Наборы

Настоящее изобретение относится к наборам для лечения или предотвращения неоплазии (например, множественной миеломы). В конкретном варианте осуществления набор включает терапевтическую или профилактическую композицию, содержащую эффективное количество иммунореактивной клетки, содержащей FcRL5-специфичный CAR, в стандартной лекарственной форме. В конкретных вариантах осуществления клетки могут дополнительно экспрессировать по меньшей мере один костимулирующий лиганд. В конкретных вариантах осуществления набор включает стерильный контейнер, содержащий терапевтическую или профилактическую вакцину; такие контейнеры могут представлять собой коробки, ампулы, бутылки, флаконы, пробирки, мешки, пакеты, блистерные упаковки или другие подходящие формы контейнеров, известные в данной области. Такие контейнеры могут быть выполнены из пластика, стекла, ламинированной бумаги, металлической фольги или других материалов, подходящих для хранения лекарственных средств.

При необходимости, иммунореактивную клетку предоставляют совместно с инструкциями по введению клетки субъекту, имеющему, или имеющему риск развития неоплазии (например, множественной миеломы). Инструкции, как правило, будут содержать информацию об использовании композиции для лечения или предотвращения неоплазии (например, множественной миеломы). В других вариантах осуществления инструкции включают по меньшей мере одно из следующего: описание лекарственного средства; схему доз и режим введения для лечения или предотвращения неоплазии (например, множественной миеломы) или ее симптомов; меры предосторожности; предупреждения; показания; противопоказания; информацию о передозировке; побочные реакции; результаты фармакологических исследований на животных, клинических исследований и/или литературные источники. Инструкции могут быть напечатаны непосредственно на контейнере (при возможности), или представлять собой этикетку, прикрепленную к контейнеру, или представлять собой отдельный листок, брошюру, карточку или папку, которые предоставляют в контейнере или вместе с ним.

X. Иллюстративные внеклеточные антигенсвязывающие домены (например, scFv)

Таблица 1

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
Cagtctgtgttgacgcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 1]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtgtatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcgaaggtccgtacgacggtttcgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 2]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 2

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
Aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattctgtggtattcggcggagggaccaagctgaccgtcctaggt [SEQ ID No. 5]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtacagtctggcactgaggtgaagaagcctggggcctcagtgagggtcgcctgcaaggcttctggttacccctttaacaaatatgacatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggaggcatcatccctatctttcgtacaacaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtatattactgtgcgcgcgaatggttctactgggatatctggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 6]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 3

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgactcagccaccctcagtgtccgtgtccccaggacagacagccagcatctcctgctctggaaataaattggggactaagtatgtttactggtatcagaagaggccaggccagtcccctgtgttggtcatgtatgaagataatcagcggccctcagggatcccggagcggttctctggctccaactctgggaacacagccactctgaccatcagagggacccagactgtggatgaggctgactattactgtcaggcgtgggactccgacactttcgtggtcttcggcggagggaccaaggtcaccgtcctaggt [SEQ ID NO: 9]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagaccgggggaggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcacatgatggaagtaataaatactacgcagactccgtgaagggccgattcaccatctccagagacaattccaaggacacgctgtatctgcaaatgaacagcctgagaggtgaggacacggccgtatattactgtgcgcgctctaaccagtggtctggttacttctctttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 10]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 4

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtggtggtcatccattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 13]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccacctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacacttacaatggtcacacaaactatgcacagaagctccagggcagagccacaatgaccgcagacacatccacgaacacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgcgttatctacggttctggtgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 14]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 5

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccactctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaactgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatcgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 17]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcaatgtctctggttactccatcagcagtggttacttttggggctggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagtaggagcacctactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgaactctgtgaccgccgcagacacggccgtgtattactgtgcgcgcggttacggttacttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 18]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 6

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caatctgccctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactatgtctcctggtaccaacaacacccaggcaaagcccccaaactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcacttcgaaggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 21]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggaggtgtggtacggcctggggggtccctgagactctcctgtgcagcctctggattcacctttggtgattatggcatgagctgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaatggtggtagcacaggttatgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggccgtatattactgtgcgcgctctaaatacaacttccatgtttactacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 22]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 7

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccaccctcagcgtctgggacccccgggcagacagtcaccatctcttgttctggaagcaactccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcctcatctataggaataatcagcggccctcaggggtccctgaccgattctcaggctccaagtctggcacctcagcctccctggccatcagtgggctccgctccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtgcttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 25]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgctcttctggtaacatggtttcttggaaagatatgtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 26]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 8

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caatctgccctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactctgtctcctggtaccaacaacacccaggcaaagcccccagactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcacccctttagtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 29]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcggtgctgttgcttaccatgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 30]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 9

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagagggtcaccatctcctgctctggaagcagctccaacatttcgatttatgatgtatcctggtatcagcagctcccaggaacagcccccaaactcctcatttatggcaataataagcgaccctcggggattgctgaccgattctctggctccacgtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatgacagtctgagtgggggggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 33]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
cagatgcagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcgaggcttctggaggcaccctcagcagctatgctatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatgtttggtacagcacactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgaaaacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtgttcattacgcttctttcgatcattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 34]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 10

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctgcggccgcaggacagaaggtcaccatctcctgctctggaagcgactccaacattgggaataattatgtgtcctggtatcaacacctcccagggacagcccccaaactcctcatttatgacgttaaaaatcgaccctcagggattcctgaccggttctccggctccaagtctggctcgtcagccaccctaggcatcgccggactccagcctggggacgaggccgattattactgcggaacatgggacagtcggctggatgcctatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 37]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
cagatgcagctggtgcaatctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaagacttctggtttcccctttaatatctttggaatcacctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcggttacaacggtaacacagactacccacagaagttccagggcagagtcaccatgtccacagacacatccacgagtacagcctacatggagctgaggaacctgaaatctgacgacacggccgtgtattactgtgcgcgcggtgcttacggtggtatggatacttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 38]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 11

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcacctccaacatcggggcaggttatgatgtacactggtatcagcagcttccaggaacagcccccaaactcctcatctatactaacaactttcggccctcaggggtccctgaccgattctctgcctccaagtctggcacttcagcttccctggccatcactggtctccaggctgaggatgaggctgattattactgcggaacatgggatagcagcctgagtgccgttgtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 41]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctggaactgaggtgaagaagcctggggcctcagtgaaagtctcctgcaaggcttctggttacatgtttaccagttatggtctcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgctaacaatggtaagacaaattatgctaagaaattccaggacagagtcaccatgaccagagacacttccacgagcacaggctacatggaactgaggagcctgagatctgacgacacggccgtatattactgtgcgcgccatatcggtggttcttacttcgatcgttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 42]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 12

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcattatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 45]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagactgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtgatggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagacgaggacacggccgtatattactgtgcgcgctctcatgaagctaacctggttggtgattggtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 46]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 13

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtggtgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatgtggtattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 49]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgctggggtggtttcggtgctgttgatcattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 50]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 14

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcttctgagctgactcaggaccctgctgtgtctgtggccttgggacagacagtcaagatcacgtgccaaggagacagcctcacagactaccatgcaacctggtaccagcagaagccaggacaggcccctgtcgctgtcatctatgctacaaacaaccggcccactgggatcccagaccgattctctggttccagttccggaaacacagcttctttgaccatcactggggctcaggcggaagatgaggctgactattactgtaattcccgggacagcggcacggacgaagtgttattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 53]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagactgggggaggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttcagtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagtagtagttacatatactacgcagactcagtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgcgcggtcagggttacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 54]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 15

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цеп His-метка+HA-метка)
tcctatgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcgtctatgatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgagcatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatactgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 57]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgctactacccgggtatggatatgtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 58]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 16

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccgccctcaacgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcgggagaaatggtgtaaactggtaccagcagctcccaggagcggcccccaaagtcctcatctataatgataatcagcgaccctcaggggtccctgaccgagtctctggctcccagtctggctcctcaggcaccctggccatcgatgggcttcggtctgaggatgaggctgattattactgtgcggcatgggatgacagcctgcatggtgtggtattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 61]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtacagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcaatgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtggttacggtgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 62]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 17

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattcttgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 65]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcaatctggggctgaggtgaagaggcctgggtcctcggtgaaggtctcctgcacggcttctggaggcaccttcagcagcgatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaggaatcatccctatgtttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcgaaggttactactacccgtctgcttacctgggttctgttctgaacgacatctcttctgtttacgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 66]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 18

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcacctccaacattggaaataatgatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcgtgagtgcttcttgggtcttcggcagagggaccaagctgaccgtcctaggt [SEQ ID NO: 69]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatccacagaagctccagggcagagtcaccatgaccacagacccatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgctctatgacttctttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 70]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 19

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcaactccaacattgggaataattatgtatcctggtatcagcaactcccagggacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaggtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatggaataccactgtgactcctggctatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 73]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaagtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacaccgccatgtattactgtgcgcgctctgtttacgacctggatacttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 74]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 20

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgggggccccttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 77]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtcttggggaggctcggaacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagcggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaattccctgtatctgcaaatgaacagtctgagagctgaggacaccgccatgtattactgtgcgcgctaccgtcaggttggttctgcttacgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 78]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 21

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
ctgcctgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtatcagcagaagccaggccaggcccctgtgctggtcgtctatgctgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagttatcataattatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 81]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgagcagcctgagatctgaggacaccgccatgtattactgtgcgcgctactggggtttcggtgtttctgatcgttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 82]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 22

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccccgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgacagcagcaatctttgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 85]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
cagatgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctacaactactactactacgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 86]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 23

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
gacatccagatgacccagtctccatcctccctgtctgcatctgtaggagacagagtcaccatcacttgccgggcaagtcagagcattagcagctatttaaattggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagtggcagtggatctgggacagatttcactctcaccatcagcagtctgcaacctgaagattttgcaacttactactgtcaacagagttacagtaccccattcactttcggccctgggaccaaagtggatatcaaacgt [SEQ ID NO: 89]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacaccgccatgtattactgtgcgcgctactggggttacgactcttacgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 90]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 24

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 93]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcaacaaccattactacaacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 94]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 25

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagggggtcaccatcccctgcactgggagcagctccaacatcggggcaggttatgatgtacactggtaccagcagcttccagggacagcccccaaactcctcatctatggtaacaacaatcggccctcaggggtccctgaccgcttctctggctccaggtctggctcctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtgatgtggtattcggcggagggaccaaggtcaccgtcctaggt [SEQ ID NO: 97]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaagaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttcaccgactactacatgcactgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaagatggtgaaacaatatacgcagagaagttccagggcagagtcaccataaccgcggacacgtctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgctactggtcttactctttcgactacctgtacatgccggaaggtaacgattggtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 98]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 26

