Способы и композиции для получения или поддержания плюрипотентных клеток



C12N2509/00 - Микроорганизмы или ферменты; их композиции (биоциды, репелленты или аттрактанты или регуляторы роста растений, содержащие микроорганизмы, вирусы, микробные грибки, ферменты, агенты брожения или вещества, получаемые или экстрагируемые из микроорганизмов или из материала животного происхождения A01N 63/00; пищевые составы A21,A23; лекарственные препараты A61K; химические аспекты или использование материалов для бандажей, перевязочных средств, впитывающих подкладок или хирургических приспособлений A61L; удобрения C05); размножение, консервирование или сохранение микроорганизмов (консервирование живых тканей или органов людей или животных A01N 1/02); мутации или генная инженерия; питательные среды (среды для микробиологических испытаний C12Q)

Владельцы патента RU 2706965:

РЕГЕНЕРОН ФАРМАСЬЮТИКАЛЗ, ИНК. (US)

Изобретение относится к области биотехнологии, а именно к получению популяции человеческих индуцированных плюрипотентных стволовых клеток (hiPSC), поддержанию hiPSC, модификации целевого геномного локуса в hiPSC и композиции для культивирования и поддержания hiPSC. Способ включает культивирование in vitro популяции фибробластов, трансформированных для экспрессии плюрипотентного состояния, в среде с низкой осмоляльностью от 200 мОсм/кг до 250 мОсм/кг, содержащей основную среду и полипептид, являющийся фактором, ингибирующим лейкемию (LIF), ингибитор гликоген-синтазы-киназы 3 (GSK3) и ингибитор MEK. Модификацию целевого геномного локуса в hiPSC осуществляют путем введения в hiPSC нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым сайтам в целевом геномном локусе или внедрения в hiPSC нуклеазного агента, который создает один или более одноцепочечных или двухцепочечных разрывов в сайте распознавания в целевом геномном локусе для создания модификации целевого геномного локуса и идентификации генетически модифицированной hiPSC, содержащей в своем геноме полинуклеотидную вставку, встроенную в целевой геномный локус. Изобретение позволяет расширить арсенал технических средств. 5 н. и 33 з.п. ф-лы, 6 табл., 6 ил., 5 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА СМЕЖНЫЕ ЗАЯВКИ

Данная заявка испрашивает преимущество заявки на патент США №62/064,384, поданной 15 октября 2014 г., которая полностью включена в настоящий документ путем ссылки.

ССЫЛКА НА СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ, ПОДАННЫЙ В ВИДЕ ТЕКСТОВОГО ФАЙЛА ЧЕРЕЗ СЕТЬ EFS-WEB

Официальная копия списка последовательностей представлена в электронном виде через EFS-Web в виде файла со списком последовательностей в формате ASCII с наименованием 469587SEQLIST.TXT, созданного 14 октября 2015 г., имеющего размер 757 байт и поданного одновременно со спецификацией. Список последовательностей, содержащийся в данном документе в формате ASCII, является частью спецификации и полностью включен в настоящий документ путем ссылки.

ПРЕДПОСЫЛКИ СОЗДАНИЯ ИЗОБРЕТЕНИЯ

Человеческие индуцированные плюрипотентные стволовые (ИПС) клетки могут проявлять интактное или праймированное состояние плюрипотентности (Nichols and Smith, Cell Stem Cell (2009) Vol. 4(6), pp. 487-492). Праймированные человеческие ИПС-клетки проявляют характеристики, сходные с характеристиками эпибластных клеток после имплантации, и являются коммитированными для спецификации и дифференцировки в конкретную линию. Напротив, интактные человеческие ИПС-клетки проявляют характеристики, сходные с характеристиками эмбриональных стволовых (ЭС) клеток внутренней клеточной массы эмбриона до имплантации. В некоторых отношениях интактные ИПС-клетки являются более плюрипотентными, чем праймированные клетки, поскольку они не коммитированы для спецификации в линию. Для поддержания человеческих ИПС-клеток в интактном или праймированном состоянии используют различные условия культивирования.

ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Предлагаются способы получения популяции человеческих индуцированных плюрипотентных стволовых клеток (hiPSC). Такие способы включают в себя культивирование in vitro популяции неплюрипотентных клеток, трансформированных для проявления плюрипотентного состояния, в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор MEK; причем среда имеет осмоляльность от приблизительно 175 мОсм/кг до приблизительно 280 мОсм/кг. Такие способы также включают в себя культивирование in vitro популяции неплюрипотентных клеток, трансформированных для проявления плюрипотентного состояния, в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор МЕК; причем основная среда имеет осмоляльность от приблизительно 180 мОсм/кг до приблизительно 250 мОсм/кг. Дополнительно предлагаются способы поддержания популяции hiPSC в культуре in vitro, включающие в себя культивирование популяции hiPSC в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор MEK; причем среда имеет осмоляльность от приблизительно 175 мОсм/кг до приблизительно 280 мОсм/кг. Такие способы также включают в себя культивирование популяции hiPSC в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор МЕК; причем основная среда имеет осмоляльность от приблизительно 180 мОсм/кг до приблизительно 250 мОсм/кг. В некоторых способах hiPSC включают в себя интактные или выглядящие интактными hiPSC. В некоторых способах hiPSC включают в себя интактноподобные hiPSC. В некоторых способах способ увеличивает популяцию интактных или выглядящих интактными hiPSC. В некоторых способах способ увеличивает популяцию интактноподобных hiPSC.

В некоторых способах трансформированные клетки экспрессируют репрограммирующие гены, включающие в себя Oct4, Sox2, Klf4, Мус или любую их комбинацию. В некоторых способах трансформированные клетки включают в себя праймированные клетки hiPSC.

В некоторых способах основная среда имеет осмоляльность приблизительно 200 мОсм/кг. В некоторых способах основная среда содержит NaCl в концентрации приблизительно 3 мг/мл, бикарбонат натрия в концентрации приблизительно 2,2 мг/мл и имеет осмоляльность приблизительно 200 мОсм/кг.

В некоторых способах основная среда содержит глюкозу в концентрации приблизительно 4,5 мг/мл.

В некоторых способах среда с низкой осмоляльностью имеет осмоляльность от приблизительно 200 мОсм/кг до приблизительно 250 мОсм/кг. В некоторых способах среда с низкой осмоляльностью имеет осмоляльность приблизительно 233 мОсм/кг. В некоторых способах добавки включают: (а) среду F-12; (b) добавку N2; (с) среду NEUROBASAL; (d) добавку В-27; (е) L-глютамин; (f) 2-меркаптоэтанол или (g) любую комбинацию (a)-(f).

В некоторых способах полипептид LIF представляет собой человеческий полипептид LIF (hLIF). В некоторых способах ингибитор GSK3 представляет собой CHIR99021. В некоторых способах ингибитор МЕК представляет собой PD0325901. В некоторых способах среда с низкой осмоляльностью содержит ингибиторы, состоящие по существу из ингибитора GSK3 и ингибитора МЕК.

В некоторых способах среда с низкой осмоляльностью содержит основную среду в концентрации приблизительно 24,75% (об/об), среду F-12 в концентрации приблизительно 24,75% (об/об), добавку N2 в концентрации приблизительно 0,5% (об/об), среду NEUROBASAL в концентрации приблизительно 49% (об/об), добавку В-27 в концентрации приблизительно 1% (об/об), L-глутамин в концентрации приблизительно 2 мМ, 2-меркаптоэтанол в концентрации приблизительно 0,1 мМ, hLIF в концентрации приблизительно 100 единиц/мл, CHIR99021 в концентрации приблизительно 3 мкМ и PD0325901 в концентрации приблизительно 0,5 мкМ. В некоторых способах среда с низкой осмоляльностью не содержит одного или более из: добавки bFGF, добавки TGF-β1, ингибитора JNK, ингибитора р38, ингибитора ROCK и ингибитора РКС. В некоторых способах среда с низкой осмоляльностью не содержит основного фактора роста фибробластов (bFGF).

В некоторых способах hiPSC или трансформированные клетки культивируют на MATRIGEL™, питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) или GELTREX™.

В некоторых способах hiPSC экспрессируют один или более маркеров плюрипотентности. В некоторых способах один или более маркеров плюрипотентности включают в себя NANOG, щелочную фосфатазу или их комбинацию. В некоторых способах hiPSC имеют нормальный кариотип.В некоторых способах hiPSC проявляют морфологию, характеризующуюся компактными куполообразными колониями.

В некоторых способах hiPSC можно ферментативным способом диссоциировать в суспензию одиночных клеток и пересеивать. В некоторых способах ферментативную диссоциацию выполняют с использованием трипсина. В некоторых способах ферментативную диссоциацию выполняют в отсутствие ингибитора Rho-ассоциированной протеинкиназы (ROCK). В некоторых способах пересеянные hiPSC продолжают экспрессировать один или более маркеров плюрипотентности. В некоторых способах пересеянные hiPSC сохраняют интактное или выглядящее интактным состояние и проявляют морфологию, характеризующуюся компактными куполообразными колониями. В некоторых способах пересеянные hiPSC сохраняют нормальный кариотип.

В некоторых способах hiPSC могут дифференцировать в клетки любого из зародышевых листков эндодермы, эктодермы или мезодермы.

В некоторых способах hiPSC имеют время удвоения от приблизительно 16 часов до приблизительно 24 часов.

В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до культивирования в среде с низкой осмоляльностью, причем среда с высокой осмоляльностью содержит bFGF. Необязательно, среда с высокой осмоляльностью имеет осмоляльность по меньшей мере приблизительно 290 мОсм/кг.

В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят характеристики интактного или выглядящего интактным состояния. В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью в течение периода приблизительно двух месяцев. В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят морфологию, характеризующуюся трехмерными скоплениями клеток. Дополнительно предлагаются hiPSC, полученные любым из вышеописанных способов. Дополнительно предлагаются способы модификации целевого геномного локуса в hiPSC, включающие: (а) введение в hiPSC нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым сайтам в целевом геномном локусе; и (b) идентификацию генетически модифицированной hiPSC, содержащей в своем геноме полинуклеотидную вставку, встроенную в целевой геномный локус; причем hiPSC культивируют в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор МЕК; причем среда имеет осмоляльность от приблизительно 175 мОсм/кг до приблизительно 280 мОсм/кг. Такие способы могут также включать: (а) введение в hiPSC нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым сайтам в целевом геномном локусе; и (b) идентификацию генетически модифицированной hiPSC, содержащей в своем геноме полинуклеотидную вставку, встроенную в целевой геномный локус; причем hiPSC культивируют в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор МЕК; причем основная среда имеет осмоляльность от приблизительно 180 мОсм/кг до приблизительно 250 мОсм/кг. В некоторых способах нацеливающий вектор представляет собой большой нацеливающий вектор (LTVEC), в котором общая суммарная длина 5'- и 3'-гомологичных плеч составляет по меньшей мере 10 т.п.н. В некоторых способах начальный этап (а) дополнительно включает в себя введение нуклеазного агента, стимулирующего гомологичную рекомбинацию между нацеливающим вектором и целевым геномным локусом в hiPSC. В некоторых способах нацеленная генетическая модификация содержит: (а) делецию эндогенной человеческой нуклеотидной последовательности; (b) вставку экзогенной нуклеотидной последовательности или (с) замену эндогенной человеческой нуклеотидной последовательности экзогенной нуклеотидной последовательностью. В некоторых способах экзогенная нуклеотидная последовательность содержит одно или более из следующего: (а) нуклеотидной последовательности, которая является гомологичной или ортологичной эндогенной человеческой нуклеотидной последовательности; (b) химерной нуклеотидной последовательности; (с) условного аллеля, фланкированного целевыми последовательностями сайт-специфичной рекомбиназы; и (d) репортерного гена, функционально связанного с промотором, активным в hiPSC.

Такие способы модификации целевого геномного локуса в hiPSC также могут включать в себя: (а) внедрение в hiPSC одного или более нуклеазных агентов, которые создают один или более одноцепочечных или двухцепочечных разрывов в сайте распознавания в целевом геномном локусе; и (b) идентификацию по меньшей мере одной клетки, содержащей в своем геноме модификацию целевого геномного локуса; причем hiPSC культивируют в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (iii) ингибитор МЕК; причем среда имеет осмоляльность от приблизительно 175 мОсм/кг до приблизительно 280 мОсм/кг. Такие способы могут также включать: (а) внедрение в hiPSC одного или более нуклеазных агентов, которые создают один или более одноцепочечных или двухцепочечных разрывов в сайте распознавания в целевом геномном локусе; и (b) идентификацию по меньшей мере одной клетки, содержащей в своем геноме модификацию целевого геномного локуса; причем hiPSC культивируют в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (iii) ингибитор МЕК; причем основная среда имеет осмоляльность от приблизительно 180 мОсм/кг до приблизительно 250 мОсм/кг. В любых таких способах модификации целевого геномного локуса в hiPSC клетки hiPSC можно ферментативно диссоциировать в суспензию одиночных клеток и пересеивать перед этапом (а). Необязательно, ферментативную диссоциацию выполняют с использованием трипсина. Необязательно, ферментативную диссоциацию выполняют в отсутствие ингибитора ROCK. В некоторых способах пересеянные hiPSC продолжают экспрессировать один или более маркеров плюрипотентности. В некоторых способах пересеянные hiPSC сохраняют интактное или выглядящее интактным состояние и проявляют морфологию, характеризующуюся компактными куполообразными колониями. В некоторых способах пересеянные hiPSC сохраняют нормальный кариотип.

В некоторых способах нуклеазный агент содержит нуклеазу с «цинковыми пальцами» (ZFN). В некоторых способах нуклеазный агент содержит эффекторную нуклеазу, подобную активатору транскрипции (TALEN). В некоторых способах нуклеазный агент содержит белок Cas, ассоциированный с короткими палиндромными повторами, регулярно расположенными группами (CRISPR), и гидовую РНК (гРНК), содержащую CRISPR РНК (крРНК), распознающую геномную целевую последовательность, и трансактивирующую CRISPR РНК (тракрРНК). Необязательно, белок Cas представляет собой Cas9.

В некоторых способах нацеленная генетическая модификация является двухаллельной. В некоторых способах hiPSC включают в себя интактные или выглядящие интактными hiPSC. В некоторых способах hiPSC включают в себя интактноподобные hiPSC. В некоторых способах hiPSC экспрессируют один или более маркеров плюрипотентности. Необязательно, маркеры плюрипотентности включают в себя NANOG, щелочную фосфатазу или их комбинацию. В некоторых способах hiPSC проявляют морфологию, характеризующуюся компактными куполообразными колониями. В некоторых способах hiPSC могут дифференцировать в клетки любого из зародышевых листков эндодермы, эктодермы или мезодермы. В некоторых способах hiPSC имеют время удвоения от приблизительно 16 часов до приблизительно 24 часов. В некоторых способах hiPSC имеют нормальный кариотип.

В некоторых способах hiPSC происходят от неплюрипотентных клеток, трансформированных для экспрессии плюрипотентного состояния. Необязательно, трансформированные клетки экспрессируют репрограммирующие гены, включающие в себя Oct4, Sox2, Klf4, Мус или любую их комбинацию. Необязательно, трансформированные клетки включают в себя праймированные клетки hiPSC. В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до культивирования в среде с низкой осмоляльностью, причем среда с высокой осмоляльностью содержит bFGF. Необязательно, среда с высокой осмоляльностью имеет осмоляльность по меньшей мере 290 мОсм/кг. В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят характеристики интактного или выглядящего интактным состояния. В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью в течение периода приблизительно двух месяцев. В некоторых способах трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят морфологию, характеризующуюся трехмерными скоплениями клеток. В некоторых способах основная среда имеет осмоляльность приблизительно 200 мОсм/кг. В некоторых способах основная среда содержит NaCl в концентрации приблизительно 3 мг/мл, бикарбонат натрия в концентрации приблизительно 2,2 мг/мл и имеет осмоляльность приблизительно 200 мОсм/кг.

В некоторых способах основная среда содержит глюкозу в концентрации приблизительно 4,5 мг/мл.

В некоторых способах среда с низкой осмоляльностью имеет осмоляльность от приблизительно 200 мОсм/кг до приблизительно 250 мОсм/кг. В некоторых способах среда с низкой осмоляльностью имеет осмоляльность приблизительно 233 мОсм/кг. В некоторых способах добавки включают: (i) среду F-12; (ii) добавку N2; (iii) среду NEUROBASAL; (iv) добавку В-27; (v) L-глутамин; (vi) 2-меркаптоэтанол или (vii) любую комбинацию (i)-(vi). В некоторых способах полипептид LIF представляет собой человеческий полипептид LIF (hLIF). В некоторых способах ингибитор GSK3 представляет собой CHIR99021. В некоторых способах ингибитор МЕК представляет собой PD0325901.

В некоторых способах среда с низкой осмоляльностью содержит ингибиторы, состоящие по существу из ингибитора гликоген-синтазы-киназы 3 (GSK3) и ингибитора МЕК.

В некоторых способах среда с низкой осмоляльностью содержит основную среду в концентрации приблизительно 24,75% (об/об), среду F-12 в концентрации приблизительно 24,75% (об/об), добавку N2 в концентрации приблизительно 0,5% (об/об), среду NEUROBASAL в концентрации приблизительно 49% (об/об), добавку В-27 в концентрации приблизительно 1% (об/об), L-глутамин в концентрации приблизительно 2 мМ, 2-меркаптоэтанол в концентрации приблизительно 0,1 мМ, hLIF в концентрации приблизительно 100 единиц/мл, CHIR99021 в концентрации приблизительно 3 мкМ и PD0325901 в концентрации приблизительно 0,5 мкМ. В некоторых способах среда с низкой осмоляльностью не содержит одного или более из следующего: добавки bFGF; добавки TGF-β1; ингибитора JNK; ингибитора р38; ингибитора ROCK и ингибитора РКС. В некоторых способах среда с низкой осмоляльностью не содержит добавки bFGF.

В некоторых способах клетки hiPSC культивируют на MATRIGEL, питающих клетках NuFF или GELTREX.

Дополнительно предлагаются модифицированные hiPSC, полученные любым из вышеописанных способов.

Дополнительно предлагаются культуры in vitro, содержащие: (а) популяцию клеток hiPSC; и (b) среду с низкой осмоляльностью, содержащую основную среду и добавки, причем среда с низкой осмоляльностью содержит: (i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (iii) ингибитор МЕК; причем среда имеет осмоляльность от приблизительно 175 мОсм/кг до приблизительно 280 мОсм/кг. Такие культуры in vitro также могут содержать (а) популяцию hiPSC; и (b) среду с низкой осмоляльностью, содержащую основную среду и добавки, причем среда с низкой осмоляльностью содержит: (i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (iii) ингибитор МЕК; причем основная среда имеет осмоляльность от приблизительно 180 мОсм/кг до приблизительно 250 мОсм/кг. Дополнительно предлагаются популяции hiPSC, которые получены или поддерживаются в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор МЕК; причем среда имеет осмоляльность от приблизительно 175 мОсм/кг до приблизительно 280 мОсм/кг. Такие популяции hiPSC также могут быть получены или могут поддерживаться в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем среда с низкой осмоляльностью содержит: (а) полипептид, являющийся фактором, ингибирующим лейкемию (LIF); (b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и (с) ингибитор МЕК; причем основная среда имеет осмоляльность от приблизительно 180 мОсм/кг до приблизительно 250 мОсм/кг.

В некоторых популяциях или культурах in vitro hiPSC содержат интактные или выглядящие интактными hiPSC. В некоторых популяциях или культурах in vitro hiPSC содержат интактноподобные hiPSC.

В некоторых популяциях или культурах in vitro hiPSC происходят от неплюрипотентных клеток, трансформированных для экспрессии плюрипотентного состояния. В некоторых популяциях или культурах in vitro трансформированные клетки экспрессируют репрограммирующие гены, включающие в себя Oct4, Sox2, Klf4, Мус или любую их комбинацию. В некоторых популяциях или культурах in vitro трансформированные клетки содержат праймированные клетки hiPSC. В некоторых популяциях или культурах in vitro основная среда имеет осмоляльность приблизительно 200 мОсм/кг. В некоторых популяциях или культурах in vitro основная среда содержит NaCl в концентрации приблизительно 3 мг/мл, бикарбонат натрия в концентрации приблизительно 2,2 мг/мл и имеет осмоляльность приблизительно 200 мОсм/кг.

В некоторых популяциях или культурах in vitro основная среда содержит глюкозу в концентрации приблизительно 4,5 мг/мл.

В некоторых популяциях или культурах in vitro среда с низкой осмоляльностью, содержащая основную среду и добавки, имеет осмоляльность от приблизительно 200 мОсм/кг до приблизительно 250 мОсм/кг. В некоторых популяциях или культурах in vitro среда с низкой осмоляльностью имеет осмоляльность приблизительно 233 мОсм/кг.

В некоторых популяциях или культурах in vitro добавки содержат: (а) среду F-12; (b) добавку N2; (с) среду NEUROBASAL; (d) добавку В-27; (е) L-глютамин; (f) 2-меркаптоэтанол или (g) любую комбинацию (a)-(f).

В некоторых популяциях или культурах in vitro полипептид LIF представляет собой человеческий полипептид LIF (hLIF). В некоторых популяциях или культурах in vitro ингибитор GSK3 представляет собой CHIR99021. В некоторых популяциях или культурах in vitro ингибитор МЕК представляет собой PD0325901. В некоторых популяциях или культурах in vitro среда с низкой осмоляльностью содержит ингибиторы, состоящие по существу из ингибитора GSK3 и ингибитора МЕК. В некоторых популяциях или культурах in vitro среда с низкой осмоляльностью содержит основную среду в концентрации приблизительно 24,75% (об/об), среду F-12 в концентрации приблизительно 24,75% (об/об), добавку N2 в концентрации приблизительно 0,5% (об/об), среду NEUROBASAL в концентрации приблизительно 49% (об/об), добавку В-27 в концентрации приблизительно 1% (об/об), L-глутамин в концентрации приблизительно 2 мМ, 2-меркаптоэтанол в концентрации приблизительно 0,1 мМ, hLIF в концентрации приблизительно 100 единиц/мл, CHIR99021 в концентрации приблизительно 3 мкМ и PD0325901 в концентрации приблизительно 0,5 мкМ.