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgactcagccacccgcagcgtctgggacccccggacagagagtcaccatctcttgttctgggggcgtctccaacatcgggagtggtgctctaaattggtaccagcaactcccaggaacggcccccaaactcctcatctatagttacaatcagcggccctcaggggtctctgaccgattctctggctccaggtctgccacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcaacctgggatgatagtgtgaatggttgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 101]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtacagtctggagctgaggtgaagaagcctggggattcagtgaaggtctcctgcaagccttctggttacaattttctcaactatggtatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggattagcacttacaccggtaacacaaactatgcacagaagctgcagggcagagtcaccttcaccacagacacatccacgagcacagcctacatggagatgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcgacctgtactactacgaaggtgttgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 102]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 27

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccagggttacctgtgggggaaacaacattggaagtgaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgttggtcatctattatgataccgaccggccctcagggatccctgagcgattctctggctcccactctgggaccacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagggatcatgtggtattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 105]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctgggggaggcgtggtccagcctgggaggtccctgagactctcctgtgcggcctctggattcaccttcagtagctatgctatgcactgggtccgccaggctccaggcaagggactggagtgggtggcagttatatcatatgatggaagcaataaatactacgcagactccgtgaagggcctattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggccgtgtattactgtgcgcgctcttacttcacttctggtttctacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 106]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 28

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagttccaacatcggggcaggttatgatgtaaattggtatcagcagtttccaggaacagcccccaaactcctcatctatggtaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggctcttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 109]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
cagatgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcatgtcttctatgtactacgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 110]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 29

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgattatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 113]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagactgggggaggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccgtcagtgactactacatgagctggatccgccaggctccagggaagggcctggagtggatttcatacattagtggtagtggtaatagcatatactacgcagactctgtgaagggccgattcaccatctccagggacaacgccaagaactcactggatctgcaaatgaccagcctgagagccgaggacacggccgtatattactgtgcgcgctctactaaattcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 114]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 30

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
ctgcctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacgtcggaagttacactgtaaactggtaccggcaactcccaggaacggcccccacactcctcatctataataataatcagcggccctcaggggtccctgaccgattctctgactccaagtctggcacctcggcctccctgaccattagtgggctccagcctgaggatgaggctgattattattgtgcagcatgggatgacaggctgggtggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 117]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtctggagcagaggtgaaaaagccgggggagtctctgaagatctcctgtaagggttctggatacagctttaccaactactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgactctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctacagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgcgctctactggttcttctcatatgtctgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 118]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 31

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatcattgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 121]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caagtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggagatcactcatagtggaaggtccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgctcttctatcatgtctgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 122]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 32

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcacctccaacatcggggcaggttatgatgtacactggtaccagcagcttccaggaacagcccccaaactcctcatcaacaataacaggaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatggcagcctgactggtgcagtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 125]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcatgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcggttctgctctggaccattacgatcgttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 126]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 33

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcaccaattgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 129]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctacaactactacttcaacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 130]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 34

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 133]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
cagatgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgctctatgttcggtgctcatgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 134]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 35

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaacatcggggcaggttttgatgtacactggtaccagctacttccaggaacagcccccaaactcctcatctatgctaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctcctggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggtgtggtattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 137]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtgcttctttcgaccgtcatgataactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 138]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 36

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagttcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 141]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgctctaactactactacaacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 142]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 37

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaacatcggggcaggttatgatgtacactggtaccagcagcttccaggaacagcccccaaactcctcatctatggtaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 145]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctactctggtgtttactacgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 146]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 38

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggggtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccgacaactttgtgcagtggtaccagcagcgcccgggcggtgtccccaccactgtgatctttaatgatgacgaaagaccctctggcgtccctgatcggttctctggctccatcgacacctcctccaattctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgataataataatcgaggggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 149]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatgaaccctaacagtggtaacacaggctatgcacagaagttccagggcagagtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcaacctgagatctgaggacacggccgtgtattactgtgcgcgctactactcttacggttacgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 150]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 39

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagacggtcaccatctcctgcactgggggcagctccaacatcgggacaggttattttgtaaattggtaccagcaggttccaggaaaagcccccaaactcctcatcctgggtaacaataatcggccctcgggggtccctgaccgactctccggctccacgtccggcacctcagcctccctggccatcactgggctccaggctgaggatgagggtacttattactgccagtcctatgacagcagcctgagtggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 153]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtacagctgcagcagtcaggtccaggactggtgaagccctcgcagaccctctcactcacctgtggcatctccggggacagtgtctctaccaacagtgttgcttggcactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtccaagtggtctaatgactatggagtatctgtgaaaagtcgaatcaccatcatcccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcgcgctcttcttcttggtaccagatcttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 154]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 40

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagcgacagcatagccaacaactatgttcagtggtaccagcagcgcccgggcagtgcccccaccaatgtgatctacgaagatgtccaaagaccctctggggtccctgatcggttctctgggtccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgtctactattgtcagtcttatcatagcgacaatcgttgggtgttcggcggcgggaccaagctgaccgtcctaggt [SEQ ID NO: 157]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtggagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtggtggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgcgctctggtgcttactgggactactctgtttacgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 158]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 41

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgactcagccaccctcagtgtccgtgtccccaggacagacagccaccatcgcctgttctggacataaattgggggataaatatgcttcctggtatcagcagaagtcgggccagtcccctgtgttgatcatctatcaggataataagcggccctcagggattcctgagcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctctggatgaggctgactattattgtcaggcgtgggacagtagtacttatgtggcattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 161]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctgcaggagtccggcccaggactggtgaagccttcggagaccctgtccctcacctgcgttgtctctggtggctccatcagcagtagtaactggtggagctgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagtgggagccccaactacaacccatccctcaagagtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcatgactactcatactttcggttacgatgcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 162]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 42

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagcctgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccacgattacttgtgggggaaacaacattggaagtgaaagtgtgcactggtaccaccagaagccaggccaggcccctgtgttggtcatctatgatgatgccggccggccctcagggatccctgagcgattcactggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggacagaaatagtgctcagtttgtcttcggacctgggaccaaggtcaccgtcctaggt [SEQ ID NO: 165]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcggtgttcatctggattggtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 166]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 43

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtggttatgtcttcggaactgggaccaagctgaccgtcctaggt [SEQ ID NO: 169]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcctgtacgaaggtggttaccatggttggggttcttggctgtcttctgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 170]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 44

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttattgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 173]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgcgcgaaggggcatttgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 174]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 45

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgagctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcttcatctataggaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtggttatctcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 177]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaatggcgactccaactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 178]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 46

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgccctgactcagcctgcctccgtgtccgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacattggtggttataactatgtctcctggtaccaacaacacccaggcaaagcccccaaactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcatctcatatacacgcacctggaacccctatgtcttcgggagtgggaccaaggtcaccgtcctaggt [SEQ ID NO: 181]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtctgggggaggcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccgtcaagctccagggaagggtctggagtgggtctctcttattagtggggatggtggtagcacatactatgcagactctgtgaagggccgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagaactgaggacaccgccttgtattactgtgcaaaagatcgggcagcagctggctactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 182]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 47

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
ctgcctgtgctgactcagccaccctcagtgtccgtgtccccaggacagacagccatcatcacctgctctggagataaattgggggaaaaatatgtttcctggtatcagcagaagccaggccagtcccctgtactggtcatcgatcaagataccaggaggccctcagggatccctgagcgattctctggctccaactctgggaccacagccactctgaccatcagcgggacccaggctatggatgaggctgactattactgtcaggcgtgggacaggggtgtggtattcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 185]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggagacttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttaatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggagtggtaataacataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagatagtatacggtatggcatcacctggggaggttttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 186]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 48

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagcctgtgctgactcagccaccctcggtgtccaagggcttgagacagaccgccacactcacctgcactgggaacagcaacaatgttggcaacctaggagtagcttggctgcagcagcaccagggccaccctcccaaactcctatcctacaggaataacaaccggccctcagggatctcagagagattatctgcatccaggtcaggaaacacagcctccctgaccattactggactccagcctgaggacgaggctgactattactgctcagcatgggacagtagcctcagtgcttgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 189]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggagtcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccgtcaagctccggggaagggtctggagtgggtctctcttattaattgggatggtggtagcacctactatgcagactctgtgaagggtcgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagagctgaggacaccgccttgtattactgtgcaaaagggatgggcctgagggcgtttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 190]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 49

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcctgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaatgatcagcggccctcaggggtccctgaccgattctctggctccaagtccggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcttcatgggatgacagcctgaatggccgttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 193]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtacagtctggggctgaggtgaggaagcctggggcctcagtgaaggtttcctgcaagacttctggatacaccttcagttggtatgctatacattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggcaatggaaacacaaaatattcacagaaatttcagggcagagtcagtcttaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgatgacacggctgtgtattactgtgcgagacccgataattatggttcgggtggggatgtttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 194]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 50

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactttgtgcagtggtaccagcagcgcccgggcagtgcccccacccctatgatctatgaggataacaacagaccccctggggtccctgatcggttctctgcctccgtcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgataccagcaatgtggtattcggcggggggaccaagctgaccgtcctaggt [SEQ ID NO: 197]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggaggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatgaaatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagtggtagtaccatatactacgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtttattactgtgcacgctgggactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 198]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 51

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccaccctcagcgtctggggcccccgggcagagggtcaccgtctcttgttctggaagcaactccaacatcggaagtaactacgttaactggtaccagcagttcccaggaacggcccccaaactcctcatgtatagtagtagtcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccactctgaggatgaggctgattattactgtgctacatgggatgacagcctgaatgcttgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 201]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaggaagcctggggcctcagtgaaggtttcctgcaagacttctggatacaccttcacttggtatgctatacattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggcagtggaaacacaaaatattcacagaaatttcagggcagagtcacccttaccagggacacatccgcgagcacagcgtacatggagctgagcagcctgagatctgatgacacggctgtgtattactgtgcgagacccaataactatggttcgggtggggatgtttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 202]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 52

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgagtgcttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 205]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaagtttcctgcaaggcttctggatacaccttcacgaactatgctctgcattgggtgcgccaggcccccggacaagggcttgagtggatggcatggatcaacggtggcaatggtaacacaaaatattcacagaacttccagggcagagtcaccattaccagggacacatccgcgagcacagcctatatggagctgagcagcctgagatctgaagacacggctgtgtattactgtgcgaaaccggaggaaacagctggaacaatccactttgactactggggccagggaaccccggtcaccgtctcctca [SEQ ID NO: 206]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 53

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcaccatcacggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 209]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtacagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgggggagggttactatgatagtagtggttattccaacggtgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 210]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 54

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatgtggtattcggcggagggaccaaggtcaccgtcctaggt [SEQ ID NO: 213]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggaggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatgaaatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagtggtagtaccatatactacgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtttattactgtgcacgctgggactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 214]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 55

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccaccctcagtgtccgtgtccccaggacagacagccagcatcacctgctctggagatagattgacgaataaatatgtttcctggtatcaacagaagccaggccagtcccctgtgttggtcatctatgaggatgccaagcggccctcagggatccctgcgcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctatggatgagtctgaatattactgtcaggcgtgggacagcagtgtggtggtttttggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 217]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggatttacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagtataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagatgaggacacggccttgtattactgtgcaaaagaccgaggggggggagttatcgttaaggatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 218]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 56

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgagctgactcagccacccgcagcgtctgggacccccggacagagagtcaccatctcttgttctgggggcgtctccaacatcgggagtggtgctctaaattggtaccagcaactcccaggaacggcccccaaactcctcatctatagttacaatcagcggccctcaggggtctctgaccgattctctggctccaggtctgccacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcaacctgggatgatagtgtgaatggttgggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 221]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctggagctgaggtgaagaagcctggggattcagtgaaggtctcctgcaagccttctggttacaattttctcaactatggtatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggattagcacttacaccggtaacacaaactatgcacagaagctgcagggcagagtcaccttcaccacagacacatccacgagcacagcctacatggagatgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgccagcagggtggtggttggtacgatgtttggggtcaaggtactctggtcaccgtctcctca [SEQ ID NO: 222]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 57

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggagagaaggtcaccatctcctgctctggaagcaacttcaatgttggaaataatgatgtatcctggtatcagcaactcccaggtgcagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctggacatcaccgggctccacagtgacgacgaggccgattattactgcggaacatgggatagcagcctgaatactgggggggtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 225]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatactatcagctgggtacgacaggcccctggacaagggcttgagtggatgggatggatcagcacttacaatggtctcacaaactatgcacagaacctccagggcagagtcaccatgactacagacacattcacgaccacagcctacatggagctgaggagcctcagatctgacgacacggccgtgtattactgtgtgagagaggggtcccccgactacggtgacttcgcgtcctttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 226]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 58

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctgcgcccccgggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagttcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggatttctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcgccggactccagactggggacgaggccgattattactgcggaacatgggataccagcctgagtggtttttatgtcttcggaagtgggaccaaggtcaccgtcctaggt [SEQ ID NO: 229]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatactatcagctgggtacgacaggcccctggacaagggcttgagtggatgggatggatcagcacttacaatggtctcacaaactatgcacagaacctccagggcagagtcaccatgactacagacacattcacgaccacagcctacatggagctgaggagcctcagatctgacgacacggccgtgtattactgtgtgagagaggggtcccccgactacggtgacttcgcgtcctttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 230]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 59

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
ctgcctgtgctgactcagccaccctcagcgtctgcgacccccgggcagagggtcaccatctcttgttctggaaccacctccaacatcggaagtaatactgtacactggtaccagcagctcccagggacggcccccaaactcctcatctataataataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctacatattcctgtgcaacatgggatgacagcctgagtggtgtggtcttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 233]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagatcccgcctacggtgactacgagtatgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 234]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 60

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaactaatggtgtaaactggttccagcagttcccaggaacggcccccaaactcctcatctatactaatgatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgcggatgaggctgattattactgtgcagtgtgggaccacagcctgaatggtccggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 237]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaggggccggttttgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 238]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 61

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgagactgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 241]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagaggggctagatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 242]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 62

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatgtatagtaatgatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattattgtgcagcatgggatgacagcctgaatggttatgtcttcgcagctgggacccagctcaccgttttaagt [SEQ ID NO: 245]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagaggggctagatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 246]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 63

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcactggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgagtgctgcttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 249]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagctttaccagctatactatcagctgggttcgacaggcccctggacaaggccttgagtggatgggatgggtcagcacttacaatggtctcagaaactatgcacagaacctccagggcagagtcaccatgactacagacacactcacgaccacagcctacatggagctgaggagcctcagatctgacgacacggccgtgtattattgtgtgagagaggggtcccccgactacggtgacttcgcggcctttgactactggggccagggcaccctggtcaccgtctcctca [SEQ ID NO: 250]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 64

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccaccctcagcgtctgagacccccgggcagagggtcaccatctcttgttctggaagcaggtccaacatcggaactaatattgtacactggtaccagcagcgcccaggaatggcccccaaactcctcacttatggtagtcggcggccctcaggggtcccggaccgattctctggctccaagtttggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattattgtgcagcatgggatgacagtctgaatggtccggctttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 253]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagacggtgggggctactttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 254]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 65

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaatatcggggcacgttatgatgtacactggtaccagcaactcccaggaacagccccccgactcctcatctctgctaactacgatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagtgtgagtgcttgggtgttcggcggagggaccaaggtcaccgtcctaggt [SEQ ID NO: 257]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaagtgcagctggtgcagtctggggctgaagtgaaggagcctggggcctcagtgaggatctcctgccaggcatctggatacaacttcatcagttattatatgcactgggtgcggcaggcccctgggcaaggtcttgagtggatgggcaccatcaacccaggcagtggtgagacagactactcacagaagttgcagggcagagtcaccatgaccagggacccgtccacgggtacattcgacatggggctgagcagcctgacatctggggacacggccgtctattattgtgcgacaggtctcatcagaggagctagcgatgcttttaatatctggggccgggggacaatggtcaccgtctcttca [SEQ ID NO: 258]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 66

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagcctgtgctgactcagccaccctcagtgtccgtgtccccaggacagacggccgccatcccctgttctggagataagttgggggataaatttgcttcctggtatcagcagaagccaggccagtcccctgtgctggtcatctatcaagatactaagcggccctcagggatccctgagcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctatggatgaggctgactattactgtcagacgtgggccagcggcattgtggtgttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 261]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtacagctgcagcagtcaggtccaggactggtgaagccctcgcagaccctctcactcacctgtgccatctccggggacagtgtctctagcaacagtgctgcttggaactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtccaagtggtataatgattatgcagtatctgtgaaaagtcgaataaccatcaacccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcaagagagcgcagtggctggaagggatttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 262]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 67

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
gatgttgtgatgactcagtctccaccctccctgtccgtcacccctggagagccggcctccatcacctgcaggtctagtcagagcctcctggaaagaaatgcatacaactacttggattggtacctgcagaggccaggacagtctccacagctcctgatctacttgggttctaatcgggccgccggggtccctgacaggttcagtggcagtggatcaggcagagattttacactgaaaatcagcagagtggagcctgaggatgttggggtttattactgcatgcaagctctacaagctccgttcactttcggcggagggaccaaggtggagatcaaacgt [SEQ ID NO: 265]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaagtgcagctggtgcagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtggtggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaatggggcccgtttcaggatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 266]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 68

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactatgtctcctggtaccaacagcacccgggcaaagcccccaaactcatgatttatgaggtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcaccccttatgtcttcggagcagggaccaaggtcaccgtcctaggt [SEQ ID NO: 269]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagccaggtggacagcagtggcatcagaccaccactttgactactggggccagggaacgctggtcaccgtctcctca [SEQ ID NO: 270]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 69

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgcttactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaagctgaccgtcctaggt [SEQ ID NO: 273]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagattgggactacatggacgtctggggcaaagggaccacggtcaccgtctcctca [SEQ ID NO: 274]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 70

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgagctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 277]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtgcagctggtggagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagacctatctcggggagctaacccgcattactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 278]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 71

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccgtctcctgcactgggagcagatccaacatcggggcaggatatgatgtacactggtaccagcaacttccaggaacagcccccaaactcctcatctatggaaatagtaatcggcctccaggggtccctgaccgattctctgggtctaagtctggcacctcagcctccctggtcatcactgggctccaggctgaggatgccgctgattattactgccagtcctatgacaacactgtgcgtgaatcaccttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 281]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtacagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcaacagagagtaatttagtgtcccggcactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 282]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 72

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
ctgcctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaaccagctccaacatcggaagtaattctgtagactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgaatctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 285]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaagtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagagattacggatactatggttcggggagttattcgagcggccccctttactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 286]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 73

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
caggctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatgtataataatgatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctcaatggttatgtcttcggacctgggaccaaggtcaccgtcctaggt [SEQ ID NO: 289]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtggagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagacctatctcggggagctaacccgcattactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 290]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 74

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
aattttatgctgactcagccccacgctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagtattgccagcaactatgtgcagtggtaccagcagcgcccgggcagttccccccgcactgtgatttatgaggataatcaaagaccctctggggtccctggtcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgattccaccagtgtgcttttcggcggagggaccaagctgaccgtcctaggt [SEQ ID NO: 293]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
gaggtccagctggtgcagtctggggctgaggtgaagaagccagggtcctcggtgaaggtctcctgcaaggcctcgggaggcaccttcagcagcaattctctcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcttccctatcctgggtataacaaactatgcacagaagttccagggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtctattactgtgcgagaggaaactaccaatggtatgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 294]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 75

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
cagcctgtgctgactcagccaccctcagtgtcagtggtcccaggaaagacggccaggattacctgtgggggaaaaaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtggtggtcatccattatgatagtgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 297]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccaactatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacataagctccagggcagagtcaccatgaccacagacacatccacgagcacagccaacatggagctgaggagcctgagacctgacgacactgccgtgtattactgtgcgcgctcttacttcggttctcatgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 298]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

Таблица 76

Последовательность ДНК
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)
tcctatgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggatttcctgtgggggaaacgacattggaagtaaaagtgttttctggtatcagcagaggccaggccaggcccctgtgttggtcgtctatgatgatagcgaccggccctcagggctccctgagcgattctctggcttcaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaagtgtgggatagtagtagtgatcattatgtcttcggaactgggaccaaggtcaccgtcctaggt [SEQ ID NO: 301]
tctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcc [SEQ ID NO: 305]
caggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagatataacctatggttcggggagttatggtgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 302]
Аминокислотная последовательность
(вариабельная область легкой цепи scFv линкер вариабельная область тяжелой цепи His-метка+HA-метка)

XI. Иллюстративные внеклеточные антигенсвязывающие домены (например, scFv), содержащие вариабельную область тяжелой цепи, вариабельную область легкой цепи и пептидный линкер

Таблица 77

Последовательность ДНК
Cagtctgtgttgacgcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtgtatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcgaaggtccgtacgacggtttcgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 593]
Аминокислотная последовательность