В некоторых популяциях или культурах in vitro среда с низкой осмоляльностью не содержит одного или более из: добавки bFGF, добавки TGF-β1, ингибитора JNK, ингибитора р38, ингибитора ROCK и ингибитора РКС. В некоторых популяциях или культурах in vitro среда с низкой осмоляльностью не содержит основного фактора роста фибробластов (bFGF).

В некоторых популяциях или культурах in vitro hiPSC или трансформированные клетки культивируют на MATRIGEL™, питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) или GELTREX™.

В некоторых популяциях или культурах in vitro клетки hiPSC экспрессируют один или более маркеров плюрипотентности. В некоторых популяциях или культурах in vitro один или более маркеров плюрипотентности включает в себя NANOG, щелочную фосфатазу или их комбинацию. В некоторых популяциях или культурах in vitro hiPSC имеют нормальный кариотип.

В некоторых популяциях или культурах in vitro hiPSC проявляют морфологию, характеризующуюся компактными куполообразными колониями.

В некоторых популяциях или культурах in vitro hiPSC можно ферментативным способом диссоциировать в суспензию одиночных клеток и пересеивать. В некоторых популяциях или культурах in vitro ферментативную диссоциацию выполняют с использованием трипсина. В некоторых популяциях или культурах in vitro ферментативную диссоциацию выполняют в отсутствие ингибитора Rho-ассоциированной протеинкиназы (ROCK). В некоторых популяциях или культурах in vitro пересеянные hiPSC продолжают экспрессировать один или более маркеров плюрипотентности. В некоторых популяциях или культурах in vitro пересеянные hiPSC сохраняют интактное или выглядящее интактным состояние и проявляют морфологию, характеризующуюся компактными куполообразными колониями. В некоторых популяциях или культурах in vitro пересеянные hiPSC сохраняют нормальный кариотип.

В некоторых популяциях или культурах in vitro hiPSC могут дифференцировать в клетки любого из зародышевых листков эндодермы, эктодермы или мезодермы. В некоторых популяциях или культурах in vitro hiPSC имеют время удвоения от приблизительно 16 часов до приблизительно 24 часов.

В некоторых популяциях или культурах in vitro трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до культивирования в среде с низкой осмоляльностью, причем среда с высокой осмоляльностью содержит bFGF. Необязательно, среда с высокой осмоляльностью имеет осмоляльность по меньшей мере приблизительно 290 мОсм/кг.

В некоторых популяциях или культурах in vitro трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят характеристики интактного или выглядящего интактным состояния. В некоторых популяциях или культурах in vitro трансформированные клетки сначала культивируют в среде с высокой осмоляльностью в течение периода приблизительно двух месяцев. В некоторых популяциях или культурах in vitro трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят морфологию, характеризующуюся трехмерными скоплениями клеток.

КРАТКОЕ ОПИСАНИЕ ФИГУР

На Фиг. 1 представлена схема замены участка человеческого локуса ADAM6 нуклеиновой кислотой, содержащей мышиные локусы Adam6a и Adam6b с использованием LTVEC и гидовой РНК в человеческих ИПС-клетках. Целевой сайт для гидовой РНК обозначен стрелкой.

На Фиг. 2А представлена морфология, проявляемая человеческими ИПС-клетками, культивированными в течение 8 дней в среде 2i.

На Фиг. 2В представлена морфология, проявляемая человеческими ИПС-клетками, культивированными в течение 12 дней в среде 2i.

На Фиг. 3A-3D представлена морфология человеческих ИПС-клеток, культивированных в среде mTeSR™-hLIF или в среде с низкой осмоляльностью VG2i в течение 6 дней. На Фиг. 3А и 3В представлена морфология человеческих ИПС-клеток, культивированных в среде mTeSR™-hLIF (Фиг. 3А) или в среде VG2i (Фиг. 3В) в течение 6 дней. На Фиг. 3С и 3D представлена морфология человеческих ИПС-клеток, культивированных на питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) в среде mTeSR™-hLIF (Фиг. 3С) или в среде VG2i (Фиг. 3D) в течение 6 дней.

На Фиг. 4А представлены репрограммированные человеческие ИПС-клетки, культивированные в среде VG2i, которые окрашены на щелочную фосфатазу. На Фиг. 4В и 4С представлены репрограммированные человеческие ИПС-клетки, культивированные в среде VG2i, которые иммунно окрашены на экспрессию NANOG. На Фиг. 5А-5С представлена ферментативная диссоциация и пересев репрограммированных человеческих ИПС-клеток, культивированных в среде VG2i. На Фиг. 5А представлены репрограммированные человеческие ИПС-клетки, культивированные в среде VG2i, до ферментативной диссоциации трипсином в отсутствие ингибитора ROCK. На Фиг. 5В представлены человеческие ИПС-клетки, культивированные в среде VG2i в течение 1 дня после пересева. На Фиг. 5С представлены человеческие ИПС-клетки, культивированные в среде VG2i в течение 4 дней после пересева.

На Фиг. 6А и 6В показаны кариотипы клеток из двух разных клонов человеческих ИПС-клеток 10-го пассажа после диссоциации трипсином для формирования суспензии одиночных клеток.

КРАТКОЕ ОПИСАНИЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

SEQ ID NO: 1 показывает нуклеотидную последовательность, образованную гРНК ADAM6.

SEQ ID NO: 2 показывает нуклеотидною последовательность целевой последовательности для комплекса CRISPR/Cas.

ОПРЕДЕЛЕНИЯ

Термины «белок», «полипептид» и «пептид», используемые в настоящем документе на взаимозаменяемой основе, включают полимерные формы аминокислот любой длины, включая кодированные и некодированные аминокислоты и химически или биохимически модифицированные или дериватизированные аминокислоты. Термины также включают полимеры, которые подверглись модификации, например полипептиды с модифицированными основными цепями пептидов. Термины «нуклеиновая кислота» и «полинуклеотид», используемые в настоящем документе на взаимозаменяемой основе, включают полимерные формы нуклеотидов любой длины, включая рибонуклеотиды, дезоксирибонуклеотиды или их аналоги и модифицированные формы. Эти термины включают одно-, двух- и многоцепочечные ДНК или РНК, геномную ДНК, кДНК, гибриды ДНК-РНК и полимеры, содержащие пуриновые основания, пиримидиновые основания или другие природные, химически модифицированные, биохимически модифицированные, неприродные или дериватизированные нуклеотидные основания.

«Оптимизация кодонов» по существу включает в себя процесс модификации нуклеотидной последовательности для улучшения экспрессии в конкретных клетках-хозяевах путем замены по меньшей мере одного кодона нативной последовательности кодоном, который более часто или наиболее часто используется в генах клетки-хозяина при сохранении нативной аминокислотной последовательности. Например, нуклеиновую кислоту, кодирующую белок Cas, можно модифицировать для введения кодонов-заместителей, имеющих большую частоту использования в человеческой клетке. Таблицы использования кодонов являются общедоступными, например, в базе данных Codon Usage Database. Эти таблицы можно адаптировать несколькими способами. См. Nakamura et al. (2000) Nucleic Acids Research 28:292. Также имеются компьютерные алгоритмы для оптимизации кодонов с конкретной последовательностью для экспрессии в конкретном хозяине (см., например, Gene Forge).

Термин «функциональная связь» или «функционально связанный» относится к смежному размещению двух или более компонентов (например, промотора и другого элемента последовательности) таким образом, чтобы оба компонента нормально функционировали и обеспечивалась возможность того, чтобы по меньшей мере один из компонентов мог опосредовать функцию, осуществляемую в отношении по меньшей мере одного из других компонентов. Например, промотор может быть функционально связан с кодирующей последовательностью, если промотор контролирует уровень транскрипции кодирующей последовательности в ответ на присутствие или отсутствие одного или более факторов регуляции транскрипции. Термин «комплементарность» нуклеиновых кислот означает, что нуклеотидная последовательность в одной цепи нуклеиновой кислоты вследствие ориентации нуклеотидных оснований образует водородные связи с другой последовательностью на противоположной цепи нуклеиновой кислоты. В ДНК, как правило, комплементарны основания А и Т, а также С и G. В РНК это, как правило, С и G, а также U и А. Комплементарность может быть идеальной или существенной/достаточной. Идеальная комплементарность двух нуклеиновых кислот означает, что две нуклеиновые кислоты могут образовывать дуплекс, в котором каждое основание связано с комплементарным основанием, образуя пары Уотсона - Крика. Термин «существенная» или «достаточная» комплементарность означает, что последовательность одной цепи не полностью и/или не идеально комплементарна последовательности противоположной цепи, но между основаниями на двух цепях создается достаточное связывание, чтобы образовывался стабильный гибридный комплекс при некотором наборе условий гибридизации (например, концентрации солей и температуре). Такие условия можно спрогнозировать, используя последовательности и стандартные математические расчеты для предсказания Tm гибридизованных цепей, или путем эмпирического определения Tm традиционными способами. Tm относится к температуре, при которой популяция гибридизационных комплексов, образовавшихся между двумя цепями нуклеиновых кислот, является денатурированной на 50%. При температуре ниже Tm преимущество имеет образование гибридизационного комплекса, тогда как при температуре выше Tm преимущество имеет плавление или разделение цепей гибридизационного комплекса. Tm можно оценить для нуклеиновой кислоты с известным содержанием G+С в водном 1 М растворе NaCl, используя, например, выражение Tm=81,5+0,41(% G+С), хотя в других известных расчетах Tm принимаются во внимание структурные характеристики нуклеиновых кислот. Термин «условие гибридизации» означает совокупную среду, в которой одна цепь нуклеиновой кислоты связывается со второй цепью нуклеиновой кислоты в результате взаимодействия комплементарных цепей и водородного связывания с образованием гибридизационного комплекса. Такие условия включают в себя химические компоненты и их концентрации (например, соли, хелатирующие агенты, формамид) в водном или органическом растворе, содержащем нуклеиновые кислоты, и температуру смеси. Свой вклад в среду могут вносить другие факторы, такие как длительность инкубации или размеры инкубационной камеры. См., например, Sambrook et al., Molecular Cloning, A Laboratory Manual, 2.sup.nd ed., pp. 1.90-1.91, 9.47-9.51, 11.47-11.57 (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). Для гибридизации требуется, чтобы две нуклеиновые кислоты содержали комплементарные последовательности, хотя возможны несовпадения между основаниями. Условия, подходящие для гибридизации между двумя нуклеиновыми кислотами, зависят от длины нуклеиновых кислот и степени комплементации, и эти переменные хорошо известны специалистам в данной области. Чем больше степень комплементации между двумя нуклеотидными последовательностями, тем выше температура плавления (Tm) гибридов нуклеиновых кислот, имеющих эти последовательности. При гибридизации нуклеиновых кислот с короткими участками комплементарности (например, с комплементарностью более 35 нуклеотидов или менее, 30 или менее, 25 или менее, 22 или менее, 20 или менее или 18 или менее) становится важным положение несовпадающих оснований (см. выше Sambrook et al., 11.7-11.8). Как правило, длина пригодной для гибридизации нуклеиновой кислоты составляет по меньшей мере приблизительно 10 нуклеотидов. Значения иллюстративной минимальной длины пригодных для гибридизации нуклеиновых кислот включают по меньшей мере приблизительно 15 нуклеотидов, по меньшей мере приблизительно 20 нуклеотидов, по меньшей мере приблизительно 22 нуклеотида, по меньшей мере приблизительно 25 нуклеотидов и по меньшей мере приблизительно 30 нуклеотидов. Кроме того, температуру и концентрацию солей в промывном растворе можно регулировать по мере необходимости, в зависимости от таких факторов, как длина области комплементации и степень комплементации.

Для обеспечения специфической гибридизации последовательность полинуклеотида не обязательно должна быть на 100% комплементарна целевой нуклеиновой кислоте. Более того, полинуклеотид может гибридизоваться на одном или более сегментах, так что промежуточные или соседние сегменты не вовлечены в событие гибридизации (например, структура петли или шпильки). Полинуклеотид (например, гРНК) может иметь по меньшей мере 70%-ю, по меньшей мере 80%-ю, по меньшей мере 90%-ю, по меньшей мере 95%-ю, по меньшей мере 99%-ю или 100%-ю комплементарность последовательности относительно целевой области в целевой нуклеотидной последовательности, на которую он нацелен. Например, гРНК, в которой 18 из 20 нуклеотидов комплементарны целевой области и, следовательно, могут специфически гибридизоваться, будет представлять 90% комплементарности. В этом примере оставшиеся не комплементарные нуклеотиды могут быть кластеризованы или рассеяны среди комплементарных нуклеотидов и не должны быть обязательно смежными друг с другом или с комплементарными нуклеотидами. Процентную долю комплементарности между конкретными участками нуклеотидных последовательностей в пределах нуклеиновых кислот можно определять типовым способом, используя программы BLAST (средства поиска основных локальных выравниваний) и PowerBLAST, известные в данной области (Altschul et al. (1990) J. Mol. Biol. 215:403-410; Zhang and Madden (1997) Genome Res. 7:649-656), или с помощью программы Gap (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, г. Мэдисон, штат Висконсин, США) с использованием заданных по умолчанию параметров, где используется алгоритм Смита - Ватермана (Adv. Appl. Math., 1981, 2, 482-489).

Термин «идентичность последовательности» или «идентичность» в контексте двух полинуклеотидов или полипептидных последовательностей означает ссылку на остатки, которые одинаковы в двух последовательностях при выравнивании для максимального соответствия в установленном окне сравнения. Если термин «процентная доля идентичности последовательности» применяется в отношении белков, следует понимать, что положения с остатками, не являющимися идентичными, зачастую отличаются консервативными заменами аминокислот, где аминокислотные остатки заменяются другими аминокислотными остатками с аналогичными химическими свойствами (например, зарядом или гидрофобностью) и поэтому не изменяют функциональные свойства молекулы. Если последовательности отличаются консервативными заменами, процентную долю идентичности последовательностей можно скорректировать в сторону увеличения, чтобы учесть консервативный характер замены. Последовательности, отличающиеся такими консервативными заменами, считаются имеющими «сходство последовательностей» или «сходство». Способы внесения данной корректировки хорошо известны специалистам в данной области. Как правило, они включают в себя оценку консервативной замены как частичного, а не полного несовпадения, в результате чего повышается процент идентичности последовательности. Таким образом, например, если идентичной аминокислоте присваивают оценку 1, то неконсервативной замене присваивают оценку, равную нулю, а консервативная замена получает оценку от нуля до 1. Вычисляют оценку консервативных замен, например, в соответствии с реализацией в программе PC/GENE (Intelligenetics, г. Маунтин-Вью, штат Калифорния, США).

Термин «процентная доля идентичности последовательности» означает значение, которое определяют путем сравнения двух оптимально выровненных последовательностей в окне сравнения, причем участок полинуклеотидной последовательности в окне сравнения может содержать добавления или делеции (т.е. гэпы) в сравнении с эталонной последовательностью (которая не содержит добавлений или делеций) для оптимального выравнивания двух последовательностей. Процент рассчитывают путем определения числа положений, в которых в обеих последовательностях встречаются идентичные нуклеиновые основания или аминокислотные остатки, деления числа совпадающих положений на общее число положений в окне сравнения и умножения результата на 100 с получением процента идентичности последовательности.

Если не указано иное, значения идентичности/сходства последовательности включают значение, полученное с использованием программного обеспечения GAP версии 10 с использованием следующих параметров: % идентичности и % сходства нуклеотидной последовательности при использовании значения GAP Weight (штраф за начало гэпа) = 50 и Length Weight (штраф за удлинение) = 3 и матрица замен nwsgapdna.cmp; % идентичности и % сходства аминокислотной последовательности при использовании значения GAP Weight (штраф за начало гэпа) = 8 и Length Weight (штраф за удлинение) = 2 и матрица замен BLOSUM62; или любого эквивалентного программного обеспечения. Термин «эквивалентное программное обеспечение» включает в себя любое программное обеспечение для сравнения последовательностей, которое для любых двух рассматриваемых последовательностей создает выравнивание, обладающее идентичными соответствиями нуклеотидов или аминокислотных остатков и идентичным процентом идентичности последовательности при сравнении с соответствующим выравниванием, получаемым посредством программного обеспечения GAP версии 10.

Композиции или способы, «содержащие» или «включающие в себя» один или более упомянутых элементов, могут включать в себя другие элементы, специально не упомянутые. Например, композиция, которая «содержит» или «включает в себя» белок, может содержать белок отдельно или в комбинации с другими ингредиентами. Обозначение диапазона значений включает в себя все целые числа, входящие в диапазон или образующие его, а также все поддиапазоны, образованные целыми числами, входящими в диапазон.

Термин «приблизительно» означает, что указанное значение может варьировать на некоторый процент. В некоторых примерах этот процент может составлять 1, 2, 3, 4, 8 или 10% от указанного значения.

Все элементы, указанные в единственном числе, также могут быть использованы и во множественном, если контекст явно не диктует иное. Например, термин «клетка» или «по меньшей мере одна клетка» может включать в себя множество клеток, включая их смеси.

ПОДРОБНОЕ ОПИСАНИЕ

А. Среда с низкой осмоляльностью для получения и поддержания человеческих индуцированных плюрипотентных стволовых клеток

Предлагается среда для культивирования клеток, предназначенная для применения в способах и композициях изобретения. В одном варианте осуществления среда пригодна для получения популяции человеческих ИПС-клеток. В другом варианте осуществления среда пригодна для поддерживания человеческих ИПС-клеток в культуре. В некоторых вариантах осуществления человеческие ИПС-клетки являются интактными или выглядящими интактными.

Среда, предлагаемая в настоящем документе, содержит по меньшей мере основную среду, добавки, полипептид, являющийся фактором, ингибирующим лейкемию (LIF), ингибитор гликоген-синтазы-киназы 3 (GSK3) и ингибитор митоген-активированной протеинкиназы-киназы (МЕК). Термин «основная среда» или «основные среды» включает в себя, например, основную среду, известную в данной области (например, модифицированную по способу Дульбекко среду Игла (DMEM)), которая пригодна для применения (с дополнительными добавками) при выращивании или поддержании плюрипотентных клеток (например, ИПС-клеток) в культуре. Основная среда обычно поставляется с рядом различных добавок, известных в данной области, при использовании для сохранения клеток в культуре.

Настоящая среда представляет собой среду с низкой осмоляльностью. В одном примере осмоляльность составляет приблизительно 175-280 мОсм/кг. В дополнительных примерах осмоляльность среды составляет приблизительно 180-270 мОсм/кг, приблизительно 200-250 мОсм/кг, приблизительно 220-240 мОсм/кг или приблизительно 225-235 мОсм/кг. В одном конкретном варианте осуществления осмоляльность среды составляет приблизительно 233 мОсм/кг. Предлагаемая для изобретения основная среда представляет собой основную среду с низкой осмоляльностью, к которой добавлены добавки. Данная основная среда отличается от основной среды, обычно используемой для поддержания человеческих ИПС-клеток в культуре, которая содержит модифицированную по способу Дульбекко среду Игла (DMEM) в различных формах (например, Invitrogen DMEM, кат. №1 1971-025) и низкосолевую среду DMEM, предлагаемую под наименованием KO-DMEM™ (Invitrogen кат. №10829-018).

Основная среда, предлагаемая в настоящем документе, представляет собой среду с низкой осмоляльностью, но она проявляет характеристики, не ограничивающиеся низкой осмоляльностью. Например, состав DMEM, показанный в таблице 1, можно сделать приемлемым для целей изобретения, изменив концентрации хлорида натрия и/или карбоната натрия, как предложено в настоящем документе, результатом чего будет иная осмоляльность по сравнению со стандартной основной средой DMEM или низкосолевой основной средой DMEM (KO-DMEM), показанными в таблице 1.

Данная основная среда может содержать галогенидную соль щелочного металла, например хлорид натрия (NaCl). Примерные концентрации NaCl в основной среде включают 50±5 мМ или приблизительно 3 мг/мл. Концентрация галогенидной соли щелочного металла в основной среде или среде, содержащей основную среду и добавки, может составлять, например, не более чем приблизительно 100, 90, 80, 70, 60 или 50 мМ. Например, основная среда или среда, содержащая основную среду и добавки, может содержать концентрацию галогенидной соли щелочного металла приблизительно 50-110, 60-105, 70-95, 80-90, 90 мМ или 85 мМ. В альтернативном варианте осуществления концентрация галогенидной соли щелочного металла может составлять, например, 50±5 мМ, 87±5 мМ, 110±5 мМ, приблизительно 3 мг/мл, приблизительно 5,1 мг/мл или приблизительно 6,4 мг/мл.

В другом варианте осуществления основная среда демонстрирует концентрацию соли угольной кислоты. Соль угольной кислоты может представлять собой натриевую соль. В таком примере натриевая соль может представлять собой бикарбонат натрия. В одном конкретном варианте осуществления бикарбонат натрия присутствует в основной среде в концентрации приблизительно 26±5 мМ или приблизительно 2,2 мг/мл. Концентрация соли угольной кислоты в основной среде или среде, содержащей основную среду и добавки, может составлять, например, не более чем 45, 40, 35, 30, 25 или 20 мМ. Например, основная среда или среда, содержащая основную среду и добавки, может содержать концентрацию соли угольной кислоты в основной среде приблизительно 10-40, 18-44, 17-30, 18-26, 13-25, 20-30, 25-26, 18 или 26 мМ. В альтернативном варианте осуществления концентрация соли угольной кислоты может составлять, например, 18±5 мМ, 26±5 мМ, приблизительно 1,5 мг/мл или приблизительно 2,2 мг/мл.

Сумма концентраций галогенидной соли щелочного металла и соли угольной кислоты в основной среде или среде, содержащей основную среду и добавки, может составлять, например, не более чем приблизительно 140, 130, 120, 110, 100, 90 или 80 мМ. Например, основная среда или среда, содержащая основную среду и добавки, может содержать сумму концентраций галогенидной соли щелочного металла и соли угольной кислоты приблизительно 80-140, 85-130, 90-120, 95-120, 100-120 или 115 мМ. Молярное соотношение галогенидной соли щелочного металла и соли угольной кислоты в основной среде или среде, содержащей основную среду и добавки, может составлять, например, более чем 2,5. Например, основная среда или среда, содержащая основную среду и добавки, может иметь молярное соотношение галогенидной соли щелочного металла и соли угольной кислоты приблизительно 2,6-4,0, 2,8-3,8, 3,0-3,6, 3,2-3,4, 3,3-3,5 или 3,4.