Таблица 78

Последовательность ДНК
Aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattctgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggcactgaggtgaagaagcctggggcctcagtgagggtcgcctgcaaggcttctggttacccctttaacaaatatgacatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggaggcatcatccctatctttcgtacaacaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtatattactgtgcgcgcgaatggttctactgggatatctggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 595]
Аминокислотная последовательность

Таблица 79

Последовательность ДНК
Cagtctgtgttgactcagccaccctcagtgtccgtgtccccaggacagacagccagcatctcctgctctggaaataaattggggactaagtatgtttactggtatcagaagaggccaggccagtcccctgtgttggtcatgtatgaagataatcagcggccctcagggatcccggagcggttctctggctccaactctgggaacacagccactctgaccatcagagggacccagactgtggatgaggctgactattactgtcaggcgtgggactccgacactttcgtggtcttcggcggagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagaccgggggaggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcacatgatggaagtaataaatactacgcagactccgtgaagggccgattcaccatctccagagacaattccaaggacacgctgtatctgcaaatgaacagcctgagaggtgaggacacggccgtatattactgtgcgcgctctaaccagtggtctggttacttctctttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 597]
Аминокислотная последовательность

Таблица 80

Последовательность ДНК
Tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtggtggtcatccattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccacctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacacttacaatggtcacacaaactatgcacagaagctccagggcagagccacaatgaccgcagacacatccacgaacacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgcgttatctacggttctggtgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 599]
Аминокислотная последовательность

Таблица 81

Последовательность ДНК
Tcctatgtgctgactcagccactctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaactgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatcgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcaatgtctctggttactccatcagcagtggttacttttggggctggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagtaggagcacctactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgaactctgtgaccgccgcagacacggccgtgtattactgtgcgcgcggttacggttacttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 601]
Аминокислотная последовательность

Таблица 82

Последовательность ДНК
Caatctgccctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactatgtctcctggtaccaacaacacccaggcaaagcccccaaactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcacttcgaaggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggtgtggtacggcctggggggtccctgagactctcctgtgcagcctctggattcacctttggtgattatggcatgagctgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaatggtggtagcacaggttatgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggccgtatattactgtgcgcgctctaaatacaacttccatgtttactacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 603]
Аминокислотная последовательность

Таблица 83

Последовательность ДНК
Cagtctgtgttgacgcagccaccctcagcgtctgggacccccgggcagacagtcaccatctcttgttctggaagcaactccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcctcatctataggaataatcagcggccctcaggggtccctgaccgattctcaggctccaagtctggcacctcagcctccctggccatcagtgggctccgctccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtgcttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgctcttctggtaacatggtttcttggaaagatatgtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 605]
Аминокислотная последовательность

Таблица 84

Последовательность ДНК
Caatctgccctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactctgtctcctggtaccaacaacacccaggcaaagcccccagactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcacccctttagtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcggtgctgttgcttaccatgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 607]
Аминокислотная последовательность

Таблица 85

Последовательность ДНК
Cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagagggtcaccatctcctgctctggaagcagctccaacatttcgatttatgatgtatcctggtatcagcagctcccaggaacagcccccaaactcctcatttatggcaataataagcgaccctcggggattgctgaccgattctctggctccacgtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatgacagtctgagtgggggggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcgaggcttctggaggcaccctcagcagctatgctatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatgtttggtacagcacactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgaaaacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtgttcattacgcttctttcgatcattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 609]
Аминокислотная последовательность

Таблица 86

Последовательность ДНК
Cagtctgtgttgacgcagccgccctcagtgtctgcggccgcaggacagaaggtcaccatctcctgctctggaagcgactccaacattgggaataattatgtgtcctggtatcaacacctcccagggacagcccccaaactcctcatttatgacgttaaaaatcgaccctcagggattcctgaccggttctccggctccaagtctggctcgtcagccaccctaggcatcgccggactccagcctggggacgaggccgattattactgcggaacatgggacagtcggctggatgcctatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcaatctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaagacttctggtttcccctttaatatctttggaatcacctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcggttacaacggtaacacagactacccacagaagttccagggcagagtcaccatgtccacagacacatccacgagtacagcctacatggagctgaggaacctgaaatctgacgacacggccgtgtattactgtgcgcgcggtgcttacggtggtatggatacttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 611]
Аминокислотная последовательность

Таблица 87

Последовательность ДНК
Cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcacctccaacatcggggcaggttatgatgtacactggtatcagcagcttccaggaacagcccccaaactcctcatctatactaacaactttcggccctcaggggtccctgaccgattctctgcctccaagtctggcacttcagcttccctggccatcactggtctccaggctgaggatgaggctgattattactgcggaacatgggatagcagcctgagtgccgttgtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctggaactgaggtgaagaagcctggggcctcagtgaaagtctcctgcaaggcttctggttacatgtttaccagttatggtctcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgctaacaatggtaagacaaattatgctaagaaattccaggacagagtcaccatgaccagagacacttccacgagcacaggctacatggaactgaggagcctgagatctgacgacacggccgtatattactgtgcgcgccatatcggtggttcttacttcgatcgttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 613]
Аминокислотная последовательность

Таблица 88

Последовательность ДНК
Tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagactgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtgatggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagacgaggacacggccgtatattactgtgcgcgctctcatgaagctaacctggttggtgattggtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 615]
Аминокислотная последовательность

Таблица 89

Последовательность ДНК
Cagtctgtggtgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgctggggtggtttcggtgctgttgatcattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 617]
Аминокислотная последовательность

Таблица 90

Последовательность ДНК
Tcttctgagctgactcaggaccctgctgtgtctgtggccttgggacagacagtcaagatcacgtgccaaggagacagcctcacagactaccatgcaacctggtaccagcagaagccaggacaggcccctgtcgctgtcatctatgctacaaacaaccggcccactgggatcccagaccgattctctggttccagttccggaaacacagcttctttgaccatcactggggctcaggcggaagatgaggctgactattactgtaattcccgggacagcggcacggacgaagtgttattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagactgggggaggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttcagtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagtagtagttacatatactacgcagactcagtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgcgcggtcagggttacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 619]
Аминокислотная последовательность

Таблица 91

Последовательность ДНК
Tcctatgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcgtctatgatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgagcatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatactgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgctactacccgggtatggatatgtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 621]
Аминокислотная последовательность

Таблица 92

Последовательность ДНК
Caggctgtgctgactcagccgccctcaacgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcgggagaaatggtgtaaactggtaccagcagctcccaggagcggcccccaaagtcctcatctataatgataatcagcgaccctcaggggtccctgaccgagtctctggctcccagtctggctcctcaggcaccctggccatcgatgggcttcggtctgaggatgaggctgattattactgtgcggcatgggatgacagcctgcatggtgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcaatgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtggttacggtgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 623]
Аминокислотная последовательность

Таблица 93

Последовательность ДНК
Aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattcttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcaatctggggctgaggtgaagaggcctgggtcctcggtgaaggtctcctgcacggcttctggaggcaccttcagcagcgatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaggaatcatccctatgtttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcgaaggttactactacccgtctgcttacctgggttctgttctgaacgacatctcttctgtttacgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 625]
Аминокислотная последовательность

Таблица 94

Последовательность ДНК
Cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcacctccaacattggaaataatgatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcgtgagtgcttcttgggtcttcggcagagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatccacagaagctccagggcagagtcaccatgaccacagacccatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgctctatgacttctttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 627]
Аминокислотная последовательность

Таблица 95

Последовательность ДНК
Cagtctgtgttgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcaactccaacattgggaataattatgtatcctggtatcagcaactcccagggacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaggtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatggaataccactgtgactcctggctatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaagtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacaccgccatgtattactgtgcgcgctctgtttacgacctggatacttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 629]
Аминокислотная последовательность

Таблица 96

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgggggccccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtcttggggaggctcggaacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagcggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaattccctgtatctgcaaatgaacagtctgagagctgaggacaccgccatgtattactgtgcgcgctaccgtcaggttggttctgcttacgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 631]
Аминокислотная последовательность

Таблица 97

Последовательность ДНК
ctgcctgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtatcagcagaagccaggccaggcccctgtgctggtcgtctatgctgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagttatcataattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgagcagcctgagatctgaggacaccgccatgtattactgtgcgcgctactggggtttcggtgtttctgatcgttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 633]
Аминокислотная последовательность

Таблица 98

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccccgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgacagcagcaatctttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctacaactactactactacgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 635]
Аминокислотная последовательность

Таблица 99

Последовательность ДНК
gacatccagatgacccagtctccatcctccctgtctgcatctgtaggagacagagtcaccatcacttgccgggcaagtcagagcattagcagctatttaaattggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagtggcagtggatctgggacagatttcactctcaccatcagcagtctgcaacctgaagattttgcaacttactactgtcaacagagttacagtaccccattcactttcggccctgggaccaaagtggatatcaaacgttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacaccgccatgtattactgtgcgcgctactggggttacgactcttacgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 637]
Аминокислотная последовательность

Таблица 100

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcaacaaccattactacaacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 639]
Аминокислотная последовательность

Таблица 101

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagggggtcaccatcccctgcactgggagcagctccaacatcggggcaggttatgatgtacactggtaccagcagcttccagggacagcccccaaactcctcatctatggtaacaacaatcggccctcaggggtccctgaccgcttctctggctccaggtctggctcctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtgatgtggtattcggcggagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttcaccgactactacatgcactgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaagatggtgaaacaatatacgcagagaagttccagggcagagtcaccataaccgcggacacgtctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgctactggtcttactctttcgactacctgtacatgccggaaggtaacgattggtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 641]
Аминокислотная последовательность

Таблица 102

Последовательность ДНК
cagtctgtgttgactcagccacccgcagcgtctgggacccccggacagagagtcaccatctcttgttctgggggcgtctccaacatcgggagtggtgctctaaattggtaccagcaactcccaggaacggcccccaaactcctcatctatagttacaatcagcggccctcaggggtctctgaccgattctctggctccaggtctgccacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcaacctgggatgatagtgtgaatggttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggagctgaggtgaagaagcctggggattcagtgaaggtctcctgcaagccttctggttacaattttctcaactatggtatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggattagcacttacaccggtaacacaaactatgcacagaagctgcagggcagagtcaccttcaccacagacacatccacgagcacagcctacatggagatgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcgacctgtactactacgaaggtgttgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 643]
Аминокислотная последовательность

Таблица 103

Последовательность ДНК
caggctgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccagggttacctgtgggggaaacaacattggaagtgaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgttggtcatctattatgataccgaccggccctcagggatccctgagcgattctctggctcccactctgggaccacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagggatcatgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctgggggaggcgtggtccagcctgggaggtccctgagactctcctgtgcggcctctggattcaccttcagtagctatgctatgcactgggtccgccaggctccaggcaagggactggagtgggtggcagttatatcatatgatggaagcaataaatactacgcagactccgtgaagggcctattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggccgtgtattactgtgcgcgctcttacttcacttctggtttctacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 645]
Аминокислотная последовательность

Таблица 104

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagttccaacatcggggcaggttatgatgtaaattggtatcagcagtttccaggaacagcccccaaactcctcatctatggtaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggctcttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcatgtcttctatgtactacgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 647]
Аминокислотная последовательность

Таблица 105

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagactgggggaggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccgtcagtgactactacatgagctggatccgccaggctccagggaagggcctggagtggatttcatacattagtggtagtggtaatagcatatactacgcagactctgtgaagggccgattcaccatctccagggacaacgccaagaactcactggatctgcaaatgaccagcctgagagccgaggacacggccgtatattactgtgcgcgctctactaaattcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 649]
Аминокислотная последовательность

Таблица 106

Последовательность ДНК
ctgcctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacgtcggaagttacactgtaaactggtaccggcaactcccaggaacggcccccacactcctcatctataataataatcagcggccctcaggggtccctgaccgattctctgactccaagtctggcacctcggcctccctgaccattagtgggctccagcctgaggatgaggctgattattattgtgcagcatgggatgacaggctgggtggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggagcagaggtgaaaaagccgggggagtctctgaagatctcctgtaagggttctggatacagctttaccaactactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgactctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctacagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgcgctctactggttcttctcatatgtctgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 651]
Аминокислотная последовательность

Таблица 107

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatcattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaagtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggagatcactcatagtggaaggtccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgctcttctatcatgtctgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 653]
Аминокислотная последовательность

Таблица 108

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcacctccaacatcggggcaggttatgatgtacactggtaccagcagcttccaggaacagcccccaaactcctcatcaacaataacaggaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatggcagcctgactggtgcagtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcatgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcggttctgctctggaccattacgatcgttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 655]
Аминокислотная последовательность

Таблица 109

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcaccaattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctacaactactacttcaacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 657]
Аминокислотная последовательность

Таблица 110

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgctctatgttcggtgctcatgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 659]
Аминокислотная последовательность

Таблица 111

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaacatcggggcaggttttgatgtacactggtaccagctacttccaggaacagcccccaaactcctcatctatgctaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctcctggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggtgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtgcttctttcgaccgtcatgataactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 661]
Аминокислотная последовательность

Таблица 112

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagttcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgctctaactactactacaacgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 663]
Аминокислотная последовательность

Таблица 113

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaacatcggggcaggttatgatgtacactggtaccagcagcttccaggaacagcccccaaactcctcatctatggtaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctactctggtgtttactacgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 665]
Аминокислотная последовательность

Таблица 114

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggggtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccgacaactttgtgcagtggtaccagcagcgcccgggcggtgtccccaccactgtgatctttaatgatgacgaaagaccctctggcgtccctgatcggttctctggctccatcgacacctcctccaattctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgataataataatcgaggggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatgaaccctaacagtggtaacacaggctatgcacagaagttccagggcagagtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcaacctgagatctgaggacacggccgtgtattactgtgcgcgctactactcttacggttacgattggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 667]
Аминокислотная последовательность

Таблица 115

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagacggtcaccatctcctgcactgggggcagctccaacatcgggacaggttattttgtaaattggtaccagcaggttccaggaaaagcccccaaactcctcatcctgggtaacaataatcggccctcgggggtccctgaccgactctccggctccacgtccggcacctcagcctccctggccatcactgggctccaggctgaggatgagggtacttattactgccagtcctatgacagcagcctgagtggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtacagctgcagcagtcaggtccaggactggtgaagccctcgcagaccctctcactcacctgtggcatctccggggacagtgtctctaccaacagtgttgcttggcactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtccaagtggtctaatgactatggagtatctgtgaaaagtcgaatcaccatcatcccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcgcgctcttcttcttggtaccagatcttcgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 669]
Аминокислотная последовательность

Таблица 116

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagcgacagcatagccaacaactatgttcagtggtaccagcagcgcccgggcagtgcccccaccaatgtgatctacgaagatgtccaaagaccctctggggtccctgatcggttctctgggtccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgtctactattgtcagtcttatcatagcgacaatcgttgggtgttcggcggcgggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtggagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtggtggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgcgctctggtgcttactgggactactctgtttacgatgaatggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 671]
Аминокислотная последовательность

Таблица 117

Последовательность ДНК
cagtctgtgttgactcagccaccctcagtgtccgtgtccccaggacagacagccaccatcgcctgttctggacataaattgggggataaatatgcttcctggtatcagcagaagtcgggccagtcccctgtgttgatcatctatcaggataataagcggccctcagggattcctgagcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctctggatgaggctgactattattgtcaggcgtgggacagtagtacttatgtggcattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctgcaggagtccggcccaggactggtgaagccttcggagaccctgtccctcacctgcgttgtctctggtggctccatcagcagtagtaactggtggagctgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagtgggagccccaactacaacccatccctcaagagtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcatgactactcatactttcggttacgatgcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 673]
Аминокислотная последовательность

Таблица 118

Последовательность ДНК
cagcctgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccacgattacttgtgggggaaacaacattggaagtgaaagtgtgcactggtaccaccagaagccaggccaggcccctgtgttggtcatctatgatgatgccggccggccctcagggatccctgagcgattcactggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggacagaaatagtgctcagtttgtcttcggacctgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcggtgttcatctggattggtggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 675]
Аминокислотная последовательность

Таблица 119

Последовательность ДНК
cagtctgtcgtgacgcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtggttatgtcttcggaactgggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcctgtacgaaggtggttaccatggttggggttcttggctgtcttctgattcttggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 677]
Аминокислотная последовательность

Таблица 120

Последовательность ДНК
cagtctgtgttgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgcgcgaaggggcatttgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 679]
Аминокислотная последовательность

Таблица 121

Последовательность ДНК
tcctatgagctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcttcatctataggaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtggttatctcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaatggcgactccaactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 681]
Аминокислотная последовательность

Таблица 122

Последовательность ДНК
cagtctgccctgactcagcctgcctccgtgtccgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacattggtggttataactatgtctcctggtaccaacaacacccaggcaaagcccccaaactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcatctcatatacacgcacctggaacccctatgtcttcgggagtgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctgggggaggcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccgtcaagctccagggaagggtctggagtgggtctctcttattagtggggatggtggtagcacatactatgcagactctgtgaagggccgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagaactgaggacaccgccttgtattactgtgcaaaagatcgggcagcagctggctactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 683]
Аминокислотная последовательность

Таблица 123

Последовательность ДНК
ctgcctgtgctgactcagccaccctcagtgtccgtgtccccaggacagacagccatcatcacctgctctggagataaattgggggaaaaatatgtttcctggtatcagcagaagccaggccagtcccctgtactggtcatcgatcaagataccaggaggccctcagggatccctgagcgattctctggctccaactctgggaccacagccactctgaccatcagcgggacccaggctatggatgaggctgactattactgtcaggcgtgggacaggggtgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggagacttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttaatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggagtggtaataacataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagatagtatacggtatggcatcacctggggaggttttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 685]
Аминокислотная последовательность

Таблица 124

Последовательность ДНК
cagcctgtgctgactcagccaccctcggtgtccaagggcttgagacagaccgccacactcacctgcactgggaacagcaacaatgttggcaacctaggagtagcttggctgcagcagcaccagggccaccctcccaaactcctatcctacaggaataacaaccggccctcagggatctcagagagattatctgcatccaggtcaggaaacacagcctccctgaccattactggactccagcctgaggacgaggctgactattactgctcagcatgggacagtagcctcagtgcttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggagtcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccgtcaagctccggggaagggtctggagtgggtctctcttattaattgggatggtggtagcacctactatgcagactctgtgaagggtcgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagagctgaggacaccgccttgtattactgtgcaaaagggatgggcctgagggcgtttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 687]
Аминокислотная последовательность

Таблица 125

Последовательность ДНК
cagtctgtgttgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcctgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaatgatcagcggccctcaggggtccctgaccgattctctggctccaagtccggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcttcatgggatgacagcctgaatggccgttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggggctgaggtgaggaagcctggggcctcagtgaaggtttcctgcaagacttctggatacaccttcagttggtatgctatacattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggcaatggaaacacaaaatattcacagaaatttcagggcagagtcagtcttaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgatgacacggctgtgtattactgtgcgagacccgataattatggttcgggtggggatgtttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 689]
Аминокислотная последовательность

Таблица 126

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactttgtgcagtggtaccagcagcgcccgggcagtgcccccacccctatgatctatgaggataacaacagaccccctggggtccctgatcggttctctgcctccgtcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgataccagcaatgtggtattcggcggggggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatgaaatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagtggtagtaccatatactacgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtttattactgtgcacgctgggactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 691]
Аминокислотная последовательность

Таблица 127

Последовательность ДНК
caggctgtgctgactcagccaccctcagcgtctggggcccccgggcagagggtcaccgtctcttgttctggaagcaactccaacatcggaagtaactacgttaactggtaccagcagttcccaggaacggcccccaaactcctcatgtatagtagtagtcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccactctgaggatgaggctgattattactgtgctacatgggatgacagcctgaatgcttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaggaagcctggggcctcagtgaaggtttcctgcaagacttctggatacaccttcacttggtatgctatacattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggcagtggaaacacaaaatattcacagaaatttcagggcagagtcacccttaccagggacacatccgcgagcacagcgtacatggagctgagcagcctgagatctgatgacacggctgtgtattactgtgcgagacccaataactatggttcgggtggggatgtttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 693]
Аминокислотная последовательность

Таблица 128

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgagtgcttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaagtttcctgcaaggcttctggatacaccttcacgaactatgctctgcattgggtgcgccaggcccccggacaagggcttgagtggatggcatggatcaacggtggcaatggtaacacaaaatattcacagaacttccagggcagagtcaccattaccagggacacatccgcgagcacagcctatatggagctgagcagcctgagatctgaagacacggctgtgtattactgtgcgaaaccggaggaaacagctggaacaatccactttgactactggggccagggaaccccggtcaccgtctcctca [SEQ ID NO: 695]
Аминокислотная последовательность

Таблица 129

Последовательность ДНК
caggctgtgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcaccatcacggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgggggagggttactatgatagtagtggttattccaacggtgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 697]
Аминокислотная последовательность

Таблица 130

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatgtggtattcggcggagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatgaaatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagtggtagtaccatatactacgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtttattactgtgcacgctgggactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 699]
Аминокислотная последовательность