В еще одном варианте осуществления основная среда представляет собой основную среду с низкой осмоляльностью. Осмоляльность основной среды может лежать в диапазоне приблизительно 175-280 мОсм/кг, приблизительно 180-250 мОсм/кг, приблизительно 190-225 мОсм/кг или приблизительно 195-205 мОсм/кг. Примерная осмоляльность основной среды может составлять 200, 214, 216 или 218 мОсм/кг. В одном конкретном примере осмоляльность основной среды составляет 200 мОсм/кг. Осмоляльность можно определить при культивировании клеток с разными концентрациями СО2. В некоторых примерах клетки культивируют при 3% СО2 или 5% СО2. Осмоляльность основной среды или среды, содержащей основную среду и добавки, может составлять, например, не более чем приблизительно 330, 320, 310, 300, 290, 280, 275, 270, 260, 250, 240, 230, 220, 210 или 200 мОсм/кг. Например, основная среда или среда, содержащая основную среду и добавки, может иметь осмоляльность приблизительно 200-329, 218-322, 240-320, 250-310, 275-295 или 260-300 мОсм/кг. Например, основная среда или среда, содержащая основную среду и добавки, может иметь осмоляльность приблизительно 270 мОсм/кг, приблизительно 261 мОсм/кг или приблизительно 218 мОсм/кг. В альтернативном варианте осуществления осмоляльность может составлять 218±22 мОсм/кг, 261±26 мОсм/кг, 294±29 мОсм/кг или 322±32 мОсм/кг.

Осмоляльность основной среды может составлять, например, приблизительно 130-270, 140-260, 150-250, 160-240, 170-230, 180-220, 190-210, 195-205 или 200 мОсм/кг. В альтернативном варианте осуществления осмоляльность основной среды может составлять, например, приблизительно 200±70, 200±60, 200±50, 200±40, 200±35, 200±30, 200±25, 200±20, 200±15, 200±10, 200±5 или 200 мОсм/кг. В альтернативном варианте осуществления осмоляльность основной среды может составлять, например, приблизительно 130-140, приблизительно 140-150, приблизительно 150-160, приблизительно 160-170, приблизительно 170-180, приблизительно 180-190, приблизительно 190-200, приблизительно 200-210, приблизительно 210-220, приблизительно 220-230, приблизительно 230-240, приблизительно 240-250, приблизительно 250-260, приблизительно 260-270, приблизительно 270-280, приблизительно 280-290, приблизительно 290-300, приблизительно 300-310, приблизительно 310-320 или приблизительно 320-330 мОсм/кг. В альтернативном варианте осуществления осмоляльность основной среды может составлять, например, менее чем приблизительно 330, 320, 310, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140 или 130 мОсм/кг. Осмоляльность среды, содержащей основную среду и добавки, может составлять, например, приблизительно 205-260, 215-250, 225-240, 230-235 или 233 мОсм/кг. В альтернативном варианте осуществления осмоляльность среды, содержащей основную среду и добавки, может составлять, например, приблизительно 233±27, 233±25, 233±20, 233±15, 233±10, 233±5 или 233 мОсм/кг. В альтернативном варианте осуществления осмоляльность среды, содержащей основную среду и добавки, может составлять, например, приблизительно 200-205, 205-210, 210-215, 215-220, 220-225, 225-230, 230-235, 235-240, 240-245, 245-250, 250-255 или 255-260 мОсм/кг. В альтернативном варианте осуществления осмоляльность среды, содержащей основную среду и добавки, может составлять, например, менее чем 260, 255, 250, 245, 240, 235, 230, 225, 220, 215, 210, 205 или 200 мОсм/кг.

В некоторых средах с низкой осмоляльностью основная среда содержит приблизительно 87±5 мМ NaCl и приблизительно 26±5 мМ карбоната. Например, основная среда может содержать приблизительно 5,1 мг/мл NaCl, приблизительно 2,2 мг/мл бикарбоната натрия и иметь осмоляльность приблизительно 275 мОсм/кг. В некоторых средах с низкой осмоляльностью основная среда содержит приблизительно 50±5 мМ NaCl и приблизительно 26±5 мМ карбоната. Например, основная среда может содержать приблизительно 3,0 мг/мл NaCl и 2,2 мг/мл бикарбоната натрия с осмоляльностью приблизительно 200 мОсм/кг. В предпочтительном варианте осуществления основная среда содержит NaCl в концентрации 3,0 мг/мл, бикарбонат натрия в концентрации приблизительно 2,2 мг/мл и имеет осмоляльность 200 мОсм/кг.

Другие примеры сред с низкой осмоляльностью описаны в публикациях WO 2011/156723, US 2011/0307968 и US 2015/0067901, каждая из которых полностью включена в настоящий документ путем ссылки.

Добавки, используемые с основной средой настоящего изобретения, подходят для получения, поддерживания или обогащения популяций человеческих ИПС-клеток, описанных в настоящем документе. В настоящем описании такие добавки указаны как «добавки» или «+добавки». Термин «добавки» или фраза «+добавки» включает в себя один или более дополнительных элементов, добавляемых к компонентам основной среды, описанным в таблице 1. Например, добавки могут включать в себя, без ограничений, среду F-12® (Gibco), добавку N2® (Gibco; раствор 100Х), среду NEUROBASAL® (Gibco), добавку В-27® (Gibco; раствор 50Х), L-глутамин, глюкозу, 2-меркаптоэтанол, полипептид, являющийся фактором, ингибирующим лейкемию (LIF), ингибитор гликоген-синтазы-киназы 3, ингибитор МЕК или любую их комбинацию. Добавки также могут включать в себя, например, эмбриональную бычью сыворотку (FBS), антибиотик (-и), пенициллин и стрептомицин (т.е. пенстреп), пируватные соли (например, пируват натрия) и заменимые аминокислоты (например, MEM NEAA).

В одном конкретном варианте осуществления полипептид LIF представляет собой человеческий полипептид LIF (hLIF). В некоторых примерах полипептид hLIF используют в концентрации приблизительно 1-1000 единиц/мл, приблизительно 20-800 единиц/мл, приблизительно 50-500 единиц/мл, приблизительно 75-250 единиц/мл или приблизительно 100 единиц/мл.

Среда может содержать ингибиторы, например состоящие по существу из ингибитора GSK3 и ингибитора МЕК. Например, среда может содержать ингибиторы, состоящие из ингибитора GSK3 и ингибитора МЕК.

В другом конкретном варианте осуществления ингибитор GSK3 представляет собой CHIR99021. В некоторых примерах CHIR99021 используют в концентрации приблизительно 0,1-10 мкМ, приблизительно 1-5 мкМ, приблизительно 2-4 мкМ или приблизительно 3 мкМ.

В другом конкретном варианте осуществления ингибитор МЕК представляет собой PD0325901. В некоторых примерах PD0325901 используют в концентрации приблизительно 0,1-5 мкМ, приблизительно 0,2-1 мкМ, приблизительно 0,3-0,7 мкМ или приблизительно 0,5 мкМ.

Пример среды содержит основную среду с низкой осмоляльностью, описанную в настоящем документе, в концентрации приблизительно 24,75% (об/об), среду F-12 в концентрации приблизительно 24,75%) (об/об), добавку N2 в концентрации приблизительно 0,5% (об/об), среду NEUROBASAL в концентрации приблизительно 49% (об/об), добавку В-27 в концентрации приблизительно 1% (об/об), L-глутамин в концентрации приблизительно 2 мМ, 2-меркаптоэтанол в концентрации приблизительно 0,1 мМ, hLIF в концентрации приблизительно 100 единиц/мл, CHIR99021 в концентрации приблизительно 3 мкМ и PD0325901 в концентрации приблизительно 0,5 мкМ.

В другом конкретном варианте осуществления среда может содержать или не содержать основной фактор роста фибробластов (bFGF, также известный как FGF2 или FGF-β). Предпочтительно, данная среда не содержит bFGF.

Среда может содержать или не содержать одно или более из добавки трансформирующего фактора роста бета 1 (TGF-β1), добавки bFGF, ингибитора киназы N-конца c-Jun (JNK) (например, SP600125), ингибитора р38 митоген-активированной протеинкиназы (р38) (например, SB203580), ингибитора rho-ассоциированной протеинкиназы (ROCK) (например, Y-27632) и ингибитора протеинкиназы С (РКС) (например, Go6983). Среда может содержать или не содержать форсколин. Например, некоторые среды не содержат одно или более из добавки TGF-β1, добавки bFGF, ингибитора JNK (например, SP600125), ингибитора р38 (например, SB203580), ингибитора ROCK (например, Y-27632) и ингибитора РКС (например, Go6983). Некоторые среды не содержат одно или более из ингибитора р38 и ингибитора JNK. Некоторые среды не содержат добавку bFGF или добавку TGF-β1. Некоторые среды не содержат добавку TGF-β1. Некоторые среды не содержат ни одно из добавки TGF-β1, добавки bFGF, ингибитора JNK (например, SP600125), ингибитора р38 (например, SB203580), ингибитора ROCK (например, Y-27632) и ингибитора РКС (например, Go6983). Некоторые среды не содержат форсколин.

В. Человеческие индуцированные плюрипотентные стволовые клетки

В настоящем документе предлагаются способы и композиции для получения популяции человеческих ИПС-клеток. Также предлагаются способы и композиции для поддержания человеческих ИПС-клеток в культуре. Также предлагаются человеческие ИПС-клетки, которые получают или поддерживают в культуре.

Термин «плюрипотентная клетка» или «плюрипотентная стволовая клетка», используемый в настоящем документе, включает недифференцированную клетку, которая обладает способностью развиваться в более чем один дифференцированный тип клеток. Такие плюрипотентные клетки могут представлять собой, например, эмбриональную стволовую клетку (ЭС-клетку) млекопитающего или индуцированную плюрипотентную стволовую клетку (ИПС-клетку) млекопитающего. К примерам плюрипотентных клеток относятся человеческие ИПС-клетки.

Термин «эмбриональная стволовая клетка» или «ЭС-клетка» означает происходящую из эмбриона тотипотентную или плюрипотентную стволовую клетку, которая получена из внутренней клеточной массы бластоцисты и которая может поддерживаться в культуре in vitro при использовании подходящих условий. ЭС-клетки способны дифференцироваться в клетки любого из трех зародышевых листков позвоночных, например эндодермы, эктодермы или мезодермы. ЭС-клетки также характеризуются способностью к неограниченному размножению при подходящих условиях культивирования in vitro. См., например, Thomson et al. (Science (1998) Vol.282(5391), pp.1145-1147).

Термин «индуцированная плюрипотентная стволовая клетка» или «ИПС-клетка» включает в себя плюрипотентную стволовую клетку, которая может быть получена непосредственно из дифференцированной взрослой клетки. Человеческие ИПС-клетки можно получать путем введения в неплюрипотентную клетку определенного набора репрограммирующих факторов, куда могут входить, например, Oct3/4, транскрипционные факторы семейства Sox (например, Sox1, Sox2, Sox3, Sox15), транскрипционные факторы семейства Мус (например, с-Мус, 1-Мус, n-Мус), транскрипционные факторы из семейства (KLF) (например, KLF1, KLF2, KLF4, KLF5), и/или родственных транскрипционных факторов, таких как NANOG, LIN28 и/или Glis1. Человеческие ИПС-клетки также можно получить, например, при помощи миРНК - небольших молекул, имитирующих действие транскрипционных факторов или спецификаторов линий дифференцировки. Человеческие ИПС-клетки характеризуются способностью дифференцироваться в любую клетку трех зародышевых листков позвоночных, например эндодермы, эктодермы или мезодермы. Человеческие ИПС-клетки также характеризуются способностью к неограниченному размножению при подходящих условиях культивирования in vitro. См., например, публикацию Takahashi and Yamanaka (Cell (2006) Vol. 126(4), pp. 663-676).

Термины «интактный» и «праймированный» означают разные состояния плюрипотентности человеческих ИПС-клеток. Термин «выглядящая интактной» означает клетку, проявляющую плюрипотентное состояние и демонстрирующую одну или более характеристик интактной плюрипотентной клетки. Выглядящие интактными человеческие ИПС-клетки также могут именоваться «интактноподобными» человеческими ИПС-клетками. Термины «выглядящая интактной» и «интактноподобная» считаются эквивалентными. В некоторых вариантах осуществления выглядящие интактными человеческие ИПС-клетки проявляют одну или более морфологических характеристик интактных человеческих ИПС-клеток, например морфологию, характеризующуюся компактными куполообразными колониями. В некоторых вариантах осуществления выглядящие интактными человеческие ИПС-клетки экспрессируют один или более маркеров плюрипотентности, описанных в настоящем документе. В некоторых вариантах осуществления интактные или выглядящие интактными человеческие ИПС-клетки представляют собой интактные человеческие ИПС-клетки. В других вариантах осуществления интактные или выглядящие интактными человеческие ИПС-клетки представляют собой выглядящие интактными человеческие ИПС-клетки. Характеристики интактных и праймированных ИПС-клеток описаны в данной области техники. См., например, публикацию Nichols and Smith (Cell Stem Cell (2009) Vol.4(6), pp. 487-492). Интактные человеческие ИПС-клетки проявляют состояние плюрипотентности, сходное с ЭС-клетками внутренней клеточной массы эмбриона до имплантации. Такие интактные клетки не праймированы для спецификации и коммитирования в определенную линию дифференцировки. Женские интактные ИПС-клетки характеризуются двумя активными Х-хромосомами. В культуре самообновление интактных человеческих ИПС-клеток зависит от фактора, ингибирующего лейкемию (LIF), и других ингибиторов. Культивируемые интактные человеческие ИПС-клетки проявляют клональную морфологию, характеризующуюся куполообразными колониями и отсутствием апикально-базальной полярности. Культивируемые интактные клетки могут дополнительно проявлять один или более маркеров плюрипотентности, как описано в других частях настоящего документа. При подходящих условиях время удвоения интактных человеческих ИПС-клеток в культуре может составлять от 16 до 24 часов.

Праймированные человеческие ИПС-клетки проявляют состояние плюрипотентности, сходное с состоянием клеток эпибласта после имплантации. Такие клетки праймированы для спецификации и коммитирования в определенную линию дифференцировки. Женские праймированные ИПС-клетки характеризуются одной активной Х-хромосомой и одной неактивной Х-хромосомой. В культуре самообновление праймированных человеческих ИПС-клеток зависит от фактора роста фибробластов (FGF) и активина. Культивируемые праймированные человеческие ИПС-клетки проявляют клональную морфологию, характеризующуюся эпителиальным монослоем, и проявляют апикально-базальную полярность. При подходящих условиях время удвоения праймированных человеческих ИПС-клеток в культуре может составлять 24 часа или более.

В одном варианте осуществления человеческие ИПС-клетки могут происходить от неплюрипотентных клеток, трансформированных для проявления плюрипотентного состояния. К таким трансформированным клеткам относятся, например, клетки, трансформированные для экспрессии репрограммирующих генов, индуцирующих плюрипотентность. Плюрипотентное состояние может включать в себя, например, экспрессию одного или более маркеров плюрипотентности, описанных в настоящем документе. Такие клетки (например, фибробласты крайней плоти человека) можно трансформировать для экспрессии репрограммирующих генов или любых дополнительных интересующих генов при помощи способов, известных специалистам. См., например, публикацию Takahashi and Yamanaka (Cell (2006) Vol. 126(4), pp. 663-676). Например, такие гены можно ввести в клетки, используя одну или более плазмид, лентивирусных векторов или ретровирусных векторов. В некоторых случаях векторы интегрируются в геном и могут быть удалены после завершения репрограммирования. В конкретных вариантах осуществления неплюрипотентные клетки трансформируют репрограммирующими генами, включающими в себя Oct4, Sox2, Klf4, Мус или любую их комбинацию. В некоторых примерах трансформированные клетки включают в себя праймированные человеческие ИПС-клетки.

В некоторых вариантах осуществления человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, проявляют один или более фенотипов, профилей экспрессии генов или маркеров, характерных для интактного состояния. В одном примере человеческие ИПС-клетки экспрессируют один или более маркеров плюрипотентности, экспрессия которых служит показателем интактного состояния. К таким маркерам плюрипотентности могут относиться щелочная фосфатаза, NANOG, 5Т4, ABCG2, активин RIB/ALK-4, активин RIIB, Е-кадхерин, Cbx2, CD9, CD30/TNFRSF8, CD117/c-kit, CDX2, CHD1, Cripto, DNMT3B, DPPA2, DPPA4, DPPA5/ESG1, EpCAM/TROPl, ERR бета/NR3B2, ESGP, белок F-box 15/FBX015, FGF-4, FGF-5, FoxD3, GBX2, GCNF/NR6A1, GDF-3, Gi24/VISTA/B7-H5, интегрин альфа 6/CD49f, интегрин альфа 6 бета 1, интегрин альфа 6 бета 4, интегрин бета 1/CD29, KLF4, KLF5, L1TD1, Lefty, Lefty-1, Lefty-A, LIN-28A, LIN-28B, LIN-41, cMaf, cMyc, Oct-3/4, Oct-4A, подокаликсин, Rex-1/ZFP42, Smad2, Smad2/3, SOX2, SSEA-1, SSEA-3, SSEA-4, STAT3, Stella/Dppa3, SUZ12, TBX2, ТВХ3, TBX5, TERT, TEX 19, TEX19.1, THAP11, TRA-1-60(R), TROP-2, UTF1 и/или ZIC3. В одном конкретном примере экспрессированный маркер плюрипотентности представляет собой щелочную фосфатазу, NANOG и/или оба данных вещества. В другом варианте осуществления человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанные в настоящем документе, проявляют морфологические характеристики, служащие показателем интактного состояния. Примером характерной морфологии являются клетки, имеющие в культуре компактные куполообразные колонии.

Человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, могут иметь нормальный кариотип. Нормальный кариотип включает в себя кариотип, в котором присутствуют все хромосомы, в норме характерные для вида и не имеющие видимых изменений, или состояние клеток, в котором отсутствуют любые видимые численные или структурные хромосомные аномалии, выявляемые при помощи анализа с дифференциальным окрашиванием хромосом. Человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, могут иметь нормальный кариотип, например, после приблизительно 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 или 100 пассажей в среде с низкой осмоляльностью, описанной в настоящем документе.

В другом варианте осуществления человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, можно механическим или ферментативным способом диссоциировать в суспензию одиночных клеток, пассировать и/или пересеивать. Такие человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, могут иметь нормальный кариотип и могут сохранять нормальный кариотип после механической или ферментативной диссоциации в суспензию одиночных клеток, пассирования и/или пересева. Например, такие человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, могут иметь нормальный кариотип и могут сохранять нормальный кариотип после механической или ферментативной диссоциации в суспензию одиночных клеток, модификации в целевом геномном локусе с использованием способов, описанных в других частях настоящего документа, и пересева. В одном примере ферментативную диссоциацию можно осуществить при помощи трипсина. При культивировании в настоящей среде с низкой осмоляльностью, человеческие ИПС-клетки могут обеспечить более высокую эффективность трансформации из-за улучшенной диссоциации в суспензию одиночных клеток. В других типах сред (например, в среде mTeSR™ или среде 2i), как правило используемых для поддержания человеческих ИПС-клеток в культуре, диссоциацию ИПС-клеток необходимо выполнять механически или с использованием таких ферментов, как коллагеназа, которые менее агрессивны, чем трипсин. Обычно не рекомендуется пассировать человеческие ИПС-клетки в виде одиночных клеток, поскольку на практике было показано, что это оказывает нежелательное избирательное давление на клеточные популяции, что может привести, например, к генетическим аномалиям в культуре. Человеческие ИПС-клетки подвержены апоптозу при отсоединении и диссоциации клеток, и, как правило, после полной диссоциации наблюдается массовая гибель клеток. См. публикацию Watanabe et al. (2007) Nature 25(6):681-686, которая полностью включена в настоящий документ путем ссылки. Следовательно, диссоциацию человеческих ИПС-клеток обычно выполняют с использованием реагентов и способов, минимизирующих разрушение колоний при пассировании и не образующих суспензию одиночных клеток. Следовательно, клетки не диссоциируются достаточно эффективно или достаточно полно. Однако полное диссоциирование может быть важным для таких процедур, как выделение клона после переноса генов или создания нацеленной генетической модификации, в особенности при попытке выделить относительно редкие клоны, например подвергающиеся гомологичной рекомбинации для получения нужной нацеленной модификации. Напротив, при использовании настоящей среды с низкой осмоляльностью можно применить трипсин для диссоциации клеток, и улучшенная диссоциация приведет к повышению эффективности трансформации. Например, такая диссоциация позволит получить суспензии одиночных клеток, что приведет к более высокой эффективности нацеливания при нацеливании, например, способом электропорации или способами введения нацеленных генетических модификаций, описанными в других частях настоящего документа. Более того, в отличие от других типов сред, обычно применяемых для поддержания человеческих ИПС-клеток в культуре (например, среды mTeSR™ или среды 2i), ферментативную диссоциацию человеческих ИПС-клеток, культивированных в настоящей среде с низкой осмоляльностью (предпочтительно, в среде с низкой осмоляльностью, не содержащей bFGF), можно выполнить в отсутствие одного или более ингибиторов, обычно необходимых для пассирования таких клеток. Примером ингибитора, который можно не использовать, является ингибитор Rho-ассоциированной протеинкиназы (ROCK). Ингибитор ROCK обычно является необходимым при пассировании человеческих ИПС-клеток в целях ингибирования активации проапоптозных путей. В частности, обычно рекомендуют добавлять ингибитор ROCK при пересевании суспензии одиночных человеческих ИПС-клеток, поскольку есть данные, что это повышает выживаемость клеток. См. публикацию Watanabe et al. (2007) Nature 25(6):681-686. Однако при использовании среды с низкой осмоляльностью, описанной в настоящем документе, такие ингибиторы ROCK не требуются, даже при пересевании в виде суспензии одиночных клеток. Такие суспензии одиночных клеток могут сохранять плюрипотентность и нормальный кариотип после трипсинирования и пересевания, если используется среда с низкой осмоляльностью, описанная в настоящем документе.