Таблица 131

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtccgtgtccccaggacagacagccagcatcacctgctctggagatagattgacgaataaatatgtttcctggtatcaacagaagccaggccagtcccctgtgttggtcatctatgaggatgccaagcggccctcagggatccctgcgcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctatggatgagtctgaatattactgtcaggcgtgggacagcagtgtggtggtttttggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggatttacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagtataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagatgaggacacggccttgtattactgtgcaaaagaccgaggggggggagttatcgttaaggatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 701]
Аминокислотная последовательность

Таблица 132

Последовательность ДНК
tcctatgagctgactcagccacccgcagcgtctgggacccccggacagagagtcaccatctcttgttctgggggcgtctccaacatcgggagtggtgctctaaattggtaccagcaactcccaggaacggcccccaaactcctcatctatagttacaatcagcggccctcaggggtctctgaccgattctctggctccaggtctgccacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcaacctgggatgatagtgtgaatggttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctggagctgaggtgaagaagcctggggattcagtgaaggtctcctgcaagccttctggttacaattttctcaactatggtatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggattagcacttacaccggtaacacaaactatgcacagaagctgcagggcagagtcaccttcaccacagacacatccacgagcacagcctacatggagatgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgccagcagggtggtggttggtacgatgtttggggtcaaggtactctggtcaccgtctcctca [SEQ ID NO: 703]
Аминокислотная последовательность

Таблица 133

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggagagaaggtcaccatctcctgctctggaagcaacttcaatgttggaaataatgatgtatcctggtatcagcaactcccaggtgcagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctggacatcaccgggctccacagtgacgacgaggccgattattactgcggaacatgggatagcagcctgaatactgggggggtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatactatcagctgggtacgacaggcccctggacaagggcttgagtggatgggatggatcagcacttacaatggtctcacaaactatgcacagaacctccagggcagagtcaccatgactacagacacattcacgaccacagcctacatggagctgaggagcctcagatctgacgacacggccgtgtattactgtgtgagagaggggtcccccgactacggtgacttcgcgtcctttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 705]
Аминокислотная последовательность

Таблица 134

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctgcgcccccgggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagttcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggatttctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcgccggactccagactggggacgaggccgattattactgcggaacatgggataccagcctgagtggtttttatgtcttcggaagtgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatactatcagctgggtacgacaggcccctggacaagggcttgagtggatgggatggatcagcacttacaatggtctcacaaactatgcacagaacctccagggcagagtcaccatgactacagacacattcacgaccacagcctacatggagctgaggagcctcagatctgacgacacggccgtgtattactgtgtgagagaggggtcccccgactacggtgacttcgcgtcctttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 707]
Аминокислотная последовательность

Таблица 135

Последовательность ДНК
ctgcctgtgctgactcagccaccctcagcgtctgcgacccccgggcagagggtcaccatctcttgttctggaaccacctccaacatcggaagtaatactgtacactggtaccagcagctcccagggacggcccccaaactcctcatctataataataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctacatattcctgtgcaacatgggatgacagcctgagtggtgtggtcttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagatcccgcctacggtgactacgagtatgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 709]
Аминокислотная последовательность

Таблица 136

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaactaatggtgtaaactggttccagcagttcccaggaacggcccccaaactcctcatctatactaatgatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgcggatgaggctgattattactgtgcagtgtgggaccacagcctgaatggtccggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaggggccggttttgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 711]
Аминокислотная последовательность

Таблица 137

Последовательность ДНК
caggctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgagactgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagaggggctagatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 713]
Аминокислотная последовательность

Таблица 138

Последовательность ДНК
caggctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatgtatagtaatgatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattattgtgcagcatgggatgacagcctgaatggttatgtcttcgcagctgggacccagctcaccgttttaagttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagaggggctagatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 715]
Аминокислотная последовательность

Таблица 139

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcactggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgagtgctgcttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagctttaccagctatactatcagctgggttcgacaggcccctggacaaggccttgagtggatgggatgggtcagcacttacaatggtctcagaaactatgcacagaacctccagggcagagtcaccatgactacagacacactcacgaccacagcctacatggagctgaggagcctcagatctgacgacacggccgtgtattattgtgtgagagaggggtcccccgactacggtgacttcgcggcctttgactactggggccagggcaccctggtcaccgtctcctca [SEQ ID NO: 717]
Аминокислотная последовательность

Таблица 140

Последовательность ДНК
caggctgtgctgactcagccaccctcagcgtctgagacccccgggcagagggtcaccatctcttgttctggaagcaggtccaacatcggaactaatattgtacactggtaccagcagcgcccaggaatggcccccaaactcctcacttatggtagtcggcggccctcaggggtcccggaccgattctctggctccaagtttggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattattgtgcagcatgggatgacagtctgaatggtccggctttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagacggtgggggctactttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 719]
Аминокислотная последовательность

Таблица 141

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaatatcggggcacgttatgatgtacactggtaccagcaactcccaggaacagccccccgactcctcatctctgctaactacgatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagtgtgagtgcttgggtgttcggcggagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaagtgcagctggtgcagtctggggctgaagtgaaggagcctggggcctcagtgaggatctcctgccaggcatctggatacaacttcatcagttattatatgcactgggtgcggcaggcccctgggcaaggtcttgagtggatgggcaccatcaacccaggcagtggtgagacagactactcacagaagttgcagggcagagtcaccatgaccagggacccgtccacgggtacattcgacatggggctgagcagcctgacatctggggacacggccgtctattattgtgcgacaggtctcatcagaggagctagcgatgcttttaatatctggggccgggggacaatggtcaccgtctcttca [SEQ ID NO: 721]
Аминокислотная последовательность

Таблица 142

Последовательность ДНК
cagcctgtgctgactcagccaccctcagtgtccgtgtccccaggacagacggccgccatcccctgttctggagataagttgggggataaatttgcttcctggtatcagcagaagccaggccagtcccctgtgctggtcatctatcaagatactaagcggccctcagggatccctgagcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctatggatgaggctgactattactgtcagacgtgggccagcggcattgtggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtacagctgcagcagtcaggtccaggactggtgaagccctcgcagaccctctcactcacctgtgccatctccggggacagtgtctctagcaacagtgctgcttggaactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtccaagtggtataatgattatgcagtatctgtgaaaagtcgaataaccatcaacccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcaagagagcgcagtggctggaagggatttgactactggggccagggaaccctggtcaccgtctcctca [SEQ ID NO: 723]
Аминокислотная последовательность

Таблица 143

Последовательность ДНК
gatgttgtgatgactcagtctccaccctccctgtccgtcacccctggagagccggcctccatcacctgcaggtctagtcagagcctcctggaaagaaatgcatacaactacttggattggtacctgcagaggccaggacagtctccacagctcctgatctacttgggttctaatcgggccgccggggtccctgacaggttcagtggcagtggatcaggcagagattttacactgaaaatcagcagagtggagcctgaggatgttggggtttattactgcatgcaagctctacaagctccgttcactttcggcggagggaccaaggtggagatcaaacgttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaagtgcagctggtgcagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtggtggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaatggggcccgtttcaggatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 725]
Аминокислотная последовательность

Таблица 144

Последовательность ДНК
caggctgtgctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactatgtctcctggtaccaacagcacccgggcaaagcccccaaactcatgatttatgaggtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcaccccttatgtcttcggagcagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagccaggtggacagcagtggcatcagaccaccactttgactactggggccagggaacgctggtcaccgtctcctca [SEQ ID NO: 727]
Аминокислотная последовательность

Таблица 145

Последовательность ДНК
caggctgtgcttactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagattgggactacatggacgtctggggcaaagggaccacggtcaccgtctcctca [SEQ ID NO: 729]
Аминокислотная последовательность

Таблица 146

Последовательность ДНК
tcctatgagctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagacctatctcggggagctaacccgcattactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 731]
Аминокислотная последовательность

Таблица 147

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccgtctcctgcactgggagcagatccaacatcggggcaggatatgatgtacactggtaccagcaacttccaggaacagcccccaaactcctcatctatggaaatagtaatcggcctccaggggtccctgaccgattctctgggtctaagtctggcacctcagcctccctggtcatcactgggctccaggctgaggatgccgctgattattactgccagtcctatgacaacactgtgcgtgaatcaccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtacagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcaacagagagtaatttagtgtcccggcactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 733]
Аминокислотная последовательность

Таблица 148

Последовательность ДНК
ctgcctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaaccagctccaacatcggaagtaattctgtagactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgaatctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaagtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttcaccggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaacagtggtggcacaaactatgcacagaagtttcagggcagggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagagattacggatactatggttcggggagttattcgagcggccccctttactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 735]
Аминокислотная последовательность

Таблица 149

Последовательность ДНК
caggctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatgtataataatgatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctcaatggttatgtcttcggacctgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtggagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagagacctatctcggggagctaacccgcattactactactactacggtatggacgtctggggccaagggaccacggtcaccgtctcctca [SEQ ID NO: 737]
Аминокислотная последовательность

Таблица 150

Последовательность ДНК
aattttatgctgactcagccccacgctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagtattgccagcaactatgtgcagtggtaccagcagcgcccgggcagttccccccgcactgtgatttatgaggataatcaaagaccctctggggtccctggtcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgattccaccagtgtgcttttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagccagggtcctcggtgaaggtctcctgcaaggcctcgggaggcaccttcagcagcaattctctcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcttccctatcctgggtataacaaactatgcacagaagttccagggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtctattactgtgcgagaggaaactaccaatggtatgatgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 739]
Аминокислотная последовательность

Таблица 151

Последовательность ДНК
cagcctgtgctgactcagccaccctcagtgtcagtggtcccaggaaagacggccaggattacctgtgggggaaaaaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtggtggtcatccattatgatagtgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccaactatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacataagctccagggcagagtcaccatgaccacagacacatccacgagcacagccaacatggagctgaggagcctgagacctgacgacactgccgtgtattactgtgcgcgctcttacttcggttctcatgattactggggtcaaggtactctggtgaccgtctcctca [SEQ ID NO: 741]
Аминокислотная последовательность

Таблица 152

Последовательность ДНК
tcctatgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggatttcctgtgggggaaacgacattggaagtaaaagtgttttctggtatcagcagaggccaggccaggcccctgtgttggtcgtctatgatgatagcgaccggccctcagggctccctgagcgattctctggcttcaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaagtgtgggatagtagtagtgatcattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtggagtctgggggaggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagtggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagatataacctatggttcggggagttatggtgcttttgatatctggggccaagggacaatggtcaccgtctcttca [SEQ ID NO: 743]
Аминокислотная последовательность