В еще одном варианте осуществления пересеянные человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, могут сохранять интактное или выглядящее интактным состояние после ферментативной диссоциации и пересевания. Пересеянные человеческие ИПС-клетки, культивированные в среде с низкой осмоляльностью, описанной в настоящем документе, могут сохранять интактное или выглядящее интактным состояние после ферментативной диссоциации и пересевания даже при пассировании в виде суспензии одиночных клеток и/или при модификации целевого геномного локуса способами, описанными в других частях настоящего документа. В некоторых примерах пересеянные человеческие ИПС-клетки могут продолжать проявлять морфологию, характеризующуюся компактными куполообразными колониями. Пересеянные человеческие ИПС-клетки также могут продолжать экспрессировать один или более маркеров плюрипотентности, описанных в настоящем документе.

С. Способы получения и поддержания популяции человеческих индуцированных плюрипотентных стволовых клеток

Предлагаются способы и композиции для получения человеческих ИПС-клеток в культуре in vitro. Также предлагаются способы и композиции для поддержания человеческих ИПС-клеток в культуре in vitro.

Термин «получение» включает в себя культивирование неплюрипотентных клеток, трансформированных для экспрессии одного или более репрограммирующих факторов, описанных в настоящем документе, при подходящих условиях с целью индуцирования изменения в фенотипе клеток, экспрессии генов и/или и того и другого, так чтобы клетки проявляли интактное или выглядящее интактным состояние, т.е. экспрессировали одну или более характеристик интактных человеческих ИПС-клеток. Интактное или выглядящее интактным состояние может проявляться в ответ на конкретные условия культивирования, например культивирование в среде с низкой осмоляльностью, описанной в настоящем документе. В некоторых примерах доля клеток, проявляющих интактное или выглядящее интактным состояние, составляет по меньшей мере приблизительно 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% и до 100% клеток в культуре.

В одном варианте осуществления способ обогащает культуру in vitro популяцией интактных или выглядящих интактными человеческих ИПС-клеток. В таком варианте осуществления интактные или выглядящие интактными человеческие ИПС-клетки могут размножаться в культуре с большей предпочтительностью, чем клетки, не проявляющие интактного или выглядящего интактным состояния. В другом варианте осуществления интактные или выглядящие интактными человеческие ИПС-клетки можно выбирать из культуры, ферментативно диссоциировать и пересеивать с получением обогащенной популяции интактных или выглядящих интактными человеческих ИПС-клеток.

В одном варианте осуществления неплюрипотентные клетки, трансформированные для проявления плюрипотентного состояния, культивируют in vitro в предложенной в настоящем документе среде, подходящей для индуцирования проявления интактного или выглядящего интактным состояния, в течение периода времени по меньшей мере 1, 2, 5, 7, 10, 14, 21 или 28 дней или любого периода времени, достаточного для индукции проявления интактного или выглядящего интактным состояния в культуре. Трансформированные клетки можно культивировать в настоящей среде в течение по меньшей мере 1, 2, 3 или 4 недель. Иногда трансформированные клетки культивируют в течение 1-4 недель. Проявление интактного или выглядящего интактным состояния можно определить путем наблюдения морфологических характеристик или экспрессии маркеров плюрипотентности, характерных для интактного или выглядящего интактным состояния, описанных в других частях настоящего документа. В одном варианте осуществления неплюрипотентные клетки, трансформированные для проявления плюрипотентного состояния, культивируют в настоящей среде с низкой осмоляльностью до тех пор, пока они не проявят характеристики интактного или выглядящего интактным состояния. Затем клетки можно культивировать в настоящей среде для поддержания интактного или выглядящего интактным состояния. В одном варианте осуществления неплюрипотентные клетки, трансформированные для проявления плюрипотентного состояния, сначала культивируют в среде с высокой осмоляльностью, а затем культивируют в данной среде с низкой осмоляльностью. Такая среда с высокой осмоляльностью проявляет более высокую осмоляльность, чем данная среда с низкой осмоляльностью, и может содержать bFGF. Осмоляльность среды с высокой осмоляльностью может составлять, например, приблизительно 300-380, 310-370, 320-360, 330-350 или 340 мОсм/кг. В альтернативном варианте осуществления осмоляльность среды с высокой осмоляльностью может составлять, например, 340±70, 340±60, 340±50, 340±40, 340±30, 340±20 или 340±10 мОсм/кг. Например, осмоляльность среды с высокой осмоляльностью может составлять приблизительно 270-280, 280-290, 290-300, 300-310, 310-320, 320-330, 330-340, 340-350, 350-360, 360-370, 370-380, 380-390, 390-400 или 400-410 мОсм/кг. В альтернативном варианте осуществления осмоляльность среды с высокой осмоляльностью может составлять по меньшей мере приблизительно 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 или 410 мОсм/кг. Некоторая среда с высокой осмоляльностью содержит одно или более из бычьего сывороточного альбумина, bFGF, трансформирующего фактора роста β (TGFβ), хлорида лития, пипеколиновой кислоты и гамма-аминомасляной кислоты (GABA). К примерам сред с высокой осмоляльностью относится среда mTeSR™ (Stemcell Technologies). В некоторых вариантах осуществления неплюрипотентные клетки, трансформированные для проявления плюрипотентного состояния, можно первоначально культивировать в среде с высокой осмоляльностью, содержащей bFGF, пока они не начнут проявлять характеристики интактного или выглядящего интактным состояния, и с этого времени клетки культивируют в среде с низкой осмоляльностью. В одном примере клетки можно культивировать в среде с высокой осмоляльностью, содержащей bFGF, в течение периода по меньшей мере 1, 2, 5, 10, 30, 60 или 90 дней, периода 1, 2, 4, 8 или 12 недель или периода от 1 дня до 3 месяцев. Пример периода времени для культивирования в среде с высокой осмоляльностью, содержащей bFGF, составляет 2 месяца.

В других вариантах осуществления неплюрипотентные клетки, трансформированные для проявления плюрипотентного состояния, можно первоначально культивировать в среде с высокой осмоляльностью, содержащей bFGF, пока они не начнут проявлять морфологию, характеризующуюся трехмерными скоплениями клеток, и с этого времени клетки культивируют в среде с низкой осмоляльностью. В таких вариантах осуществления клетки, образующие трехмерные скопления, можно отбирать, диссоциировать (например, трипсином) и переносить в новую культуру в среде с низкой осмоляльностью, описанной в настоящем документе.

Термины «сохранять», «поддерживать», «сохранение», «поддерживание», «сохранность» относятся к стабильному сохранению по меньшей мере одной или более характеристик или фенотипов человеческих ИПС-клеток, описанных в настоящем документе. Такие характеристики могут включать в себя сохранение плюрипотентности, клеточной морфологии, профилей экспрессии генов и/или других функциональных характеристик интактных клеток. Термины «сохранять», «сохранение», «сохранность» могут также охватывать размножение клеток и/или увеличение числа культивируемых интактных клеток. Термины охватывают условия культивирования, предотвращающие переход клеток в праймированное или неплюрипотентное состояние. Данные термины дополнительно включают условия культивирования, которые позволяют клеткам оставаться плюрипотентными и/или интактными, при этом может продолжаться или не продолжаться деление и увеличение количества клеток.

В одном варианте осуществления человеческие ИПС-клетки культивируют in vitro в среде, предложенной в настоящем документе, пригодной для сохранения таких клеток в интактном или выглядящем интактным состоянии. В одном конкретном примере человеческие ИПС-клетки можно культивировать в подходящей среде в течение периода времени 1, 2, 5, 7, 10, 14, 21 или 28 дней или в течение периода времени приблизительно 2 недель, приблизительно 3 недель, приблизительно 4 недель или более, пока культивируемые клетки сохраняются в интактном или выглядящем интактным состоянии. Клетки можно культивировать в течение по меньшей мере 1, 2, 3 или 4 недель. Иногда клетки культивируют в течение 1-4 недель. Человеческие ИПС-клетки можно сохранять, например, в течение любого периода времени, достаточного для размножения клеток в культуре, генетической модификации клеток и/или пересева клеток.

В другом варианте осуществления человеческие ИПС-клетки или неплюрипотентные клетки, трансформированные для экспрессии плюрипотентного состояния, можно культивировать на субстрате или слое питающих клеток, подходящем для культивирования in vitro. В одном конкретном примере клетки культивируют на субстрате MATRIGEL™ (BD Biosciences). В другом примере клетки культивируют на питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF). В другом примере клетки культивируют на субстрате GELTREX™ (Life Technologies). В другом примере клетки культивируют на витронектине (например, VITRONECTIN XF™ (STEMCELL Technologies)).

В еще одном варианте осуществления время удвоения человеческих ИПС-клеток, культивированных в данной среде с низкой осмоляльностью, снижено по сравнению с праймированными человеческими ИПС-клетками или неплюрипотентными клетками, трансформированными для проявления плюрипотентного состояния. В одном конкретном примере время удвоения данных человеческих ИПС-клеток составляет приблизительно 16-24 часа.

D. Генетические модификации и способы получения нацеленных генетических модификаций

В некоторых вариантах осуществления способы получения и сохранения человеческих ИПС-клеток включают в себя введение генетической модификации в человеческие ИПС-клетки. Аналогично, в изобретении предлагаются человеческие ИПС-клетки, содержащие генетическую модификацию.

В конкретных вариантах осуществления генетическая модификация включает в себя модификацию одной или более эндогенных нуклеиновых кислот, замену в одной или более эндогенных нуклеиновых кислот, замещение эндогенной нуклеиновой кислоты гетерологичной нуклеиновой кислотой, нокаут или нокин. В конкретных примерах генетическую модификацию внедряют путем введения большого нацеливающего вектора (LTVEC) в человеческие ИПС-клетки или неплюрипотентные клетки, трансформированные для проявления плюрипотентного состояния. В таком примере LTVEC может содержать ДНК, предназначенную для вставки в геном клеток. Можно использовать различные способы получения нацеленных генетических модификаций в человеческих ИПС-клетках. Например, можно использовать различные способы получения нацеленных генетических модификаций, которые изменяют содержание и/или активность белков в человеческих ИПС-клетках. Например, в одном случае для нацеленной генетической модификации используется система, которая будет производить нацеленную генетическую модификацию посредством события гомологичной рекомбинации (HR). Направляемая гомологией репарация (HDR) или HR включает в себя форму репарации нуклеиновых кислот, для которой может потребоваться гомология нуклеотидной последовательности, и в ней используется «донорская» молекула для репарации по ее шаблону «целевой» молекулы (т.е. молекулы, подвергшейся двухцепочечному разрыву), и она приводит к переносу генетической информации от донора к мишени. Безотносительно к какой-либо конкретной теории, такой перенос может быть связан с коррекцией несовпадений гетеродуплексной ДНК, сформированной расщепленной мишенью и донором, и/или синтез-зависимым отжигом нитей, при котором донор используется для повторного синтеза генетической информации, которая становится частью мишени, и/или родственным процессом. В некоторых случаях полинуклеотид-донор, участок полинуклеотида-донора, копия полинуклеотида-донора или участок копии полинуклеотида-донора встраивается в целевую ДНК. В других случаях клетку можно модифицировать с использованием нуклеазных агентов, которые производят одно- или двухцепочечный разрыв в местоположении целевого генома. Одно- или двухцепочечный разрыв затем восстанавливается посредством пути соединения негомологичных концов (NHEJ). NHEJ включает в себя репарацию двухцепочечных разрывов нуклеиновой кислоты путем прямого сшивания концов разрыва друг с другом без необходимости в гомологичном шаблоне. Сшивание несмежных последовательностей методом NHEJ часто может приводить к делециям, вставкам или перемещениям вблизи области двухцепочечного разрыва. Такие системы находят применение, например, в производстве нацеленных генетических модификаций потери функции. Не имеющие ограничительного характера способы создания такой нацеленной генетической модификации подробно описаны в других разделах настоящего документа, включая, например, использование нацеливающих плазмид или больших нацеливающих векторов. См. также публикации Wang et al. (2013) Cell 153:910-918, Mandalos et al. (2012) PLOS ONE 7:e45768:1-9 и Wang et al. (2013) Nat Biotechnol. 31:530-532, каждая из которых включена в настоящий документ путем ссылки. Признается, что в конкретных вариантах осуществления нацеленная генетическая модификация любого интересующего полинуклеотида может происходить в процессе того, как плюрипотентная клетка (т.е. человеческая ИПС-клетка) сохраняется в культуральной среде, описанной в настоящем документе. В альтернативном варианте осуществления нацеленная генетическая модификация любого интересующего полинуклеотида может происходить в процессе того, как плюрипотентная клетка (т.е. человеческая ИПС-клетка) поддерживается в другой культуральной среде, а затем переносится в культуральную среду с низкой осмоляльностью, описанную в настоящем документе.

В общем случае уровень и/или активность белка модифицированы, если уровень белка и/или уровень активности белка статистически выше или ниже, чем уровень белка в подходящей контрольной клетке, которую не подвергали генетической модификации или мутагенезу для изменения экспрессии и/или активности белка. В конкретных вариантах осуществления концентрация и/или активность белка изменены на по меньшей мере 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% или 90% по отношению к контрольной клетке, которую не подвергали модификации для получения модифицированного уровня и/или активности белка. «Клетка-субъект» представляет собой клетку, в которой осуществили генетическое изменение, такое как генетическая модификация, описанная в настоящем документе, или представляет собой клетку, которая произошла от измененной таким образом клетки и которая содержит данное изменение. «Контроль» или «контрольная клетка» обеспечивает эталонную точку для измерения изменений в фенотипе клетки-субъекта. В одном варианте осуществления контрольная клетка наиболее близко соответствует клетке со сниженной активностью белка, за исключением того, что у нее отсутствует генетическая модификация или мутация, приводящая к модифицированной активности (например, соответствующие клетки могут происходить из одной и той же клеточной линии). В других случаях контрольная клетка может представлять собой, например: (а) клетку дикого типа, т.е. тот генотип, который используется как исходный материал для генетического изменения, которое привело к получению клетки-субъекта; (b) клетку, имеющую тот же генотип, что и исходный материал, но которая была модифицирована нулевым конструктом (т.е. конструктом, не оказывающим известного воздействия на интересующий признак, такой как конструкт, содержащий маркерный ген); (с) клетку, представляющую собой не имеющее генетической модификации потомство клетки-субъекта (т.е. контрольная клетка и клетка-субъект происходят от одной клеточной линии); (d) клетку, генетически идентичную клетке-субъекту, но не подверженную воздействию условий или стимулов, которые могут индуцировать экспрессию интересующего гена; или (е) саму клетку-субъекта в условиях, в которых генетическая модификация не приводит к изменениям в экспрессии интересующего полинуклеотида.

Уровень экспрессии полипептида можно измерять непосредственно, например с помощью анализа измерения уровня полипептида в клетке или организме, или опосредованно, например посредством измерения активности полипептида. В других случаях клетки, имеющие нацеленную генетическую модификацию, выбирают с использованием способов, которые включают, без ограничений, анализ саузерн-блот, секвенирование ДНК, анализ ПЦР или фенотипический анализ. Такие клетки затем используют в различных способах и композициях, описанных в настоящем документе.

Нацеленная генетическая модификация может включать в себя нацеленное изменение интересующего полинуклеотида. Такие нацеленные модификации включают, без ограничений, добавление одного или более нуклеотидов, делеции одного или более нуклеотидов, замены одного или более нуклеотидов, нокаут интересующего полинуклеотида или его части, нокин интересующего полинуклеотида или его части, замещение эндогенной нуклеотидной последовательности гетерологичной нуклеотидной последовательностью или их комбинацию. В конкретных вариантах осуществления по меньшей мере 1, 2, 3, 4, 5, 7, 8, 9, 10, 100, 500 или более нуклеотидов или по меньшей мере 10-500 т.п.н. или более изменяют таким образом, чтобы образовать нацеленную геномную модификацию.

В других вариантах осуществления активность и/или уровень полипептида модифицированы посредством введения в клетку полинуклеотида, который изменяет уровень или активность полипептида. Полинуклеотид может модифицировать экспрессию полипептида непосредственно, изменяя трансляцию информационной РНК, или косвенно, кодируя полипептид, изменяющий транскрипцию или трансляцию гена, кодирующего белок. В других вариантах осуществления активность полипептида модифицирована посредством введения в клетку последовательности, кодирующей полипептид, который меняет активность целевого полипептида. В одном варианте осуществления человеческие ИПС-клетки могут содержать условный аллель, модифицирующий активность и/или уровень белка. «Условный аллель» включает в себя модифицированный ген, разработанный с модифицированным уровнем и/или активностью белка в заданный момент развития и/или в пределах заданной интересующей ткани. Модифицированные уровень и/или активность можно сравнивать с контрольной клеткой, в которой отсутствует модификация, дающая начало условному аллелю, или, в случае модифицированной активности во время заданного момента развития, с предыдущими и/или последующими моментами, или, в случае заданной ткани, со средней активностью всех тканей. В одном варианте осуществления условный аллель представляет собой условный нулевой аллель гена, который можно выключать или включать в заданный момент развития и/или в конкретных тканях.

В не имеющем ограничительного характера варианте осуществления условный аллель является многофункциональным аллелем, как описано в публикации US 2011/0104799, которая в полном объеме включена в настоящий документ путем ссылки. В конкретных вариантах осуществления условный аллель содержит: (а) активирующую последовательность в смысловой ориентации по отношению к транскрипции целевого гена и кассету селекции лекарственными средствами (DSC) в смысловой или антисмысловой ориентации; (b) находящуюся в антисмысловой ориентации интересующую нуклеотидную последовательность (NSI) и условный по инверсии модуль (COIN, в котором используется разделяющий экзон интрон и инвертируемый модуль, подобный генной ловушке; см., например, публикацию US 2011/0104799, которая полностью включена в настоящий документ путем ссылки); и (с) рекомбинируемые блоки, которые рекомбинируются при воздействии первой рекомбиназой с образованием условного аллеля, который (i) не имеет активирующей последовательности и DSC, и (ii) содержит NSI в смысловой ориентации и COIN в антисмысловой ориентации.

Настоящее изобретение позволяет модифицировать целевой геномный локус на хромосоме в клетке. В конкретных вариантах осуществления способы, предложенные в настоящем документе, позволяют выполнять нацеливание на геномный локус на хромосоме посредством использования нацеливающего вектора при отсутствии нуклеазного агента или в комбинации с ним.

Способы получения нацеленных генетических модификаций могут включать в себя, например, использование нацеливающего вектора (например, LTVEC), отдельно или в комбинации с одной или более нуклеазами, как описано в других частях настоящего документа. См., например, публикации US 2015/0159175, US 2015/0159174, US 2014/0310828, US 2014/0309487 и US 2013/0309670, каждая из которых во всех отношениях полностью включена в настоящий документ путем ссылки. Аналогично, способы получения нацеленных генетических модификаций могут включать в себя использование одной или более нуклеаз отдельно или в комбинации с нацеливающим вектором.

Например, предлагаются способы модификации целевого геномного локуса в человеческой ИПС-клетке, включающие в себя: (а) внедрение в клетку одного или более нуклеазных агентов, которые создают один или более одноцепочечных или двухцепочечных разрывов в сайте распознавания в целевом геномном локусе или вблизи него; и (b) идентификацию по меньшей мере одной клетки, содержащей в своем геноме модификацию целевого геномного локуса. Такие способы могут приводить к нарушению целевого геномного локуса. Нарушение эндогенной нуклеотидной последовательности может возникать, например, когда двухцепочечный разрыв, созданный нуклеазой, восстанавливается путем репарации ДНК, опосредуемой негомологичным соединением концов (NHEJ), вследствие чего получается мутантный аллель, содержащий вставку или делецию в нуклеотидной последовательности, и тем самым геномный локус нарушается. К примерам нарушения относится изменение регуляторного элемента (например, промотора или энхансера), миссенс-мутация, несмысловая мутация, мутация сдвига рамки считывания, мутация укорочения, нуль-мутация или вставка или делеция небольшого количества нуклеотидов (например, приводящая к мутации сдвига рамки считывания). Нарушение может приводить к деактивации (т.е. утрате функции) или потере аллеля.

Другие способы модификации целевого геномного локуса в человеческой ИПС-клетке включают в себя: (а) введение в клетку нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым сайтам; и (b) идентификацию по меньшей мере одной клетки, содержащей в своем геноме полинуклеотидную вставку, интегрированную в целевой геномный локус.

Другие способы модификации целевого геномного локуса в человеческой ИПС-клетке включают в себя: (а) введение в клетку: (i) нуклеазного агента, причем нуклеазный агент индуцирует одно- или двухцепочечный разрыв в первом сайте распознавания в целевом геномном локусе; и (ii) нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым сайтам, расположенным достаточно близко к сайту распознавания; и (с) идентификацию по меньшей мере одной клетки, содержащей модификацию (например, интегрированную полинуклеотидную вставку) в целевом геномном локусе. Такие способы могут приводить к различным типам нацеленных генетических модификаций. Такие нацеленные модификации могут включать в себя, например, добавление одного или более нуклеотидов, делеции одного или более нуклеотидов, замены одного или более нуклеотидов, точечную мутацию, нокаут интересующего полинуклеотида или его части, нокин интересующего полинуклеотида или его части, замещение эндогенной нуклеотидной последовательности гетерологичной, экзогенной или ортологичной нуклеотидной последовательностью, перестановку доменов, перестановку экзонов, перестановку интронов, перестановку регуляторных последовательностей, перестановку генов или их комбинацию. Например, по меньшей мере 1, 2, 3, 4, 5, 7, 8, 9, 10 или более нуклеотидов могут изменять таким образом, чтобы образовать нацеленную геномную модификацию. Делеции, вставки и замещения могут иметь любой размер, как описано в других частях настоящего документа.

а. Нуклеазные агенты и сайты распознавания для нуклеазных агентов

Термин «сайт распознавания для нуклеазного агента» включает последовательность ДНК, в которой нуклеазный агент индуцирует одно- или двухцепочечный разрыв. Сайт распознавания для нуклеазного агента может быть эндогенным (или нативным) по отношению к клетке, или сайт распознавания может быть экзогенным по отношению к клетке. В конкретных вариантах осуществления сайт распознавания является экзогенным по отношению к клетке и, таким образом, не встречается в геноме клетки в природе. В других дополнительных вариантах осуществления сайт распознавания является эндогенным по отношению к клетке и интересующим полинуклеотидам, которые необходимо разместить в целевом локусе. В дополнительных вариантах осуществления экзогенный или эндогенный сайт распознавания присутствует в геноме клетки-хозяина только один раз. В конкретных вариантах осуществления идентифицирован эндогенный или нативный сайт, который присутствует в геноме только один раз. Впоследствии такой сайт может быть использован для конструирования нуклеазных агентов, которые будут создавать на эндогенном сайте распознавания одно- или двухцепочечный разрыв.

Длина сайта распознавания может изменяться и включает, например, сайты распознавания для пары нуклеаз с «цинковыми пальцами» (ZFN) длиной приблизительно 30-36 п. н. (т.е. приблизительно 15-18 п. н. для каждой ZFN), для эффекторной нуклеазы, подобной активатору транскрипции (TALEN), длиной приблизительно 36 п. н. или для гидовой РНК CRISPR/Cas9 длиной приблизительно 20 п. н.

В одном варианте осуществления каждый мономер нуклеазного агента распознает сайт распознавания длиной по меньшей мере 9 нуклеотидов. В других вариантах осуществления сайт распознавания составляет от приблизительно 9 до приблизительно 12 нуклеотидов в длину, от приблизительно 12 до приблизительно 15 нуклеотидов в длину, от приблизительно 15 до приблизительно 18 нуклеотидов в длину или от приблизительно 18 до приблизительно 21 нуклеотида в длину и любую комбинацию таких поддиапазонов (например, 9-18 нуклеотидов). Следует понимать, что данный нуклеазный агент может связывать сайт распознавания и расщеплять сайт связывания, или, в альтернативном варианте осуществления, нуклеазный агент может связываться с последовательностью, которая отличается от сайта распознавания. Кроме того, термин «сайт распознавания» содержит как сайт связывания нуклеазного агента, так и сайт одноцепочечного разрыва/расщепления, независимо от того, расположен ли сайт одноцепочечного разрыва/расщепления в пределах или за пределами сайта связывания нуклеазного агента. В другой разновидности расщепление нуклеазным агентом может происходить в положениях нуклеотидов, расположенных непосредственно друг напротив друга для производства разреза с тупым концом, или, в других случаях, разрезы могут быть ступенчатыми для производства одноцепочечных нависаний, также именуемых «липкие концы», которые могут быть 5'-нависаниями или 3'-нависаниями.

В описанных в настоящем документе способах и композициях может использоваться любой нуклеазный агент, который индуцирует одно- или двухцепочечный разрыв в заданном сайте распознавания. Встречающийся в природе, или нативный, нуклеазный агент может использоваться при условии, что нуклеазный агент индуцирует в заданном сайте распознавания одно- или двухцепочечный разрыв. В альтернативном варианте осуществления может использоваться модифицированный или сконструированный нуклеазный агент. «Сконструированный нуклеазный агент» включает нуклеазу, сконструированную (модифицированную или производную) из ее нативной формы для того, чтобы она специфически распознавала и индуцировала одно- или двухцепочечный разрыв в заданном сайте распознавания. Таким образом, сконструированный нуклеазный агент может быть получен из нативного встречающегося в природе нуклеазного агента, или он может быть создан или синтезирован искусственно. Модификация нуклеазного агента может быть незначительной, например, она может представлять собой модификацию одной аминокислоты в агенте расщепления белка или одного нуклеотида в агенте расщепления нуклеиновой кислоты. В некоторых вариантах осуществления сконструированная нуклеаза индуцирует одно- или двухцепочечный разрыв в сайте распознавания, причем сайт распознавания не является последовательностью, которая могла бы быть распознана нативным (не сконструированным или не модифицированным) нуклеазным агентом. Создание одно- или двухцепочечного разрыва в сайте распознавания или другой ДНК в настоящем документе может называться «разрезанием» или «расщеплением» сайта распознавания или другой ДНК. Также представлены активные варианты и фрагменты сайтов распознавания, приведенные в качестве примера. Идентичность последовательности таких активных вариантов данному сайту распознавания составляет по меньшей мере 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или более, причем активные варианты сохраняют биологическую активность и, следовательно, могут распознаваться и расщепляться нуклеазным агентом последовательность-специфическим образом. Анализы измерения двухцепочечного разрыва сайта распознавания посредством нуклеазного агента известны в данной области (например, из публикации TaqMan® qPCR assay, Frendewey D. et al., Methods in Enzymology, 2010, 476:295-307, которая включена в настоящий документ в полном объеме путем ссылки). Сайт распознавания нуклеазного агента можно размещать в любом месте в целевом локусе или вблизи него. Сайт распознавания может располагаться в кодирующей области гена или в регуляторных областях, влияющих на экспрессию гена. Сайт распознавания нуклеазного агента может быть расположен в интроне, экзоне, промоторе, энхансере, регуляторной области или не кодирующей белок области. В конкретных вариантах осуществления сайт распознавания расположен внутри полинуклеотида, кодирующего селективный маркер. Такое положение может находиться в пределах кодирующей области селективного маркера или в пределах регуляторных областей, оказывающих влияние на экспрессию селективного маркера. Таким образом, сайт распознавания нуклеазного агента может быть расположен в интроне селективного маркера, промоторе, энхансере, регуляторной области или любой не кодирующей белок области полинуклеотида, кодирующего селективный маркер. В конкретных вариантах осуществления одно- или двухцепочечный разрыв на сайте распознавания нарушает активность селективного маркера. Известны методы анализа на наличие или отсутствие функционального селективного маркера. В одном варианте осуществления нуклеазный агент представляет собой эффекторную нуклеазу, подобную активатору транскрипции (TALEN). TAL-эффекторные нуклеазы представляют собой класс последовательность-специфических нуклеаз, которые можно использовать для выполнения двухцепочечных разрывов на специфических целевых последовательностях в геноме прокариотического или эукариотического организма. TAL-эффекторные нуклеазы создают путем слияния нативного или сконструированного эффектора, подобного активатору транскрипции (TAL), или его функциональной части с каталитическим доменом эндонуклеазы, например FokI. Уникальный модульный TAL-эффекторный ДНК-связывающий домен обеспечивает конструирование белков с потенциально любой заданной специфичностью распознавания ДНК. Таким образом, для распознавания целевых сайтов со специфической ДНК могут быть сконструированы ДНК-связывающие домены TAL-эффекторных нуклеаз, и, таким образом, их можно использовать для двухцепочечных разрывов на заданных целевых последовательностях. См. публикацию WO 2010/079430; Morbitzer et al. (2010) PNAS 10.1073/pnas.l013133107; Scholze & Boch (2010) Virulence 1:428-432; Christian et al. Genetics (2010) 186:757-761; Li et al. (2010) Nuc. Acids Res. (2010) doi:10.1093/nar/gkq704; and Miller et al. (2011) Nature Biotechnology 29:143-148; все из которых включены в настоящий документ путем ссылки. Примеры подходящих TAL-нуклеаз и способы получения подходящих TAL-нуклеаз описаны, например, в заявках на патент США №№2011/0239315 А1, 2011/0269234 А1, 2011/0145940 А1, 2003/0232410 А1, 2005/0208489 А1, 2005/0026157 А1, 2005/0064474 А1, 2006/0188987 А1 и 2006/0063231 А1 (каждая включена в настоящий документ путем ссылки). В различных вариантах осуществления сконструированы TAL-эффекторные нуклеазы, которые «выполняют разрез» в целевой нуклеотидной последовательности или возле нее, например в интересующем локусе или интересующем геномном локусе, в котором целевая нуклеотидная последовательность находится на последовательности, подлежащей модификации посредством нацеливающего вектора, или возле нее. TAL-нуклеазы, подходящие для использования с различными способами и композициями, предложенными в настоящем документе, включают те, которые специфически разработаны для связывания на целевой нуклеотидной последовательности, подлежащей модификации посредством нацеливающих векторов, или возле нее, как описано в настоящем документе. В одном варианте осуществления каждый мономер TALEN содержит 12-25 повторов TAL, причем каждый повтор TAL связывается с подсайтом в 1 п. н. В некоторых TALEN каждый мономер TALEN содержит 33-35 повторов TAL, которые распознают одну пару нуклеотидов с помощью двух гипервариабельных остатков. В одном варианте осуществления нуклеазный агент представляет собой химерный белок, содержащий ДНК-связывающий домен на основе TAL-повторов, функционально связанный с независимой нуклеазой. В одном варианте осуществления независимая нуклеаза представляет собой эндонуклеазу FokI. В одном варианте осуществления нуклеазный агент содержит первый ДНК-связывающий домен на основе TAL-повторов и второй ДНК-связывающий домен на основе TAL-повторов, причем каждый из первого и второго ДНК-связывающих доменов на основе TAL-повторов функционально связан с нуклеазой FokI, при этом первый и второй ДНК-связывающие домены на основе TAL-повторов распознают две смежные целевые последовательности ДНК в каждой цепи целевой последовательности ДНК, разделенные сайтом расщепления размером от приблизительно 6 п. н. до приблизительно 40 п. н., причем нуклеазы FokI димеризуются и создают двухцепочечный разрыв на целевой последовательности. Например, нуклеазный агент может содержать первый ДНК-связывающий домен на основе TAL-повторов и второй ДНК-связывающий домен на основе TAL-повторов, причем каждый из первого и второго ДНК-связывающих доменов на основе TAL-повторов функционально связан с нуклеазой FokI, при этом первый и второй ДНК-связывающие домены на основе TAL-повторов распознают две смежные целевые последовательности ДНК в каждой цепи целевой последовательности ДНК, разделенные последовательностью спейсера различной длины (12-20 п. н.), и при этом субъединицы нуклеазы FokI димеризуются для создания активной нуклеазы, которая выполняет двухцепочечный разрыв на целевой последовательности.

Нуклеазный агент, используемый в различных способах и композициях, описанных в настоящем документе, может дополнительно содержать нуклеазу с «цинковыми пальцами» (ZFN). В одном варианте осуществления каждый мономер ZFN содержит 3 или более ДНК-связывающих доменов на основе «цинковых пальцев», причем каждый ДНК-связывающий домен на основе «цинковых пальцев» связывается с субсайтом из 3 п. н. В других вариантах осуществления ZFN представляет собой химерный белок, содержащий ДНК-связывающий домен на основе «цинковых пальцев», функционально связанный с независимой нуклеазой. В одном варианте осуществления независимая эндонуклеаза представляет собой эндонуклеазу FokI. В одном варианте осуществления нуклеазный агент содержит первую ZFN и вторую ZFN, причем каждая из первой ZFN и второй ZFN функционально связана с нуклеазой FokI, при этом первая и вторая ZFN распознают две смежные целевые последовательности ДНК в каждой цепи целевой последовательности ДНК, разделенные сайтом расщепления размером от приблизительно 6 п. н. до приблизительно 40 п. н., причем нуклеазы FokI димеризуются и создают двухцепочечный разрыв. Например, нуклеазный агент может содержать первую ZFN и вторую ZFN, причем каждая из первой ZFN и второй ZFN функционально связана с субъединицей нуклеазы FokI, при этом первая и вторая ZFN распознают две смежные целевые последовательности ДНК в каждой цепи целевой последовательности ДНК, разделенные спейсером длиной приблизительно 5-7 п. н., и при этом субъединицы нуклеазы FokI димеризуются для создания активной нуклеазы, которая выполняет двухцепочечный разрыв. См., например, публикации US 20060246567; US 20080182332; US 20020081614; US 20030021776; WO/2002/057308A2; US 20130123484; US 20100291048; и WO/2011/017293А2, каждая из которых включена в настоящий документ путем ссылки.

В еще одном варианте осуществления нуклеазный агент представляет собой мегануклеазу. Мегануклеазы были разделены на четыре семейства на основе консервативных мотивов последовательностей, семейства представляют собой LAGLIDADG, GIY-YIG, H-N-H и His-Cys box. Эти мотивы участвуют в координации ионов металлов и гидролизе фосфодиэфирных связей. Мегануклеазы отличаются своими длинными сайтами распознавания и допуском некоторых видов полиморфизма последовательностей в их ДНК-субстратах. Домены мегануклеаз, их структура и функции известны, см., например, Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199-248; Lucas et al., (2001) Nucleic Acids Res 29:960-9; Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304-26; Stoddard, (2006) Q Rev Biophys 38:49-95; и Moure et al., (2002) Nat Struct Biol 9:764. В некоторых примерах используют встречающийся в природе вариант и/или сконструированное производное мегануклеазы. Известны способы изменения кинетики, взаимодействия кофакторов, экспрессии, оптимальных условий и/или специфичности сайтов распознавания и скрининга по активности, см., например, Epinat et al., (2003) Nucleic Acids Res 31:2952-62; Chevalier et al., (2002) Mol Cell 10:895-905; Gimble et al., (2003) Mol Biol 334:993-1008; Seligman et al., (2002) Nucleic Acids Res 30:3870-9; Sussman et al., (2004) J Mol Biol 342:31-41; Rosen et al., (2006) Nucleic Acids Res 34:4791-800; Chames et al., (2005) Nucleic Acids Res 33:e178; Smith et al., (2006) Nucleic Acids Res 34:e149; Gruen et al., (2002) Nucleic Acids Res 30:e29; Chen and Zhao, (2005) Nucleic Acids Res 33:e154; WO 2005105989; WO 2003078619; WO 2006097854; WO 2006097853; WO2006097784; и WO 2004031346. Здесь может использоваться любая мегануклеаза, включая, без ограничений, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SceVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI, I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-Nsp236IP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorI, 1-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP, I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII или их любые активные варианты или фрагменты.

В одном варианте осуществления мегануклеаза распознает двухцепочечные последовательности ДНК, состоящие из 12-40 пар нуклеотидов. В одном варианте осуществления мегануклеаза распознает одну идеально соответствующую целевую последовательность в геноме. В одном варианте осуществления мегануклеаза представляет собой самонаводящуюся нуклеазу. В одном варианте осуществления самонаводящаяся нуклеаза принадлежит к семейству самонаводящихся нуклеаз LAGLIDADG. В одном варианте осуществления семейство самонаводящихся нуклеаз LAGLIDADG выбирают из I-SceI, I-CreI и I-Dmol.

Нуклеазные агенты могут дополнительно содержать рестрикционные эндонуклеазы, которые включают эндонуклеазы I типа, II типа, III типа и IV типа. Рестрикционные эндонуклеазы I типа и III типа распознают специфические сайты распознавания, но, как правило, осуществляют расщепление в разных положениях на расстоянии от сайта связывания нуклеазы, которые могут находиться на расстоянии сотен пар нуклеотидов от сайта расщепления (сайта распознавания). В системах II типа рестрикционная активность не зависит от метилазной активности, и расщепление обычно происходит в специфических сайтах в пределах сайта связывания или вблизи него. Большинство ферментов II типа разрезает палиндромные последовательности, однако ферменты IIа типа распознают непалиндромные сайты распознавания и осуществляют расщепление за пределами сайта распознавания, ферменты IIb типа разрезают последовательности дважды на двух сайтах за пределами сайта распознавания, а ферменты IIs типа распознают асимметричный сайт распознавания и осуществляют расщепление с одной стороны и на определенном расстоянии от сайта распознавания, составляющем приблизительно 1-20 нуклеотидов. Рестрикционные ферменты IV типа нацелены на метилированную ДНК. Рестрикционные ферменты дополнительно описаны и классифицированы, например, в базе данных REBASE (веб-страница по адресу rebase.neb.com; Roberts et al., (2003) Nucleic Acids Res 31:418-20), Roberts et al., (2003) Nucleic Acids Res 31:1805-12 и Belfort et 7al., (2002) в сборнике Mobile DNA II, pp.761-783, под. ред. Craigie et al. (ASM Press, Washington, DC).

Нуклеазный агент, использованный в различных способах и композициях, может также содержать систему коротких палиндромных повторов, регулярно расположенных группами (CRISPR)/CRISPR-ассоциированного белка (Cas), или компоненты такой системы. Системы CRISPR/Cas включают в себя транскрипты и другие элементы, участвующие в экспрессии или управлении активностью генов Cas. Система CRISPR/Cas может представлять собой систему I типа, II типа или III типа. В способах и композициях, описанных в настоящем документе, для сайт-направленного расщепления нуклеиновых кислот используются системы CRISPR/Cas посредством использования комплексов CRISPR (содержащих гидовую РНК (гРНК), образующую комплекс с белком Cas).

Некоторые системы CRISPR/Cas, используемые в способах, описанных в настоящем документе, не встречаются в природе. «Не встречающаяся в природе» система имеет признаки вмешательства человека, например один или более компонентов системы изменены или мутированы по сравнению с их природным состоянием, при этом они по меньшей мере по существу не содержат по меньшей мере один другой компонент, с которым они естественно ассоциированы в природе, или они ассоциированы по меньшей мере с другим компонентом, с которым они не ассоциированы в природе. Например, в некоторых системах CRISPR/Cas используются не встречающиеся в природе комплексы CRISPR, которые содержат гРНК и белок Cas, не встречающиеся в природе вместе.

Белки Cas обычно содержат по меньшей мере один домен распознавания или связывания РНК. Такие домены могут взаимодействовать с гидовыми РНК (гРНК, описанными более подробно ниже). Белки Cas могут также содержать нуклеазные домены (например, домены ДНКазы или РНКазы), ДНК-связывающие домены, геликазные домены, домены межбелковых взаимодействий, домены димеризации и другие домены. Нуклеазный домен обладает каталитической активностью в отношении расщепления нуклеиновых кислот. Расщепление включает разрушение ковалентных связей молекулы нуклеиновой кислоты. В результате расщепления могут образовываться тупые концы или ступенчатые концы, и расщепление может быть одноцепочечным или двухцепочечным.

Примеры белков Cas включают Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 или Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 и Cu1966 и их гомологи или модифицированные варианты.

В некоторых случаях белок Cas относится к системе CRISPR/Cas типа II. Например, белок Cas может быть белком Cas9 или может быть получен из белка Cas9. Белки Cas9 обычно имеют четыре общих основных мотива с консервативной архитектурой.

Мотивы 1, 2 и 4 представляют собой RuvC-подобные мотивы, а мотив 3 представляет собой мотив HNH. Белок Cas9 может быть получен из, например, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, AlicyclobacHlus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospiraplatensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus или Acaryochloris marina. Белок Cas9 может быть получен из Staphylococcus aureus. Дополнительные примеры представителей семейства Cas9 включают описанные в публикации WO 2014/131833, которая полностью включена в настоящий документ путем ссылки. В одном конкретном примере белок Cas9 представляет собой белок Cas9 из S. pyogenes или его производное. Аминокислотную последовательность белка Cas9 из S. pyogenes можно найти, например, в базе данных SwissProt под номером доступа Q99ZW2.

Белки Cas могут являться белками дикого типа (т.е. встречающимися в природе), модифицированными белками Cas (т.е. вариантами белков Cas) или фрагментами белков Cas дикого типа или модифицированных белков Cas. Белки Cas могут также являться активными вариантами или фрагментами белков Cas дикого типа или модифицированных белков Cas. Идентичность последовательности таких активных вариантов или фрагментов белку Cas дикого типа или модифицированному белку Cas или его части может составлять по меньшей мере 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или более, причем активные варианты сохраняют способность разрезания на требуемом сайте расщепления и, следовательно, сохраняют активность, индуцирующую одно- или двухцепочечный разрыв. Анализы определения активности, индуцирующей одно- или двухцепочечный разрыв, известны и, как правило, измеряют общую активность и специфичность белка Cas на субстратах ДНК, содержащих сайт расщепления.

Белки Cas могут быть модифицированы для увеличения или уменьшения аффинности связывания нуклеиновых кислот, специфичности связывания нуклеиновых кислот и/или ферментативной активности. Белки Cas могут также быть модифицированы для изменения любого другого вида активности или свойства белка, например стабильности. Например, один или более нуклеазных доменов белка Cas могут быть изменены, удалены или инактивированы, или белок Cas может быть усечен, чтобы удалить домены, которые не являются необходимыми для функционирования белка, или для оптимизации (например, увеличения или уменьшения) активности белка Cas. Некоторые белки Cas содержат по меньшей мере два нуклеазных домена, таких как домены ДНКазы. Например, белок Cas9 может содержать RuvC-подобный нуклеазный домен и HNH-подобный нуклеазный домен. Каждый из доменов RuvC и HNH может разрезать отличную цепь двухцепочечной ДНК, чтобы выполнить двухцепочечный разрыв в ДНК. См., например, публикацию Jinek et al. (2012) Science 337:816-821, которая полностью включена в настоящий документ путем ссылки. Один или оба нуклеазных домена могут быть удалены или подвергнуты мутации таким образом, чтобы прекратить их функционирование или уменьшить нуклеазную активность. При удалении или мутации одного из нуклеазных доменов полученный белок Cas (например, Cas9) может называться «никаза» и может производить одноцепочечный разрыв на целевой последовательности в пределах двухцепочечной ДНК, но не двухцепочечный разрыв (т.е. он может расщеплять комплементарную цепь или некомплементарную цепь, но не обе). При удалении или мутации обоих нуклеазных доменов полученный белок Cas (например, Cas9) будет иметь пониженную способность расщеплять обе цепи двухцепочечной ДНК. Примером мутации, превращающей Cas9 в никазу, является мутация D10A (замена аспартата на аланин в положении 10 Cas9) в домене RuvC белка Cas9 из S. pyogenes. Подобным образом мутация Н939А (замена гистидина на аланин в положении аминокислоты 839) или Н840А (замена гистидина на аланин в положении аминокислоты 840) в домене HNH Cas9 из S. pyogenes может превращать Cas9 в никазу. Другие примеры мутаций, превращающих Cas9 в никазу, включают соответствующие мутации Cas9 из S. thermophilus. См., например, публикации Sapranauskas et al. (2011) Nucleic Acids Research 39:9275-9282 и WO 2013/141680, каждая из которых полностью включена в настоящий документ путем ссылки. Такие мутации могут быть созданы с использованием таких известных способов, как сайт-направленный мутагенез, ПЦР-опосредованный мутагенез или полный синтез гена. Примеры других мутаций, создающих никазы, можно найти, например, в публикациях WO/2013/176772A1 и WO/2013/142578A1, каждая из которых включена в настоящий документ путем ссылки. Белки Cas также могут представлять собой слитые белки. Например, белок Cas может быть слит с доменом расщепления, доменом эпигенетических модификаций, доменом транскрипционной активации или доменом транскрипционного репрессора. См. публикацию WO 2014/089290, которая полностью включена в настоящий документ путем ссылки. Белки Cas также могут быть слиты с гетерологичным полипептидом, обеспечивающим повышенную или сниженную стабильность. Слитый домен или гетерологичный полипептид может быть расположен на N-конце, на С-конце или находиться внутри белка Cas.