XII. Иллюстративные внеклеточные антигенсвязывающие домены (например, scFv), содержащие вариабельную область тяжелой цепи, вариабельную область легкой цепи, пептидный линкер, а также His-метку и HA-метку

Таблица 153

Последовательность ДНК
cagtctgtgttgacgcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaatactgtaaactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcagcatgggatgacagcctgaatggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtgtatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcgaaggtccgtacgacggtttcgattcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 745]
Аминокислотная последовательность

Таблица 154

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattctgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggcactgaggtgaagaagcctggggcctcagtgagggtcgcctgcaaggcttctggttacccctttaacaaatatgacatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggaggcatcatccctatctttcgtacaacaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtatattactgtgcgcgcgaatggttctactgggatatctggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 747]
Аминокислотная последовательность

Таблица 155

Последовательность ДНК
cagtctgtgttgactcagccaccctcagtgtccgtgtccccaggacagacagccagcatctcctgctctggaaataaattggggactaagtatgtttactggtatcagaagaggccaggccagtcccctgtgttggtcatgtatgaagataatcagcggccctcagggatcccggagcggttctctggctccaactctgggaacacagccactctgaccatcagagggacccagactgtggatgaggctgactattactgtcaggcgtgggactccgacactttcgtggtcttcggcggagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagaccgggggaggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttcagtagttatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcacatgatggaagtaataaatactacgcagactccgtgaagggccgattcaccatctccagagacaattccaaggacacgctgtatctgcaaatgaacagcctgagaggtgaggacacggccgtatattactgtgcgcgctctaaccagtggtctggttacttctctttcgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 749]
Аминокислотная последовательность

Таблица 156

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtggtggtcatccattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccacctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacacttacaatggtcacacaaactatgcacagaagctccagggcagagccacaatgaccgcagacacatccacgaacacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgcgttatctacggttctggtgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 751]
Аминокислотная последовательность

Таблица 157

Последовательность ДНК
tcctatgtgctgactcagccactctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaactgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatcgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctgcaggagtcgggcccaggactggtgaagccttcggagaccctgtccctcacctgcaatgtctctggttactccatcagcagtggttacttttggggctggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagtaggagcacctactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgaactctgtgaccgccgcagacacggccgtgtattactgtgcgcgcggttacggttacttcgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 753]
Аминокислотная последовательность

Таблица 158

Последовательность ДНК
caatctgccctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactatgtctcctggtaccaacaacacccaggcaaagcccccaaactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcacttcgaaggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctgggggaggtgtggtacggcctggggggtccctgagactctcctgtgcagcctctggattcacctttggtgattatggcatgagctgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaatggtggtagcacaggttatgcagactctgtgaagggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggccgtatattactgtgcgcgctctaaatacaacttccatgtttactacgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 755]
Аминокислотная последовательность

Таблица 159

Последовательность ДНК
cagtctgtgttgacgcagccaccctcagcgtctgggacccccgggcagacagtcaccatctcttgttctggaagcaactccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcctcatctataggaataatcagcggccctcaggggtccctgaccgattctcaggctccaagtctggcacctcagcctccctggccatcagtgggctccgctccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtgcttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgctcttctggtaacatggtttcttggaaagatatgtggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 757]
Аминокислотная последовательность

Таблица 160

Последовательность ДНК
caatctgccctgactcagcctgcctccgtgtctgggtctcctggacagtcgatcaccatctcctgcactggaaccagcagtgacgttggtggttataactctgtctcctggtaccaacaacacccaggcaaagcccccagactcatgatttatgatgtcagtaatcggccctcaggggtttctaatcgcttctctggctccaagtctggcaacacggcctccctgaccatctctgggctccaggctgaggacgaggctgattattactgcagctcatatacaagcagcagcacccctttagtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcggtgctgttgcttaccatgattggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 759]
Аминокислотная последовательность

Таблица 161

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagagggtcaccatctcctgctctggaagcagctccaacatttcgatttatgatgtatcctggtatcagcagctcccaggaacagcccccaaactcctcatttatggcaataataagcgaccctcggggattgctgaccgattctctggctccacgtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatgacagtctgagtgggggggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcgaggcttctggaggcaccctcagcagctatgctatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatgtttggtacagcacactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgaaaacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtgttcattacgcttctttcgatcattggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 761]
Аминокислотная последовательность

Таблица 162

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctgcggccgcaggacagaaggtcaccatctcctgctctggaagcgactccaacattgggaataattatgtgtcctggtatcaacacctcccagggacagcccccaaactcctcatttatgacgttaaaaatcgaccctcagggattcctgaccggttctccggctccaagtctggctcgtcagccaccctaggcatcgccggactccagcctggggacgaggccgattattactgcggaacatgggacagtcggctggatgcctatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcaatctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaagacttctggtttcccctttaatatctttggaatcacctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcggttacaacggtaacacagactacccacagaagttccagggcagagtcaccatgtccacagacacatccacgagtacagcctacatggagctgaggaacctgaaatctgacgacacggccgtgtattactgtgcgcgcggtgcttacggtggtatggatacttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 763]
Аминокислотная последовательность

Таблица 163

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcacctccaacatcggggcaggttatgatgtacactggtatcagcagcttccaggaacagcccccaaactcctcatctatactaacaactttcggccctcaggggtccctgaccgattctctgcctccaagtctggcacttcagcttccctggccatcactggtctccaggctgaggatgaggctgattattactgcggaacatgggatagcagcctgagtgccgttgtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagtctggaactgaggtgaagaagcctggggcctcagtgaaagtctcctgcaaggcttctggttacatgtttaccagttatggtctcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgctaacaatggtaagacaaattatgctaagaaattccaggacagagtcaccatgaccagagacacttccacgagcacaggctacatggaactgaggagcctgagatctgacgacacggccgtatattactgtgcgcgccatatcggtggttcttacttcgatcgttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 765]
Аминокислотная последовательность

Таблица 164

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagactgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtgatggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagacgaggacacggccgtatattactgtgcgcgctctcatgaagctaacctggttggtgattggtggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 767]
Аминокислотная последовательность

Таблица 165

Последовательность ДНК
cagtctgtggtgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtacagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgctggggtggtttcggtgctgttgatcattggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 769]
Аминокислотная последовательность

Таблица 166

Последовательность ДНК
tcttctgagctgactcaggaccctgctgtgtctgtggccttgggacagacagtcaagatcacgtgccaaggagacagcctcacagactaccatgcaacctggtaccagcagaagccaggacaggcccctgtcgctgtcatctatgctacaaacaaccggcccactgggatcccagaccgattctctggttccagttccggaaacacagcttctttgaccatcactggggctcaggcggaagatgaggctgactattactgtaattcccgggacagcggcacggacgaagtgttattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagactgggggaggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttcagtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagtagtagttacatatactacgcagactcagtgaagggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgcgcggtcagggttacgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 771]
Аминокислотная последовательность

Таблица 167

Последовательность ДНК
Tcctatgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcgtctatgatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgagcatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatactgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgctactacccgggtatggatatgtggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 773]
Аминокислотная последовательность

Таблица 168

Последовательность ДНК
Caggctgtgctgactcagccgccctcaacgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcgggagaaatggtgtaaactggtaccagcagctcccaggagcggcccccaaagtcctcatctataatgataatcagcgaccctcaggggtccctgaccgagtctctggctcccagtctggctcctcaggcaccctggccatcgatgggcttcggtctgaggatgaggctgattattactgtgcggcatgggatgacagcctgcatggtgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcaatgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtggttacggtgattcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 775]
Аминокислотная последовательность

Таблица 169

Последовательность ДНК
Aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattcttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcaatctggggctgaggtgaagaggcctgggtcctcggtgaaggtctcctgcacggcttctggaggcaccttcagcagcgatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaggaatcatccctatgtttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcgaaggttactactacccgtctgcttacctgggttctgttctgaacgacatctcttctgtttacgatgaatggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 777]
Аминокислотная последовательность

Таблица 170

Последовательность ДНК
Cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcacctccaacattggaaataatgatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcgtgagtgcttcttgggtcttcggcagagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatccacagaagctccagggcagagtcaccatgaccacagacccatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgctctatgacttctttcgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 779]
Аминокислотная последовательность

Таблица 171

Последовательность ДНК
Cagtctgtgttgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcaactccaacattgggaataattatgtatcctggtatcagcaactcccagggacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaggtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatggaataccactgtgactcctggctatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaagtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacaccgccatgtattactgtgcgcgctctgtttacgacctggatacttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 781]
Аминокислотная последовательность

Таблица 172

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctgcggccccaggacagaaggtcaccatctcctgctctggaagcagctccaacattgggaataattatgtatcctggtaccagcagctcccaggaacagcccccaaactcctcatttatgacaataataagcgaccctcagggattcctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatagcagcctgggggccccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtcttggggaggctcggaacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctttgatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaatagcggtagcataggctatgcggactctgtgaagggccgattcaccatctccagagacaacgccaagaattccctgtatctgcaaatgaacagtctgagagctgaggacaccgccatgtattactgtgcgcgctaccgtcaggttggttctgcttacgattcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 783]
Аминокислотная последовательность

Таблица 173

Последовательность ДНК
ctgcctgtgctgactcagccaccctcggtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtatcagcagaagccaggccaggcccctgtgctggtcgtctatgctgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagttatcataattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgagcagcctgagatctgaggacaccgccatgtattactgtgcgcgctactggggtttcggtgtttctgatcgttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 785]
Аминокислотная последовательность

Таблица 174

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccccgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgacagcagcaatctttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctacaactactactactacgattcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 787]
Аминокислотная последовательность

Таблица 175

Последовательность ДНК
gacatccagatgacccagtctccatcctccctgtctgcatctgtaggagacagagtcaccatcacttgccgggcaagtcagagcattagcagctatttaaattggtatcagcagaaaccagggaaagcccctaagctcctgatctatgctgcatccagtttgcaaagtggggtcccatcaaggttcagtggcagtggatctgggacagatttcactctcaccatcagcagtctgcaacctgaagattttgcaacttactactgtcaacagagttacagtaccccattcactttcggccctgggaccaaagtggatatcaaacgttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacaccgccatgtattactgtgcgcgctactggggttacgactcttacgatgaatggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 789]
Аминокислотная последовательность

Таблица 176

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcaacaaccattactacaacgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 791]
Аминокислотная последовательность

Таблица 177

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagggggtcaccatcccctgcactgggagcagctccaacatcggggcaggttatgatgtacactggtaccagcagcttccagggacagcccccaaactcctcatctatggtaacaacaatcggccctcaggggtccctgaccgcttctctggctccaggtctggctcctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtgatgtggtattcggcggagggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttcaccgactactacatgcactgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaagatggtgaaacaatatacgcagagaagttccagggcagagtcaccataaccgcggacacgtctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgctactggtcttactctttcgactacctgtacatgccggaaggtaacgattggtggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 793]
Аминокислотная последовательность