Одним примером слитого белка Cas является белок Cas, слитый с гетерологичным полипептидом, который обеспечивает субклеточную локализацию. Такие последовательности могут включать в себя, например, сигнал ядерной локализации (NLS), например NLS SV40, для нацеливания на ядро, сигнал митохондриальной локализации для нацеливания на митохондрии, сигнал удержания ER и т.п. См., например, Lange et al. (2007) J. Biol. Chem. 282:5101-5105. Такие сигналы субклеточной локализации могут быть расположены на N-конце, на С-конце или в других местах внутри белка Cas. NLS может содержать участок из основных аминокислот и может быть представлен одинарной последовательностью или двойной последовательностью.

Белки Cas могут также содержать проникающий в клетку домен. Например, проникающий в клетку домен может быть получен из белка TAT HIV-1, проникающего в клетку мотива TLM из вируса гепатита В человека, MPG, Рер-1, VP22, проникающего в клетку пептида из вируса простого герпеса или из последовательности пептида полиаргинина. См., например, публикацию WO 2014/089290, которая полностью включена в настоящий документ путем ссылки. Проникающий в клетку домен может быть расположен на N-конце, на С-конце или в других местах внутри белка Cas.

Белки Cas также могут содержать гетерологичный полипептид для простоты отслеживания или очистки, например флуоресцентный белок, метку очистки или эпитопную метку. Примеры флуоресцентных белков включают зеленые флуоресцентные белки (например, GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, мономерный Azami Green, CopGFP, AceGFP, ZsGreenl), желтые флуоресцентные белки (например, YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), синие флуоресцентные белки (например, eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), голубые флуоресцентные белки (например, eCFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), красные флуоресцентные белки (mKate, mKate2, mPlum, мономерный DsRed, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), оранжевые флуоресцентные белки (mOrange, mKO, Kusabira-Orange, мономерный Kusabira-Orange, mTangerine, tdTomato) и любые другие подходящие флуоресцентные белки. Примеры меток включают глутатион-S-трансферазу (GST), хитин-связывающий белок (СВР), мальтоза-связывающий белок, тиоредоксин (TRX), поли(NANP), метку тандемной аффинной очистки (ТАР), myc, AcV5, AU1, AU5, Е, ECS, Е2, FLAG, гемагглютинин (НА), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, гистидин (His), биотин-карбоксил-переносящий белок (BCCP) и кальмодулин.

Белки Cas могут быть обеспечены в любом виде. Например, белок Cas может быть обеспечен в виде белка, такого как белок Cas, образующий комплекс с гРНК. В альтернативном варианте осуществления белок Cas может быть обеспечен в виде нуклеиновой кислоты, кодирующей белок Cas, например РНК (например, матричной РНК (мРНК)) или ДНК. Необязательно, нуклеиновая кислота, кодирующая белок Cas, может быть кодон-оптимизированной для эффективной трансляции в белок в конкретной клетке или организме (т.е. человеческой клетке). Если в клетку вводят нуклеиновую кислоту, кодирующую белок Cas, то белок Cas может экспрессироваться внутри клетки временно, условно или конститутивно.

Нуклеиновые кислоты, кодирующие белки Cas, могут быть стабильно интегрированы в геном клетки и функционально связаны с промотором, активным в клетке. В альтернативном варианте осуществления нуклеиновые кислоты, кодирующие белки Cas, могут быть функционально связаны с промотором в экспрессионной конструкции. Экспрессионные конструкции включают в себя любые нуклеотидные конструкции, которые способны управлять экспрессией гена или другой интересующей нуклеотидной последовательности (например, гена Cas) и которые могут переносить такую интересующую нуклеотидную последовательность в клетку-мишень. Например, нуклеиновая кислота, кодирующая белок Cas, может находиться в нацеливающем векторе, содержащем полинуклеотидную вставку, и/или в векторе, содержащем ДНК, кодирующую гРНК. В альтернативном варианте осуществления она может находиться в векторе или плазмиде, отдельной от нацеливающего вектора и содержащей полинуклеотидную вставку и/или отдельной от вектора, содержащего ДНК, кодирующую гРНК. К промоторам, которые можно использовать в экспрессионной конструкции, относятся, например, промоторы, активные в человеческой ИПС-клетке или неплюрипотентной клетке, трансформированной для проявления интактного состояния. Такие промоторы могут представлять собой, например, условные промоторы, индуцируемые промоторы, конститутивные промоторы или тканеспецифические промоторы.

«Гидовая РНК», или «гРНК», включает в себя молекулу РНК, которая связывается с белком Cas и нацеливает белок Cas в специфическое местоположение внутри целевой ДНК. Гидовые РНК могут содержать два сегмента: «сегмент ДНК-нацеливания» и «белок-связывающий сегмент». «Сегмент» представляет собой сегмент, часть или область молекулы, например непрерывный участок из нуклеотидов в РНК. Некоторые гРНК содержат две отдельные молекулы РНК: «РНК-активатор» и «РНК-нацеливатель». Другие гРНК представляют собой одинарные молекулы РНК (одинарный полинуклеотид РНК), которые также можно назвать «одномолекулярной гРНК», «одногидовой РНК» или «огРНК». См., например, публикации WO/2013/176772A1, WO/2014/065596А1, WO/2014/089290A1, WO/2014/093622А2, WO/2014/099750A2, WO/2013142578A1 и WO 2014/131833А1, каждая из которых включена в настоящий документ путем ссылки. Термины «гидовая РНК» и «гРНК» являются включающими и включают как двухмолекулярные гРНК, так и одномолекулярные гРНК.

Примеры двухмолекулярных гРНК включают крРНК-подобную молекулу («РНК CRISPR», или «РНК-нацеливатель», или «крРНК», или «повтор крРНК») и соответствующую тракрРНК-подобную молекулу («транс-действующую РНК CRISPR», или «РНК-активатор», или «тракрРНК», или «каркас»). крРНК содержит оба сегмента (одноцепочечные) ДНК-нацеливания гРНК и участок нуклеотидов, который образует одну половину дуплекса дцРНК белок-связывающего сегмента гРНК. Соответствующая тракрРНК (РНК-активатор) содержит участок нуклеотидов, который образует другую половину дуплекса дцРНК белок-связывающего сегмента гРНК. Участок нуклеотидов крРНК комплементарен участку нуклеотидов тракрРНК и гибридизируется с ним с образованием дуплекса дцРНК белок-связывающего домена гРНК. Таким образом, можно сказать, что каждая крРНК имеет соответствующую тракрРНК.

крРНК и соответствующая тракрРНК гибридизируются с образованием гРНК. крРНК дополнительно обеспечивает одноцепочечный сегмент ДНК-нацеливания, который гибридизируется с целевой последовательностью. При использовании для модификации внутри клетки может быть разработана точная последовательность данной молекулы крРНК или тракрРНК, которая будет специфичной для тех видов, в которых будут использоваться молекулы РНК. См., например, публикации Mali et al. (2013) Science 339:823-826; Yinek et al. (2012) Science 337:816-821; Hwang et al. (2013) Nat. Biotechnol. 31:227-229; Jiang et al. (2013) Nat. Biotechnol. 31:233-239; и Cong et al. (2013) Science 339:819-823, каждая из которых включена в настоящий документ путем ссылки. Сегмент ДНК-нацеливания (крРНК) данной гРНК содержит нуклеотидную последовательность, которая является комплементарной последовательности в целевой ДНК. Сегмент ДНК-нацеливания гРНК взаимодействует с целевой ДНК последовательность-специфическим образом посредством гибридизации (т.е. спаривания нуклеотидов). По существу, нуклеотидная последовательность сегмента ДНК-нацеливания может изменяться и определяет местоположение внутри целевой ДНК, с которым будут взаимодействовать гРНК и целевая ДНК. Сегмент ДНК-нацеливания обсуждаемой гРНК может быть модифицирован для гибридизации с любой заданной последовательностью внутри целевой ДНК. Встречающиеся в природе крРНК различаются в зависимости от системы Cas9 и организма, но часто содержат нацеливающий сегмент длиной от 21 до 72 нуклеотидов, фланкированный двумя прямыми повторами (DR) длиной от 21 до 46 нуклеотидов (см., например, WO 2014/131833). В случае S. pyogenes длина DR составляет 36 нуклеотидов, а длина нацеливающего сегмента составляет 30 нуклеотидов. DR, расположенный на 3'-конце, является комплементарным и гибридизируется с соответствующей тракрРНК, которая в свою очередь связывается с белком Cas9.

Сегмент ДНК-нацеливания может иметь длину от приблизительно 12 нуклеотидов до приблизительно 100 нуклеотидов. Например, сегмент ДНК-нацеливания может иметь длину от приблизительно 12 нуклеотидов (нт) до приблизительно 80 нт, от приблизительно 12 нт до приблизительно 50 нт, от приблизительно 12 нт до приблизительно 40 нт, от приблизительно 12 нт до приблизительно 30 нт, от приблизительно 12 нт до приблизительно 25 нт, от приблизительно 12 нт до приблизительно 20 нт или от приблизительно 12 нт до приблизительно 19 нт. В альтернативном варианте осуществления сегмент ДНК-нацеливания может иметь длину от приблизительно 19 нт до приблизительно 20 нт, от приблизительно 19 нт до приблизительно 25 нт, от приблизительно 19 нт до приблизительно 30 нт, от приблизительно 19 нт до приблизительно 35 нт, от приблизительно 19 нт до приблизительно 40 нт, от приблизительно 19 нт до приблизительно 45 нт, от приблизительно 19 нт до приблизительно 50 нт, от приблизительно 19 нт до приблизительно 60 нт, от приблизительно 19 нт до приблизительно 70 нт, от приблизительно 19 нт до приблизительно 80 нт, от приблизительно 19 нт до приблизительно 90 нт, от приблизительно 19 нт до приблизительно 100 нт, от приблизительно 20 нт до приблизительно 25 нт, от приблизительно 20 нт до приблизительно 30 нт, от приблизительно 20 нт до приблизительно 35 нт, от приблизительно 20 нт до приблизительно 40 нт, от приблизительно 20 нт до приблизительно 45 нт, от приблизительно 20 нт до приблизительно 50 нт, от приблизительно 20 нт до приблизительно 60 нт, от приблизительно 20 нт до приблизительно 70 нт, от приблизительно 20 нт до приблизительно 80 нт, от приблизительно 20 нт до приблизительно 90 нт или от приблизительно 20 нт до приблизительно 100 нт.

Нуклеотидная последовательность сегмента ДНК-нацеливания, являющаяся комплементарной нуклеотидной последовательности (целевой последовательности) целевой ДНК, может иметь длину по меньшей мере приблизительно 12 нт. Например, последовательность ДНК-нацеливания (т.е. последовательность в пределах сегмента ДНК-нацеливания, являющаяся комплементарной целевой последовательности в пределах целевой ДНК) может иметь длину по меньшей мере приблизительно 12 нт, по меньшей мере приблизительно 15 нт, по меньшей мере приблизительно 18 нт, по меньшей мере приблизительно 19 нт, по меньшей мере приблизительно 20 нт, по меньшей мере приблизительно 25 нт, по меньшей мере приблизительно 30 нт, по меньшей мере приблизительно 35 нт или по меньшей мере приблизительно 40 нт. В альтернативном варианте осуществления последовательность ДНК-нацеливания может иметь длину от приблизительно 12 нуклеотидов (нт) до приблизительно 80 нт, от приблизительно 12 нт до приблизительно 50 нт, от приблизительно 12 нт до приблизительно 45 нт, от приблизительно 12 нт до приблизительно 40 нт, от приблизительно 12 нт до приблизительно 35 нт, от приблизительно 12 нт до приблизительно 30 нт, от приблизительно 12 нт до приблизительно 25 нт, от приблизительно 12 нт до приблизительно 20 нт, от приблизительно 12 нт до приблизительно 19 нт, от приблизительно 19 нт до приблизительно 20 нт, от приблизительно 19 нт до приблизительно 25 нт, от приблизительно 19 нт до приблизительно 30 нт, от приблизительно 19 нт до приблизительно 35 нт, от приблизительно 19 нт до приблизительно 40 нт, от приблизительно 19 нт до приблизительно 45 нт, от приблизительно 19 нт до приблизительно 50 нт, от приблизительно 19 нт до приблизительно 60 нт, от приблизительно 20 нт до приблизительно 25 нт, от приблизительно 20 нт до приблизительно 30 нт, от приблизительно 20 нт до приблизительно 35 нт, от приблизительно 20 нт до приблизительно 40 нт, от приблизительно 20 нт до приблизительно 45 нт, от приблизительно 20 нт до приблизительно 50 нт или от приблизительно 20 нт до приблизительно 60 нт.В некоторых случаях последовательность ДНК-нацеливания может иметь длину приблизительно 20 нт.

тракрРНК могут быть любого вида (например, полноразмерные тракрРНК или активные частичные тракрРНК) и различной длины. Они могут включать в себя первичные транскрипты или подвергнутые процессингу формы. Например, тракрРНК (как часть одногидовой РНК или в виде отдельной молекулы в составе двухмолекулярной гРНК) может содержать всю или часть последовательности тракрРНК дикого типа или состоять из всей или части последовательности тракрРНК дикого типа (например, приблизительно или более чем приблизительно 20, 26, 32, 45, 48, 54, 63, 67, 85 или более нуклеотидов последовательности тракрРНК дикого типа). Примеры последовательностей тракрРНК дикого типа из S. pyogenes включают варианты из 171 нуклеотида, 89 нуклеотидов, 75 нуклеотидов и 65 нуклеотидов. См., например, публикацию Deltcheva et al. (2011) Nature 471:602-607; WO 2014/093661, каждая из которых полностью включена в настоящий документ путем ссылки. Примеры тракрРНК в пределах одногидовых РНК (огРНК) включают сегменты тракрРНК, встречающиеся в пределах вариантов огРНК +48, +54, +67 и +85, где «+n» означает, что в огРНК включено до +n нуклеотидов тракрРНК дикого типа. См. публикацию US 8,697,359, полностью включенную в настоящий документ путем ссылки. Процент комплементарности между последовательностью ДНК-нацеливания и целевой последовательностью в пределах целевой ДНК может составлять по меньшей мере 60% (например, по меньшей мере 65%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90%, по меньшей мере 95%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% или 100%). В некоторых случаях процент комплементарности между последовательностью ДНК-нацеливания и целевой последовательностью в пределах целевой ДНК составляет по меньшей мере 60% на протяжении приблизительно 20 смежных нуклеотидов. В одном примере процент комплементарности между последовательностью ДНК-нацеливания и целевой последовательностью в пределах целевой ДНК составляет 100% на протяжении 14 смежных нуклеотидов на 5'-конце целевой последовательности в пределах комплементарной цепи целевой ДНК и всего 0% в оставшейся части. В таком случае можно считать, что длина последовательности ДНК-нацеливания составляет 14 нуклеотидов. В другом примере процент комплементарности между последовательностью ДНК-нацеливания и целевой последовательностью в пределах целевой ДНК составляет 100% на протяжении семи смежных нуклеотидов на 5'-конце целевой последовательности в пределах комплементарной цепи целевой ДНК и всего 0% в оставшейся части. В таком случае можно считать, что длина последовательности ДНК-нацеливания составляет 7 нуклеотидов.

Белок-связывающий сегмент гРНК может содержать два участка нуклеотидов, которые комплементарны друг другу. Комплементарные нуклеотиды белок-связывающего сегмента гибридизируются с образованием дуплекса двухцепочечной РНК (дцРНК). Белок-связывающий сегмент обсуждаемой гРНК взаимодействует с белком Cas, и гРНК управляет связыванием белка Cas со специфической нуклеотидной последовательностью в пределах ДНК с помощью сегмента ДНК-нацеливания. Гидовые РНК могут содержать модификации или последовательности, обеспечивающие дополнительные желаемые свойства (например, измененную или регулируемую стабильность; субклеточное нацеливание; отслеживание по флуоресцентной метке; сайт связывания для белка или белкового комплекса; и т.п.). К примерам таких модификаций относятся, например, 5'-кэп (например, 7-метилгуанилатный кэп (m7G)); 3'-полиаденилированный хвост (т.е. 3'-поли(А) хвост); последовательность-рибопереключатель (например, для обеспечения регулируемой стабильности и/или регулируемой доступности белками и/или белковыми комплексами); последовательность контроля стабильности; последовательность, образующая дуплекс дцРНК (т.е. шпилька); модификация или последовательность, нацеливающая РНК в субклеточное местоположение (например, ядро, митохондрии, хлоропласты и т.п.); модификация или последовательность, обеспечивающая отслеживание (например, прямая конъюгация с флуоресцентной молекулой, конъюгация с фрагментом, который способствует флуоресцентной детекции, последовательность, обеспечивающая флуоресцентную детекцию, и т.д.); модификация или последовательность, обеспечивающая сайт связывания для белков (например, белков, действующих на ДНК, включая активаторы транскрипции, репрессоры транскрипции, ДНК-метилтрансферазы, ДНК-деметилазы, гистонацетилтрансферазы, гистондеацетилазы и т.п.); и их комбинации. Гидовые РНК могут быть обеспечены в любом виде. Например, гРНК может быть обеспечена в виде РНК, либо как две молекулы (отдельно крРНК и тракрРНК), либо как одна молекула (огРНК) и, необязательно, в виде комплекса с белком Cas. гРНК может быть обеспечена также в виде ДНК, кодирующей РНК. ДНК, кодирующая гРНК, может кодировать одну молекулу РНК (огРНК) или отдельные молекулы РНК (например, отдельно крРНК и тракрРНК). В последнем случае ДНК, кодирующая гРНК, может быть обеспечена как отдельные молекулы ДНК, кодирующие соответственно крРНК и тракрРНК.

Если в клетку вводят ДНК, кодирующую гРНК, то гРНК может экспрессироваться внутри клетки временно, условно или конститутивно. ДНК, кодирующие гРНК, могут быть стабильно интегрированы в геном клетки и функционально связаны с промотором, активным в клетке. В альтернативном варианте осуществления ДНК, кодирующие гРНК, могут быть функционально связаны с промотором в экспрессионной конструкции. Например, ДНК, кодирующая гРНК, может находиться в нацеливающем векторе, содержащем полинуклеотидную вставку, и/или в векторе, содержащем нуклеиновую кислоту, кодирующую белок Cas. В альтернативном варианте осуществления она может находиться в векторе или плазмиде, отдельной от нацеливающего вектора и содержащей полинуклеотидную вставку и/или отдельной от вектора, содержащего нуклеиновую кислоту, кодирующую гРНК. Такие промоторы могут быть активными, например, в человеческой ИПС-клетке или в неплюрипотентной клетке, трансформированной для проявления плюрипотентного состояния. Такие промоторы могут представлять собой, например, условные промоторы, индуцируемые промоторы, конститутивные промоторы или тканеспецифические промоторы. В некоторых случаях промотор представляет собой промотор РНК-полимеразы III, например человеческий промотор U6. В альтернативном варианте осуществления гРНК можно получать с помощью различных других способов. Например, гРНК можно получать посредством транскрипции in vitro с использованием, например, Т7 РНК-полимеразы (см., например, WO 2014/089290 и WO 2014/065596). Гидовые РНК могут также быть синтетическими молекулами, полученными путем химического синтеза.

Целевая последовательность для системы CRISPR/Cas включает нуклеотидные последовательности, присутствующие в целевой ДНК, с которой будет связываться сегмент ДНК-нацеливания гРНК, при условии существования достаточных условий для связывания. Например, целевые последовательности включают последовательности, которым должна быть комплементарна сконструированная гидовая РНК, где гибридизация между целевой последовательностью и последовательностью ДНК-нацеливания способствует образованию комплекса CRISPR. Полная комплементарность не является обязательным требованием при условии достаточной комплементарности, чтобы вызвать гибридизацию и способствовать образованию комплекса CRISPR. Целевые последовательности также включают сайты расщепления для белков Cas, более подробно описанные ниже. Целевая последовательность может содержать любой полинуклеотид, который может быть расположен, например, в ядре или цитоплазме клетки или внутри органеллы клетки, такой как митохондрия или хлоропласт.

На целевую последовательность в пределах целевой ДНК может быть нацелен (т.е. может связывать, или гибридизировать, или быть комплементарным) белок Cas или гРНК. Подходящие условия связывания ДНК/РНК включают физиологические условия, обычно существующие в клетке. Другие подходящие условия связывания ДНК/РНК (например, условия в бесклеточной системе) известны в данной области (см., например, Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001)). Цепь целевой ДНК, которая является комплементарной и гибридизируется с белком Cas или гРНК, можно назвать «комплементарной цепью», а цепь целевой ДНК, которая комплементарна «комплементарной цепи» (и, таким образом, не комплементарна белку Cas или гРНК), можно назвать «некомплементарной цепью» или «матричной цепью».

Белок Cas может расщеплять нуклеиновую кислоту на сайте внутри или за пределами нуклеотидной последовательности, присутствующей в целевой ДНК, с которой будет связываться сегмент ДНК-нацеливания гРНК. «Сайт расщепления» включает положение нуклеиновой кислоты, в котором белок Cas производит одноцепочечный разрыв или двухцепочечный разрыв. Например, образование комплекса CRISPR (содержащего гРНК, гибридизованную с целевой последовательностью и образующую комплексы с белком Cas) может приводить к расщеплению одной или обеих цепей внутри или возле (например, на расстоянии в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 или более пар нуклеотидов от) нуклеотидной последовательности, присутствующей в целевой ДНК, с которой будет связываться сегмент ДНК-нацеливания гРНК. Если сайт расщепления находится за пределами имеющейся в ДНК нуклеотидной последовательности, с которой будет связываться сегмент ДНК-нацеливания гРНК, то сайт расщепления все еще считается находящимся в пределах «целевой последовательности». Сайт расщепления может находиться только на одной цепи или на обеих цепях нуклеиновой кислоты. Сайты расщепления могут находиться в одном и том же положении на обеих цепях нуклеиновой кислоты (образуя тупые концы) или могут находиться на разных сайтах на каждой цепи (образуя ступенчатые концы). Ступенчатые концы также могут быть получены, например, с использованием двух белков Cas, которые производят одноцепочечный разрыв на отличающемся сайте расщепления в каждой цепи. Например, первая никаза может создавать одноцепочечный разрыв на первой цепи двухцепочечной ДНК (дцДНК), а вторая никаза может создавать одноцепочечный разрыв на второй цепи дцДНК таким образом, что образуются нависающие последовательности. В некоторых случаях целевая последовательность никазы на первой цепи разделена с целевой последовательностью никазы на второй цепи по меньшей мере 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500 или 1000 пар нуклеотидов. Сайт-специфическое расщепление целевой ДНК белком Cas9 может происходить в местах, определенных как (i) комплементарностью спариваемых нуклеотидов между гРНК и целевой ДНК, так и (ii) наличием в целевой ДНК короткого мотива, называемого мотивом, прилежащим к протоспейсеру (РАМ). РАМ может фланкировать целевую последовательность. Необязательно, целевая последовательность может быть фланкирована РАМ на 3'-конце. Например, сайт расщепления Cas9 может находиться на расстоянии от приблизительно 1 до приблизительно 10 или от приблизительно 2 до приблизительно 5 пар нуклеотидов (например, 3 пар нуклеотидов) ближе к 5'-концу или ближе к 3'-концу от последовательности РАМ. В некоторых случаях (например, когда используется Cas9 из S. pyogenes или близкородственный Cas9) последовательность РАМ некомплементарной цепи может представлять собой 5'-XGG-3', где X является любым нуклеотидом ДНК и при этом находится непосредственно на 3'-конце целевой последовательности некомплементарной цепи целевой ДНК. По существу, последовательность РАМ комплементарной цепи будет представлять собой 5'-CCY-3', где Y является любым нуклеотидом ДНК и при этом находится непосредственно на 5'-конце целевой последовательности комплементарной цепи целевой ДНК. В некоторых случаях X и Y могут быть комплементарными, и пара оснований X-Y может представлять собой любую пару оснований (например, X=C и Y=G; X=G и Y=C; X=A и Y=T, X=T и Y=A).

Примеры целевых последовательностей включают последовательность ДНК, комплементарную сегменту ДНК-нацеливания гРНК, или такую последовательность ДНК в дополнение к последовательности РАМ. Один пример целевой последовательности содержит нуклеотидную последовательность GNNNNNNNNNNNNNNNNNNNN (GN1-20GG; SEQ ID NO: 2). Другие целевые последовательности могут иметь длину 4-22 нуклеотида SEQ ID NO: 2, включая 5'-G и 3'-GG. Другие целевые последовательности могут иметь длину от 14 до 20 нуклеотидов SEQ ID NO: 2.

Целевая последовательность может представлять собой любую нуклеотидную последовательность, эндогенную или экзогенную по отношению к клетке. Целевая последовательность может представлять собой последовательность, кодирующую генный продукт (например, белок), или некодирующую последовательность (например, регуляторную последовательность или избыточную ДНК), или может включать в себя обе.

Также предложены активные варианты и фрагменты нуклеазных агентов (т.е. сконструированный нуклеазный агент). Идентичность последовательности таких активных вариантов нативному нуклеазному агенту может составлять по меньшей мере 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или более, причем активные варианты сохраняют способность разрезать заданный сайт распознавания и, таким образом, сохраняют активность индуцирования одно- или двухцепочечного разрыва. Например, любой из нуклеазных агентов, описанных в настоящем документе, может быть модифицирован из нативной последовательности эндонуклеазы и сконструирован для распознавания и индуцирования одно- или двухцепочечного разрыва на сайте распознавания, который не распознавался нативным нуклеазным агентом. Таким образом, в некоторых вариантах осуществления сконструированная нуклеаза обладает специфической способностью индуцировать одно- или двухцепочечный разрыв на сайте распознавания, который отличается от сайта распознавания соответствующего нативного нуклеазного агента. Анализы определения активности, индуцирующей одно- или двухцепочечный разрыв, известны и, как правило, измеряют общую активность и специфичность эндонуклеазы на субстратах ДНК, содержащих сайт распознавания.

Нуклеазный агент может быть введен в плюрипотентную клетку любыми способами, известными в данной области. Полипептид, кодирующий нуклеазный агент, может быть непосредственно введен в клетку. В альтернативном варианте осуществления в клетку может быть введен полинуклеотид, кодирующий нуклеазный агент. Если в клетку вводят полинуклеотид, кодирующий нуклеазный агент, то нуклеазный агент может экспрессироваться внутри клетки временно, условно или конститутивно. Таким образом, полинуклеотид, кодирующий нуклеазный агент, может содержаться в экспрессионной кассете и быть функционально связанным с условным промотором, индуцируемым промотором, конститутивным промотором или тканеспецифическим промотором. В альтернативном варианте осуществления нуклеазный агент вводят в клетку в качестве мРНК, кодирующей нуклеазный агент.

В конкретных вариантах осуществления полинуклеотид, кодирующий нуклеазный агент, стабильно интегрирован в геном плюрипотентной клетки и функционально связан с промотором, активным в клетке. В других вариантах осуществления полинуклеотид, кодирующий нуклеазный агент, находится в том же нацеливающем векторе, который содержит полинуклеотидную вставку, хотя в других случаях полинуклеотид, кодирующий нуклеазный агент, находится в векторе или плазмиде, которая отделена от нацеливающего вектора, содержащего полинуклеотидную вставку. Если нуклеазный агент вводят в плюрипотентную клетку посредством введения полинуклеотида, кодирующего нуклеазный агент, то такой полинуклеотид, кодирующий нуклеазный агент, может быть модифицирован, чтобы заменить кодоны, имеющие более высокую частоту использования в интересующей клетке по сравнению со встречающейся в природе полинуклеотидной последовательностью, кодирующей нуклеазный агент.Например, полинуклеотид, кодирующий нуклеазный агент, можно модифицировать и ввести заменительные кодоны, имеющие более высокую частоту использования в человеческой клетке по сравнению с естественной полинуклеотидной последовательностью.

b. Селективные маркеры

В способах и композициях, описанных в настоящем документе, можно использовать различные селективные маркеры, которые обеспечивают модификацию целевого геномного локуса на хромосоме. Такие маркеры описаны в других разделах настоящего документа и включают в себя, без ограничений, селективные маркеры, которые придают устойчивость к антибиотикам, таким как G418, гигромицин, бластицидин, неомицин или пуромицин. Полинуклеотид, кодирующий селективные маркеры, функционально связан с промотором, активным в человеческой ИПС-клетке или неплюрипотентной клетке, трансформированной для проявления интактного состояния.

c. Целевой геномный локус

Предложены различные способы и композиции, обеспечивающие интеграцию в целевой геномный локус на хромосоме по меньшей мере одной полинуклеотидной вставки. Термин «целевой геномный локус на хромосоме» означает любой сегмент или область ДНК на хромосоме, в которую желательно интегрировать полинуклеотидную вставку. Геномный локус на хромосоме, на который ведется нацеливание, может быть нативным для человеческой ИПС-клетки или неплюрипотентной клетки, трансформированной для проявления плюрипотентного состояния, или, в альтернативном варианте осуществления, может содержать гетерологичный или экзогенный сегмент ДНК, интегрированный в хромосому клетки. Такие гетерологичные или экзогенные сегменты ДНК могут включать в себя трансгены, экспрессионные кассеты, полинуклеотиды, кодирующие селективные маркеры или гетерологичные или экзогенные области геномной ДНК. Целевой геномный локус на хромосоме может содержать любую систему нацеленной геномной интеграции, включая, например, сайт распознавания, селективный маркер, ранее интегрированные полинуклеотидные вставки, полинуклеотиды, кодирующие нуклеазные агенты, промоторы и т.д. В альтернативном варианте осуществления целевой геномный локус на хромосоме может быть расположен внутри дрожжевой искусственной хромосомы (YAC), бактериальной искусственной хромосомы (ВАС), человеческой искусственной хромосомы или любой другой сконструированной геномной области, содержащейся в соответствующей клетке-хозяине. Таким образом, в конкретных вариантах осуществления целевой геномный локус на хромосоме может содержать нативную геномную последовательность из человеческой клетки или гетерологичную или экзогенную геномную нуклеотидную последовательность из не относящегося к человеку млекопитающего, не относящейся к человеку клетки, от грызуна, человека, крысы, мыши, хомяка, кролика, свиньи, коровы, оленя, овцы, козы, курицы, кошки, собаки, хорька, примата (например, мартышки, макаки-резуса), домашнего млекопитающего животного или сельскохозяйственного млекопитающего животного или любого другого интересующего организма или их комбинации.

d. Нацеливающие векторы и полинуклеотидные вставки

Как отмечено выше, в способах и композициях, предложенных в настоящем документе, используют нацеливающие векторы сами по себе или в комбинации с нуклеазным агентом. Термин «гомологичная рекомбинация» обычно относится к обмену ДНК-фрагментов между двумя ДНК-молекулами на сайтах кроссинговера в пределах областей гомологии.

i. Полинуклеотидная вставка

В способах, описанных в настоящем документе, можно использовать одну или более отдельных полинуклеотидных вставок, и их можно вводить в клетку при помощи отдельных нацеливающих векторов или одного нацеливающего вектора. Полинуклеотидные вставки содержат сегменты ДНК, предназначенные для интеграции в целевые геномные локусы. Интеграция полинуклеотидной вставки в целевой локус может приводить к добавлению интересующей нуклеотидной последовательности, делеции интересующей нуклеотидной последовательности в целевом локусе и/или замене интересующей нуклеотидной последовательности в целевом локусе. Полинуклеотидная вставка или соответствующая заменяемая нуклеиновая кислота в целевом локусе может представлять собой кодирующую область, интрон, экзон, нетранслируемую область, регуляторную область, промотор, энхансер или любую их комбинацию. Более того, полинуклеотидная вставка или соответствующая заменяемая нуклеиновая кислота в целевом локусе может иметь любую желаемую длину, например, длину 10-100 нуклеотидов, длину 100-500 нуклеотидов, длину 500 нуклеотидов - 1 т.п.н., длину от 1 т.п.н. до 1,5 т.п.н., длину от 1,5 т.п.н. до 2 т.п.н., длину от 2 т.п.н. до 2,5 т.п.н., длину от 2,5 т.п.н. до 3 т.п.н., длину от 3 т.п.н. до 5 т.п.н., длину от 5 т.п.н. до 8 т.п.н., длину от 8 т.п.н. до 10 т.п.н. или более. В других случаях длина может составлять от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 250 т.п.н., от приблизительно 250 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 350 т.п.н., от приблизительно 350 т.п.н. до приблизительно 400 т.п.н., от приблизительно 400 т.п.н. до приблизительно 800 т.п.н., от приблизительно 800 т.п.н. до 1 млн п. н., от приблизительно 1 млн п. н. до приблизительно 1,5 млн п. н., от приблизительно 1,5 млн п. н. до приблизительно 2 млн п. н., от приблизительно 2 млн п. н. до приблизительно 2,5 млн п. н., от приблизительно 2,5 млн п. н. до приблизительно 2,8 млн п. н., от приблизительно 2,8 млн п. н. до приблизительно 3 млн п. н. В других случаях длина может составлять по меньшей мере 100, 200, 300, 400, 500, 600, 700, 800 или 900 нуклеотидов или по меньшей мере 1 т.п.н., 2 т.п.н., 3 т.п.н., 4 т.п.н., 5 т.п.н., 6 т.п.н., 7 т.п.н., 8 т.п.н., 9 т.п.н., 10 т.п.н., 11 т.п.н., 12 т.п.н., 13 т.п.н., 14 т.п.н., 15 т.п.н., 16 т.п.н. или более.

В некоторых нацеливающих векторах полинуклеотидная вставка может находиться в диапазоне от приблизительно 5 т.п.н. до приблизительно 200 т.п.н., от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 30 т.п.н., от приблизительно 30 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 50 т.п.н., от приблизительно 60 т.п.н. до приблизительно 70 т.п.н., от приблизительно 80 т.п.н. до приблизительно 90 т.п.н., от приблизительно 90 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 110 т.п.н., от приблизительно 120 т.п.н. до приблизительно 130 т.п.н., от приблизительно 130 т.п.н. до приблизительно 140 т.п.н., от приблизительно 140 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 160 т.п.н., от приблизительно 160 т.п.н. до приблизительно 170 т.п.н., от приблизительно 170 т.п.н. до приблизительно 180 т.п.н., от приблизительно 180 т.п.н. до приблизительно 190 т.п.н., от приблизительно 190 т.п.н. до приблизительно 200 т.п.н. В альтернативном варианте осуществления полинуклеотидная вставка может составлять от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 250 т.п.н., от приблизительно 250 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 350 т.п.н. или от приблизительно 350 т.п.н. до приблизительно 400 т.п.н.

В некоторых случаях замещение нуклеиновой кислоты в целевом локусе приводит к делеции целевой последовательности длиной в диапазоне от приблизительно 1 т.п.н. до приблизительно 200 т.п.н., от приблизительно 2 т.п.н. до приблизительно 20 т.п.н. или от приблизительно 0,5 т.п.н. до приблизительно 3 млн п. н. В некоторых случаях величина делеции превышает общую длину 5'-гомологичного плеча и 3'-гомологичного плеча.

В некоторых случаях величина делеции целевой последовательности лежит в диапазоне от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 200 т.п.н., от приблизительно 20 т.п.н. до приблизительно 30 т.п.н., от приблизительно 30 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 50 т.п.н., от приблизительно 50 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 70 т.п.н., от приблизительно 70 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 90 т.п.н., от приблизительно 90 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 110 т.п.н., от приблизительно 110 т.п.н. до приблизительно 120 т.п.н., от приблизительно 120 т.п.н. до приблизительно 130 т.п.н., от приблизительно 130 т.п.н. до приблизительно 140 т.п.н., от приблизительно 140 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 160 т.п.н., от приблизительно 160 т.п.н. до приблизительно 170 т.п.н., от приблизительно 170 т.п.н. до приблизительно 180 т.п.н., от приблизительно 180 т.п.н. до приблизительно 190 т.п.н., от приблизительно 190 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 250 т.п.н., от приблизительно 250 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 350 т.п.н., от приблизительно 350 т.п.н. до приблизительно 400 т.п.н., от приблизительно 400 т.п.н. до приблизительно 800 т.п.н., от приблизительно 800 т.п.н. до 1 млн п. н., от приблизительно 1 млн п. н. до приблизительно 1,5 млн п. н., от приблизительно 1,5 млн п. н. до приблизительно 2 млн п. н., от приблизительно 2 млн п. н., до приблизительно 2,5 млн п. н., от приблизительно 2,5 млн п. н. до приблизительно 2,8 млн п. н., от приблизительно 2,8 млн п. н. до приблизительно 3 млн п. н., от приблизительно 200 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 400 т.п.н., от приблизительно 400 т.п.н. до приблизительно 500 т.п.н., от приблизительно 500 т.п.н. до приблизительно 1 млн п. н., от приблизительно 1 млн п. н. до приблизительно 1,5 млн п. н., от приблизительно 1,5 млн п. н. до приблизительно 2 млн п. н., от приблизительно 2 млн п. н. до приблизительно 2,5 млн п. н. или от приблизительно 2,5 млн п. н. до приблизительно 3 млн п. н.

В других случаях полинуклеотидная вставка или соответствующая заменяемая нуклеиновая кислота в целевом локусе может иметь длину по меньшей мере 10 т.п.н., по меньшей мере 20 т.п.н., по меньшей мере 30 т.п.н., по меньшей мере 40 т.п.н., по меньшей мере 50 т.п.н., по меньшей мере 60 т.п.н., по меньшей мере 70 т.п.н., по меньшей мере 80 т.п.н., по меньшей мере 90 т.п.н., по меньшей мере 100 т.п.н., по меньшей мере 150 т.п.н., по меньшей мере 200 т.п.н., по меньшей мере 250 т.п.н., по меньшей мере 300 т.п.н., по меньшей мере 350 т.п.н., по меньшей мере 400 т.п.н., по меньшей мере 450 т.п.н. или по меньшей мере 500 т.п.н. или более. Полинуклеотидная вставка может содержать геномную ДНК или любой другой тип ДНК. Например, полинуклеотидная вставка может происходить из прокариота, эукариота, дрожжей, птицы (например, курицы), не относящегося к человеку млекопитающего, грызуна, человека, крысы, мыши, хомяка, кролика, свиньи, коровы, оленя, овцы, козы, кошки, собаки, хорька, примата (например, мартышки, макаки-резуса), домашнего млекопитающего животного, сельскохозяйственного млекопитающего животного или любого другого интересующего организма. В одном примере вставляемый полинуклеотид может содержать любой человеческий или не относящийся к человеку геномный локус.

Полинуклеотидная вставка и/или нуклеиновая кислота в целевом локусе может содержать кодирующую последовательность или некодирующую последовательность, например регуляторный элемент (например, промотор, энхансер или элемент, связывающийся с репрессором транскрипции). Например, полинуклеотидная вставка может содержать нокин-аллель по меньшей мере одного экзона эндогенного гена или нокин-аллель всего эндогенного гена (т.е. «нокин с обменом гена»). Полинуклеотидная вставка также может содержать условный аллель. Условный аллель может быть многофункциональным аллелем, как описано в публикации US 2011/0104799, которая полностью включена в настоящий документ путем ссылки. Например, условный аллель может содержать: (а) активирующую последовательность в смысловой ориентации по отношению к транскрипции целевого гена; (b) кассету селекции лекарственными средствами (DSC) в смысловой или антисмысловой ориентации; (с) находящуюся в антисмысловой ориентации интересующую нуклеотидную последовательность (NSI); и (d) и условный по инверсии модуль (COIN, в котором используется разделяющий экзон интрон и инвертируемый модуль, подобный генной ловушке) в обратной ориентации. См., например, публикацию US 2011/0104799, которая полностью включена в настоящий документ путем ссылки. Условный аллель может дополнительно содержать рекомбинируемые блоки, которые рекомбинируются при воздействии первой рекомбиназой с образованием условного аллеля, который (i) не имеет активирующей последовательности и DSC; и (ii) содержит NSI в смысловой ориентации и COIN в антисмысловой ориентации. См. публикацию US 2011/0104799.

Некоторые полинуклеотидные вставки содержат полинуклеотид, кодирующий селективный маркер. Селективный маркер может входить в кассету селекции. Такие селективные маркеры включают, без ограничений, неомицинфосфотрансферазу (neor), гигромицин-В-фосфотрансферазу (hygr), пуромицин-N-ацетилтрансферазу (puror), бластицидин-S-дезаминазу (bsrr), ксантин/гуанинфосфорибозилтрансферазу (gpt) или тимидинкиназу вируса простого герпеса (HSV-k) или их комбинацию. Полинуклеотид, кодирующий селективный маркер, может быть функционально связан с промотором, активным в клетке, на которую выполняется нацеливание. В некоторых нацеливающих векторах полинуклеотидная вставка содержит репортерный ген. К примерам репортерных генов относятся гены, кодирующие люциферазу, β-галактозидазу, зеленый флуоресцентный белок (GFP), усиленный зеленый флуоресцентный белок (eGFP), голубой флуоресцентный белок (CFP), желтый флуоресцентный белок (YFP), усиленный желтый флуоресцентный белок (eYFP), синий флуоресцентный белок (BFP), усиленный синий флуоресцентный белок (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, щелочную фосфатазу и любую их комбинацию. Такие репортерные гены могут быть функционально связаны с промотором, активным в клетке, на которую производится нацеливание. В некоторых нацеливающих векторах полинуклеотидная вставка содержит одну или более экспрессионных кассет или кассет делеции. Данная кассета может содержать интересующую последовательность полинуклеотидов, нуклеиновую кислоту, кодирующую селективный маркер, и/или репортерный ген наряду с различными регуляторными компонентами, влияющими на экспрессию. Примеры пригодных для включения селективных маркеров и репортерных генов обсуждаются более подробно в других разделах настоящего документа.

В некоторых нацеливающих векторах полинуклеотидная вставка содержит нуклеиновую кислоту, фланкированную целевыми последовательностями сайт-специфической рекомбинации. Хотя вся полинуклеотидная вставка может быть фланкирована такими целевыми последовательностями сайт-специфической рекомбинации, любая область или отдельный интересующий полинуклеотид внутри полинуклеотидной вставки также может быть фланкирован такими сайтами. Целевые последовательности сайт-специфической рекомбинации, которые могут фланкировать полинуклеотидную вставку или любой интересующий полинуклеотид в полинуклеотидной вставке, могут включать в себя, например, последовательности loxP, lox511, lox2272, lox66, lox71, loxM2, lox5171, FRT, FRT11, FRT71, attp, art, FRT, rox и их комбинацию. В одном примере сайты сайт-специфической рекомбинации фланкируют полинуклеотид, кодирующий селективный маркер и/или репортерный ген, содержащийся внутри полинуклеотидной вставки. После интеграции полинуклеотидной вставки в целевой локус последовательности между сайтами сайт-специфической рекомбинации можно удалить.

ii. Нацеливающие векторы

Нацеливающие векторы можно использовать для внедрения полинуклеотидной вставки в целевой геномный локус, и они могут содержать полинуклеотидную вставку и гомологичные плечи, фланкирующие полинуклеотидную вставку. Нацеливающие векторы могут иметь линейную форму или форму окружности и могут быть одноцепочечными или двухцепочечными. Для удобства ссылки термины «гомологичные плечи» в настоящем документе относятся к гомологичным плечам 5' и 3' (т.е. вышележащему ближе к 5'-концу и нижележащему ближе к 3'-концу). Эта терминология относится к относительному положению гомологичных плеч к полинуклеотидной вставке внутри нацеливающего вектора. 5'- и 3'-гомологичные плечи соответствуют областям в целевом локусе, которые в настоящем документе именуются «5'-целевой последовательностью» и «3'-целевой последовательностью» соответственно.