Таблица 178

Последовательность ДНК
cagtctgtgttgactcagccacccgcagcgtctgggacccccggacagagagtcaccatctcttgttctgggggcgtctccaacatcgggagtggtgctctaaattggtaccagcaactcccaggaacggcccccaaactcctcatctatagttacaatcagcggccctcaggggtctctgaccgattctctggctccaggtctgccacctcagcctccctggccatcagtgggctccagtctgaggatgaggctgattattactgtgcaacctgggatgatagtgtgaatggttgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtacagtctggagctgaggtgaagaagcctggggattcagtgaaggtctcctgcaagccttctggttacaattttctcaactatggtatcaactgggtgcgacaggcccctggacaagggcttgagtggatgggatggattagcacttacaccggtaacacaaactatgcacagaagctgcagggcagagtcaccttcaccacagacacatccacgagcacagcctacatggagatgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcgacctgtactactacgaaggtgttgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 795]
Аминокислотная последовательность

Таблица 179

Последовательность ДНК
caggctgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccagggttacctgtgggggaaacaacattggaagtgaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgttggtcatctattatgataccgaccggccctcagggatccctgagcgattctctggctcccactctgggaccacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagggatcatgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctgggggaggcgtggtccagcctgggaggtccctgagactctcctgtgcggcctctggattcaccttcagtagctatgctatgcactgggtccgccaggctccaggcaagggactggagtgggtggcagttatatcatatgatggaagcaataaatactacgcagactccgtgaagggcctattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggccgtgtattactgtgcgcgctcttacttcacttctggtttctacgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 797]
Аминокислотная последовательность

Таблица 180

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagttccaacatcggggcaggttatgatgtaaattggtatcagcagtttccaggaacagcccccaaactcctcatctatggtaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggctcttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcatgtcttctatgtactacgattggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 799]
Аминокислотная последовательность

Таблица 181

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgattatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtggagactgggggaggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccgtcagtgactactacatgagctggatccgccaggctccagggaagggcctggagtggatttcatacattagtggtagtggtaatagcatatactacgcagactctgtgaagggccgattcaccatctccagggacaacgccaagaactcactggatctgcaaatgaccagcctgagagccgaggacacggccgtatattactgtgcgcgctctactaaattcgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 801]
Аминокислотная последовательность

Таблица 182

Последовательность ДНК
ctgcctgtgctgactcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacgtcggaagttacactgtaaactggtaccggcaactcccaggaacggcccccacactcctcatctataataataatcagcggccctcaggggtccctgaccgattctctgactccaagtctggcacctcggcctccctgaccattagtgggctccagcctgaggatgaggctgattattattgtgcagcatgggatgacaggctgggtggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtgcagctggtgcagtctggagcagaggtgaaaaagccgggggagtctctgaagatctcctgtaagggttctggatacagctttaccaactactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggtgactctgataccagatacagcccgtccttccaaggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctacagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgcgctctactggttcttctcatatgtctgatgaatggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 803]
Аминокислотная последовательность

Таблица 183

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaatcattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaagtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggagatcactcatagtggaaggtccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgctcttctatcatgtctgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 805]
Аминокислотная последовательность

Таблица 184

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcacctccaacatcggggcaggttatgatgtacactggtaccagcagcttccaggaacagcccccaaactcctcatcaacaataacaggaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacgtcagccaccctgggcatcaccggactccagactggggacgaggccgattattactgcggaacatgggatggcagcctgactggtgcagtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcatgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgcggttctgctctggaccattacgatcgttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 807]
Аминокислотная последовательность

Таблица 185

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagtgcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcaccaattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctacaactactacttcaacgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 809]
Аминокислотная последовательность

Таблица 186

Последовательность ДНК
tcctatgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccaggattacctgtgggggaaacaacattggaagtaaaagtgtgcactggtaccagcagaagccaggccaggcccctgtgctggtcatctattatgatagcgaccggccctcagggatccctgagcgattctctggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggatagtagtagtgatcatccttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccagatgcagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacactgccgtgtattactgtgcgcgctctatgttcggtgctcatgattcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 811]
Аминокислотная последовательность

Таблица 187

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaacatcggggcaggttttgatgtacactggtaccagctacttccaggaacagcccccaaactcctcatctatgctaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctcctggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggtgtggtattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcaatctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgcggtgcttctttcgaccgtcatgataactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 813]
Аминокислотная последовательность

Таблица 188

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcacccgcagcagtggcagcattgccagcaactatgtgcagtggtaccagcagcgcccgggcagttcccccaccactgtgatctatgaggataaccaaagaccctctggggtccctgatcggttctctggctccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgatagcagcaattgggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatctttggtacagcaaactacgcacagaagttccagggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgcgctctaactactactacaacgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 815]
Аминокислотная последовательность

Таблица 189

Последовательность ДНК
cagtctgtgttgacgcagccgccctcagtgtctggggccccagggcagagggtcaccatctcctgcactgggagcagctccaacatcggggcaggttatgatgtacactggtaccagcagcttccaggaacagcccccaaactcctcatctatggtaacagcaatcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcactgggctccaggctgaggatgaggctgattattactgccagtcctatgacagcagcctgagtggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtgcagtctggggctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctcactgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaagatggtgaaacaatctacgcacagaagttccagggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacactgccgtgtattactgtgcgcgctactctggtgtttactacgattggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 817]
Аминокислотная последовательность

Таблица 190

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggggtctccggggaagacggtaaccatctcctgcaccggcagcagtggcagcattgccgacaactttgtgcagtggtaccagcagcgcccgggcggtgtccccaccactgtgatctttaatgatgacgaaagaccctctggcgtccctgatcggttctctggctccatcgacacctcctccaattctgcctccctcaccatctctggactgaagactgaggacgaggctgactactactgtcagtcttatgataataataatcgaggggtgttcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtccagctggtgcagtctggggctgaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttcagcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatgaaccctaacagtggtaacacaggctatgcacagaagttccagggcagagtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcaacctgagatctgaggacacggccgtgtattactgtgcgcgctactactcttacggttacgattggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 819]
Аминокислотная последовательность

Таблица 191

Последовательность ДНК
cagtctgtcgtgacgcagccgccctcagtgtctggggccccagggcagacggtcaccatctcctgcactgggggcagctccaacatcgggacaggttattttgtaaattggtaccagcaggttccaggaaaagcccccaaactcctcatcctgggtaacaataatcggccctcgggggtccctgaccgactctccggctccacgtccggcacctcagcctccctggccatcactgggctccaggctgaggatgagggtacttattactgccagtcctatgacagcagcctgagtggttatgtcttcggaactgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtacagctgcagcagtcaggtccaggactggtgaagccctcgcagaccctctcactcacctgtggcatctccggggacagtgtctctaccaacagtgttgcttggcactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtccaagtggtctaatgactatggagtatctgtgaaaagtcgaatcaccatcatcccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcgcgctcttcttcttggtaccagatcttcgattactggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 821]
Аминокислотная последовательность

Таблица 192

Последовательность ДНК
aattttatgctgactcagccccactctgtgtcggagtctccggggaagacggtaaccatctcctgcaccggcagcagcgacagcatagccaacaactatgttcagtggtaccagcagcgcccgggcagtgcccccaccaatgtgatctacgaagatgtccaaagaccctctggggtccctgatcggttctctgggtccatcgacagctcctccaactctgcctccctcaccatctctggactgaagactgaggacgaggctgtctactattgtcagtcttatcatagcgacaatcgttgggtgttcggcggcgggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctggtggagtctgggggaggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcacctttagcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagtggtggtagcacatactacgcagactccgtgaagggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgcgctctggtgcttactgggactactctgtttacgatgaatggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 823]
Аминокислотная последовательность

Таблица 193

Последовательность ДНК
cagtctgtgttgactcagccaccctcagtgtccgtgtccccaggacagacagccaccatcgcctgttctggacataaattgggggataaatatgcttcctggtatcagcagaagtcgggccagtcccctgtgttgatcatctatcaggataataagcggccctcagggattcctgagcgattctctggctccaactctgggaacacagccactctgaccatcagcgggacccaggctctggatgaggctgactattattgtcaggcgtgggacagtagtacttatgtggcattcggcggagggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctgcaggagtccggcccaggactggtgaagccttcggagaccctgtccctcacctgcgttgtctctggtggctccatcagcagtagtaactggtggagctgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagtgggagccccaactacaacccatccctcaagagtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcatgactactcatactttcggttacgatgcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 825]
Аминокислотная последовательность

Таблица 194

Последовательность ДНК
cagcctgtgctgactcagccaccctcagtgtcagtggccccaggaaagacggccacgattacttgtgggggaaacaacattggaagtgaaagtgtgcactggtaccaccagaagccaggccaggcccctgtgttggtcatctatgatgatgccggccggccctcagggatccctgagcgattcactggctccaactctgggaacacggccaccctgaccatcagcagggtcgaagccggggatgaggccgactattactgtcaggtgtgggacagaaatagtgctcagtttgtcttcggacctgggaccaaggtcaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggccgaggtccagctggtgcagtctggagctgaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacacctttaccagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttacaatggtaacacaaactatgcacagaagctccagggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgcgcggtgttcatctggattggtggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 827]
Аминокислотная последовательность

Таблица 195

Последовательность ДНК
cagtctgtcgtgacgcagccaccctcagcgtctgggacccccgggcagagggtcaccatctcttgttctggaagcagctccaacatcggaagtaattatgtatactggtaccagcagctcccaggaacggcccccaaactcctcatctatagtaataatcagcggccctcaggggtccctgaccgattctctggctccaagtctggcacctcagcctccctggccatcagtgggctccggtccgaggatgaggctgattattactgtgcagcatgggatgacagcctgagtggttatgtcttcggaactgggaccaagctgaccgtcctaggttctagaggtggtggtggtagcggcggcggcggctctggtggtggtggatccctcgagatggcccaggtgcagctacagcagtggggcgcaggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttcagtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagtggaagcaccaactacaacccgtccctcaagagtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgcgcctgtacgaaggtggttaccatggttggggttcttggctgtcttctgattcttggggtcaaggtactctggtgaccgtctcctcaactagtggccaggccggccagcaccatcaccatcaccatggcgcatacccgtacgacgttccggactacgcttct [SEQ ID NO: 829]
Аминокислотная последовательность

Таблица 196

Последовательность ДНК