Гомологичное плечо и целевая последовательность «соответствуют» или являются «соответствующими» друг другу, если две области имеют достаточную степень идентичности последовательности друг другу для того, чтобы действовать как субстраты для реакции гомологичной рекомбинации. Термин «гомологичные» включает последовательности ДНК, которые или являются идентичными, или имеют идентичность последовательности с соответствующей последовательностью. Идентичность последовательности между данной целевой последовательностью и соответствующим гомологичным плечом, находящимся на нацеливающем векторе, может иметь любую степень идентичности последовательности, которая обеспечивает возникновение гомологичной рекомбинации. Например, степень идентичности последовательности между гомологичным плечом нацеливающего вектора (или его фрагмента) и целевой последовательностью (или ее фрагментом) может составлять по меньшей мере 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% или 100% идентичности последовательности таким образом, что последовательности подвергаются гомологичной рекомбинации. Кроме того, соответствующая область гомологии между гомологичным плечом и соответствующей целевой последовательностью может иметь любую длину, которая является достаточной для стимуляции гомологичной рекомбинации на расщепленном сайте распознавания. Например, данное гомологичное плечо и/или соответствующая целевая последовательность может содержать соответствующие области гомологии, длина которых составляет по меньшей мере приблизительно 5-10 т.п.н., 5-15 т.п.н., 5- 20 т.п.н., 5-25 т.п.н., 5-30 т.п.н., 5-35 т.п.н., 5-40 т.п.н., 5-45 т.п.н., 5-50 т.п.н., 5-55 т.п.н., 5-60 т.п.н., 5-65 т.п.н., 5-70 т.п.н., 5-75 т.п.н., 5-80 т.п.н., 5-85 т.п.н., 5-90 т.п.н., 5-95 т.п.н., 5-100 т.п.н., 100-200 т.п.н. или 200-300 т.п.н. тысяч пар нуклеотидов или более (как описано в других разделах настоящего документа для векторов LTVEC) таким образом, что гомологичное плечо имеет достаточную гомологию, чтобы подвергаться гомологичной рекомбинации с соответствующими целевыми последовательностями в пределах генома клетки. Гомологичные плечи могут соответствовать локусу, который является нативным по отношению к клетке (например, целевому локусу), или, в альтернативном варианте осуществления, они могут соответствовать области гетерологичного или экзогенного сегмента ДНК, который был интегрирован в геном клетки, включая, например, трансгены, экспрессионные кассеты или гетерологичные или экзогенные области ДНК. В альтернативном варианте осуществления гомологичные плечи нацеливающего вектора могут соответствовать области дрожжевой искусственной хромосомы (YAC), бактериальной искусственной хромосомы (ВАС), человеческой искусственной хромосомы или любой другой сконструированной области, содержащейся в соответствующей клетке-хозяине. Еще дополнительно гомологичные плечи нацеливающего вектора могут соответствовать или могут быть получены из области из библиотеки ВАС, библиотеки космид или библиотеки фага Р1. В некоторых случаях гомологичные плечи нацеливающего вектора соответствуют локусу, который является нативным, гетерологичным или экзогенным для человеческой ИПС-клетки или неплюрипотентной клетки, трансформированной для проявления интактного состояния. В некоторых случаях при отсутствии одно- или двухцепочечного разрыва, индуцированного нуклеазным агентом (например, белком Cas), гомологичные плечи соответствуют локусу клетки, на который нельзя выполнить нацеливание с использованием стандартных способов или нацеливание на который может быть только неверным или иметь очень низкую эффективность. В некоторых случаях гомологичные плечи получены из синтетической ДНК.

В некоторых нацеливающих векторах 5'- и 3'-гомологичные плечи соответствуют локусу «зоны безопасности». Взаимодействия между интегрированной экзогенной ДНК и геномом хозяина могут ограничивать надежность и безопасность интеграции и могут приводить к явным фенотипическим эффектам, которые не обусловлены нацеленной генетической модификацией, но обусловлены непредвиденными эффектами интеграции на окружающие эндогенные гены. Например, случайным образом введенные трансгены могут быть подвержены эффектам положения и сайленсингу, что делает их экспрессию ненадежной и непредсказуемой. Аналогично, интеграция экзогенных ДНК в хромосомный локус может влиять на окружающие эндогенные гены и хроматин, тем самым изменяя поведение и фенотипы клеток. Локусы «зон безопасности» включают в себя хромосомные локусы, в которых трансгены или другие экзогенные полинуклеотидные вставки могут стабильно и надежно экспрессироваться во всех интересующих тканях, не меняя явным образом поведение и фенотип клеток. См., например, Sadelain et al. (2012) Nat. Rev. Cancer 12:51-58. Например, к локусам «зон безопасности» относятся хромосомные локусы, куда экзогенную ДНК можно интегрировать и где она может функционировать предсказуемым образом, не оказывая отрицательного влияния на структуру и экспрессию эндогенных генов. К локусам «зон безопасности» могут относиться экстрагенные или внутригенные области, например локусы внутри генов, которые не являются необходимыми, являются необязательными или которые можно нарушить без явных фенотипических последствий.

Например, локус Rosa26 и его человеческий эквивалент имеет открытую конфигурацию в хроматине во всех тканях и является повсеместно экспрессируемым в ходе эмбрионального развития и у взрослых. См. публикации Zambrowicz et al. (1997) Proc. Natl. Acad. Sci. USA 94: 3789-3794. Кроме этого, на локус Rosa26 можно нацелиться с высокой эффективностью, и нарушение гена Rosa26 не дает явного фенотипического изменения. Другим примером подходящего локуса является локус Ch25h.

Гомологичное плечо нацеливающего вектора может иметь любую длину, достаточную для стимуляции события гомологичной рекомбинации с соответствующей целевой последовательностью, включая, например, по меньшей мере длину 5-10 т.п.н., 5-15 т.п.н., 5-20 т.п.н., 5-25 т.п.н., 5-30 т.п.н., 5-35 т.п.н., 5-40 т.п.н., 5-45 т.п.н., 5-50 т.п.н., 5-55 т.п.н., 5-60 т.п.н., 5-65 т.п.н., 5-70 т.п.н., 5-75 т.п.н., 5-80 т.п.н., 5-85 т.п.н., 5-90 т.п.н., 5-95 т.п.н., 5-100 т.п.н., 100-200 т.п.н. или 200-300 т.п.н. или более. Как описано более подробно ниже, в больших нацеливающих векторах могут использоваться нацеливающие плечи более большой длины.

Нуклеазные агенты (например, системы CRISPR/Cas) можно применять в комбинации с нацеливающими векторами для обеспечения модификации целевого локуса. Такие нуклеазные агенты могут обеспечивать гомологичную рекомбинацию между нацеливающим вектором и целевым локусом. При использовании нуклеазных агентов в комбинации с нацеливающим вектором, нацеливающий вектор может содержать 5'-и 3'-гомологичные плечи, соответствующие 5'- и 3'-целевым последовательностям, расположенным достаточно близко к сайту расщепления нуклеазой, с тем чтобы обеспечить событие гомологичной рекомбинации между целевыми последовательностями и гомологичными плечами при одноцепочечном или двухцепочечном разрыве в сайте расщепления нуклеазой. Термин «сайт расщепления нуклеазой» включает последовательность ДНК, в которой нуклеазный агент (например, сайт расщепления Cas9) индуцирует одно- или двухцепочечный разрыв. Целевые последовательности в целевом локусе, соответствующие 5'- и 3'-гомологичным плечам нацеливающего вектора «расположены в достаточной близости» к сайту расщепления нуклеазой, если расстояние является таким, чтобы способствовать возникновению события гомологичной рекомбинации между 5'- и 3'-целевыми последовательностями и гомологичными плечами при одно- или двухцепочечном разрыве в сайте распознавания. Таким образом, в конкретных случаях целевые последовательности, соответствующие 5'- и/или 3'-гомологичным плечам нацеливающего вектора, находятся в пределах по меньшей мере 1 нуклеотида от данного сайта распознавания или в пределах по меньшей мере от 10 нуклеотидов до приблизительно 14 т.п.н. от данного сайта распознавания. В некоторых случаях сайт нуклеазного расщепления непосредственно смежен с по меньшей мере одним или обеими целевыми последовательностями.

Пространственное отношение целевых последовательностей, соответствующих гомологичным плечам нацеливающего вектора и сайту расщепления нуклеазой, может изменяться. Например, целевые последовательности могут быть расположены в направлении 5'-конца от сайта нуклеазного расщепления, оба целевых сайта могут быть расположены в направлении 3'-конца от сайта распознавания, или целевые последовательности могут фланкировать сайт расщепления нуклеазой. Совместное использование нацеливающего вектора (включая, например, большой нацеливающий вектор) с нуклеазным агентом может привести к повышению эффективности нацеливания по сравнению с использованием только нацеливающего вектора. Например, когда нацеливающий вектор применяют вместе с нуклеазным агентом, эффективность нацеливания нацеливающего вектора можно увеличить по меньшей мере в два раза, по меньшей мере в три раза, по меньшей мере в 4 раза или по меньшей мере в 10 раз по сравнению с использованием только нацеливающего вектора.

iii. Большие нацеливающие векторы

Некоторые нацеливающие векторы представляют собой «большие нацеливающие векторы» или «LTVEC», к которым относятся нацеливающие векторы, содержащие гомологичные плечи, соответствующие или производные от нуклеотидных последовательностей более большого размера, чем те, которые обычно применяют в других подходах, предназначенных для проведения гомологичной рекомбинации в клетках. Примеры получения нацеленных генетических модификаций с использованием LTVEC изложены, например, в публикациях WO 2015/088643, US 2015/0159175, US 2015/0159174, US 2014/0310828, US 2014/0309487 и US 2013-0309670, каждая из которых во всех отношениях полностью включена в настоящий документ путем ссылки. К LTVEC также относятся нацеливающие векторы, содержащие полинуклеотидные вставки, имеющие нуклеотидные последовательности более большой длины, чем у обычно применяемых при других подходах, предназначенных для проведения гомологичной рекомбинации в клетках. Например, LTVEC позволяют осуществлять модификацию больших локусов, которую нельзя осуществить традиционными плазмидными нацеливающими векторами из-за размерных ограничений. Например, целевой локус может представлять собой локус клетки (т.е. 5'- и 3'-гомологичные плечи могут соответствовать ему), на который при отсутствии одно- или двухцепочечного разрыва, индуцированного нуклеазным агентом (например, белком Cas), нельзя выполнить нацеливание с использованием стандартных способов, или нацеливание может быть только неверным или иметь только очень низкую эффективность.

Примеры LTVEC включают векторы, полученные из бактериальной искусственной хромосомы (ВАС), человеческой искусственной хромосомы или дрожжевой искусственной хромосомы (YAC). Не имеющие ограничительного характера примеры LTVEC и способов их получения описаны, например, в патенте США №6,586,251; патенте США №6,596,541; патенте США №7,105,348; и WO 2002/036789 (PCT/US01/45375), каждый из которых полностью включен в настоящий документ путем ссылки. LTVEC могут иметь линейную форму или кольцевую форму. LTVEC могут иметь любую длину, включая, например, от приблизительно 50 т.п.н. до приблизительно 300 т.п.н., от приблизительно 50 т.п.н. до приблизительно 75 т.п.н., от приблизительно 75 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до 125 т.п.н., от приблизительно 125 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 175 т.п.н., от приблизительно 175 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 225 т.п.н., от приблизительно 225 т.п.н. до приблизительно 250 т.п.н., от приблизительно 250 т.п.н. до приблизительно 275 т.п.н. или от приблизительно 275 т.п.н. до приблизительно 300 т.п.н. Альтернативно, LTVEC может составлять по меньшей мере 10 т.п.н., по меньшей мере 15 т.п.н., по меньшей мере 20 т.п.н., по меньшей мере 30 т.п.н., по меньшей мере 40 т.п.н., по меньшей мере 50 т.п.н., по меньшей мере 60 т.п.н., по меньшей мере 70 т.п.н., по меньшей мере 80 т.п.н., по меньшей мере 90 т.п.н., по меньшей мере 100 т.п.н., по меньшей мере 150 т.п.н., по меньшей мере 200 т.п.н., по меньшей мере 250 т.п.н., по меньшей мере 300 т.п.н., по меньшей мере 350 т.п.н., по меньшей мере 400 т.п.н., по меньшей мере 450 т.п.н. или по меньшей мере 500 т.п.н. или более. Размер LTVEC может быть слишком большим, чтобы имелась возможность скрининга событий нацеливания с помощью обычных анализов, например саузерн-блоттинга и ПЦР для амплификации протяженных участков (например, от 1 т.п.н. до 5 т.п.н.).

В некоторых случаях LTVEC включает полинуклеотидную вставку, которая может находиться в диапазоне от приблизительно 5 т.п.н. до приблизительно 200 т.п.н., от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 30 т.п.н., от приблизительно 30 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 50 т.п.н., от приблизительно 60 т.п.н. до приблизительно 70 т.п.н., от приблизительно 80 т.п.н. до приблизительно 90 т.п.н., от приблизительно 90 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 110 т.п.н., от приблизительно 120 т.п.н. до приблизительно 130 т.п.н., от приблизительно 130 т.п.н. до приблизительно 140 т.п.н., от приблизительно 140 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 160 т.п.н., от приблизительно 160 т.п.н. до приблизительно 170 т.п.н., от приблизительно 170 т.п.н. до приблизительно 180 т.п.н., от приблизительно 180 т.п.н. до приблизительно 190 т.п.н. или от приблизительно 190 т.п.н. до приблизительно 200 т.п.н. В других случаях полинуклеотидная вставка может лежать в диапазоне от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 250 т.п.н., от приблизительно 250 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 350 т.п.н. или от приблизительно 350 т.п.н. до приблизительно 400 т.п.н. В некоторых LTVEC суммарная длина вышележащего гомологичного плеча и нижележащего гомологичного плеча составляет по меньшей мере приблизительно 10 т.п.н. В других LTVEC длина вышележащего гомологичного плеча лежит в диапазоне от приблизительно 5 т.п.н. до приблизительно 100 т.п.н. и/или длина нижележащего гомологичного плеча лежит в диапазоне от приблизительно 5 т.п.н. до приблизительно 100 т.п.н. Суммарная длина вышележащего и нижележащего гомологичных плеч может составлять, например, от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 30 т.п.н., от приблизительно 30 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 50 т.п.н., от приблизительно 50 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 70 т.п.н., от приблизительно 70 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 90 т.п.н., от приблизительно 90 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 110 т.п.н., от приблизительно 110 т.п.н. до приблизительно 120 т.п.н., от приблизительно 120 т.п.н. до приблизительно 130 т.п.н., от приблизительно 130 т.п.н. до приблизительно 140 т.п.н., от приблизительно 140 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 160 т.п.н., от приблизительно 160 т.п.н. до приблизительно 170 т.п.н., от приблизительно 170 т.п.н. до приблизительно 180 т.п.н., от приблизительно 180 т.п.н. до приблизительно 190 т.п.н. или от приблизительно 190 т.п.н. до приблизительно 200 т.п.н. В некоторых случаях LTVEC и полинуклеотидная вставка сконструированы так, чтобы позволить в целевом локусе делецию от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 150 т.п.н., или от приблизительно 150 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 400 т.п.н., от приблизительно 400 т.п.н. до приблизительно 500 т.п.н., от приблизительно 500 т.п.н. до приблизительно 1 млн п. н., от приблизительно 1 млн п. н. до приблизительно 1,5 млн п. н., от приблизительно 1,5 млн п. н. до приблизительно 2 млн п. н., от приблизительно 2 млн п. н. до приблизительно 2,5 млн п. н., или от приблизительно 2,5 млн п. н. до приблизительно 3 млн п. н. В альтернативном варианте осуществления делеция может составлять по меньшей мере 10 т.п.н., по меньшей мере 20 т.п.н., по меньшей мере 30 т.п.н., по меньшей мере 40 т.п.н., по меньшей мере 50 т.п.н., по меньшей мере 60 т.п.н., по меньшей мере 70 т.п.н., по меньшей мере 80 т.п.н., по меньшей мере 90 т.п.н., по меньшей мере 100 т.п.н., по меньшей мере 150 т.п.н., по меньшей мере 200 т.п.н., по меньшей мере 250 т.п.н., по меньшей мере 300 т.п.н., по меньшей мере 350 т.п.н., по меньшей мере 400 т.п.н., по меньшей мере 450 т.п.н. или по меньшей мере 500 т.п.н. или более.

В других случаях LTVEC и полинуклеотидная вставка предназначены для того, чтобы обеспечить вставку в целевой локус экзогенной полинуклеотидной последовательности длиной в диапазоне от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 60 т.п.н., от приблизительно 60 т.п.н. до приблизительно 80 т.п.н., от приблизительно 80 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 200 т.п.н., от приблизительно 200 т.п.н. до приблизительно 250 т.п.н., от приблизительно 250 т.п.н. до приблизительно 300 т.п.н., от приблизительно 300 т.п.н. до приблизительно 350 т.п.н. или от приблизительно 350 т.п.н. до приблизительно 400 т.п.н. В альтернативном варианте осуществления инсерция может составлять по меньшей мере 10 т.п.н., по меньшей мере 20 т.п.н., по меньшей мере 30 т.п.н., по меньшей мере 40 т.п.н., по меньшей мере 50 т.п.н., по меньшей мере 60 т.п.н., по меньшей мере 70 т.п.н., по меньшей мере 80 т.п.н., по меньшей мере 90 т.п.н., по меньшей мере 100 т.п.н., по меньшей мере 150 т.п.н., по меньшей мере 200 т.п.н., по меньшей мере 250 т.п.н., по меньшей мере 300 т.п.н., по меньшей мере 350 т.п.н., по меньшей мере 400 т.п.н., по меньшей мере 450 т.п.н. или по меньшей мере 500 т.п.н. или более. В других случаях длина полинуклеотидной вставки и/или удаляемой области эндогенного локуса составляет по меньшей мере 100, 200, 300, 400, 500, 600, 700, 800 или 900 нуклеотидов или по меньшей мере 1 т.п.н., 2 т.п.н., 3 т.п.н., 4 т.п.н., 5 т.п.н., 6 т.п.н., 7 т.п.н., 8 т.п.н., 9 т.п.н., 10 т.п.н., 11 т.п.н., 12 т.п.н., 13 т.п.н., 14 т.п.н., 15 т.п.н., 16 т.п.н. или более.

iv. Способы интегрирования полинуклеотидной вставки вблизи сайта распознавания на хромосоме посредством гомологичной рекомбинации

В некоторых примерах способы модификации целевого геномного локуса на хромосоме в плюрипотентной клетке могут включать в себя: (а) получение клетки, содержащей целевой геномный локус на хромосоме, (b) введение в клетку первого нацеливающего вектора, содержащего первую полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым последовательностям; и (с) идентификацию по меньшей мере одной клетки, содержащей в своем геноме первую полинуклеотидную вставку, интегрированную в целевой геномный локус на хромосоме. Как подробно описано в других разделах настоящего документа, в конкретных вариантах осуществления суммарная длина первого гомологичного плеча и второго гомологичного плеча нацеливающего вектора составляет приблизительно 4 т.п.н., 5 т.п.н., 6 т.п.н., 7 т.п.н., 8 т.п.н., 9 т.п.н., от приблизительно 4 т.п.н. до приблизительно 5 т.п.н., от приблизительно 5 т.п.н. до приблизительно 6 т.п.н., от приблизительно 6 т.п.н. до приблизительно 7 т.п.н., от приблизительно 8 т.п.н. до приблизительно 9 т.п.н. или составляет по меньшей мере 10 т.п.н., или по меньшей мере 10 т.п.н. и менее чем 150 т.п.н. В некоторых вариантах осуществления используют LTVEC. В одном не имеющем ограничительного характера варианте осуществления такие способы выполняют с применением культуральной среды, предложенной в настоящем документе.

В других примерах способы модификации целевого геномного локуса на хромосоме в плюрипотентной клетке могут включать в себя: (а) получение клетки, содержащей на хромосоме целевой геномный локус, имеющий сайт распознавания для нуклеазного агента, (b) введение в клетку (i) нуклеазного агента, причем нуклеазный агент создает одноцепочечный или двухцепочечный разрыв в первом сайте распознавания; и (ii) первого нацеливающего вектора, содержащего первую полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым последовательностям, расположенным в достаточной близости к первому сайту распознавания; и (с) идентификацию по меньшей мере одной клетки, содержащей в своем геноме первую полинуклеотидную вставку, интегрированную в целевой геномный локус на хромосоме. Как подробно описано в других разделах настоящего документа, в конкретных вариантах осуществления суммарная длина первого гомологичного плеча и второго гомологичного плеча нацеливающего вектора составляет приблизительно 4 т.п.н., 5 т.п.н., 6 т.п.н., 7 т.п.н., 8 т.п.н., 9 т.п.н., от приблизительно 4 т.п.н. до приблизительно 5 т.п.н., от приблизительно 5 т.п.н. до приблизительно 6 т.п.н., от приблизительно 6 т.п.н. до приблизительно 7 т.п.н., от приблизительно 8 т.п.н. до приблизительно 9 т.п.н. или составляет по меньшей мере 10 т.п.н., или по меньшей мере 10 т.п.н. и менее чем 150 т.п.н. В некоторых вариантах осуществления используют LTVEC. В одном не имеющем ограничительного характера варианте осуществления такие способы выполняют с применением культуральной среды, предложенной в настоящем документе.

Для идентификации плюрипотентных клеток, имеющих интегрированную в целевой геномный локус полинуклеотидную вставку, можно также использовать различные способы. Инсерция полинуклеотидной вставки в целевой геномный локус приводит к «модификации аллеля». Термин «модификация аллеля» или МОА включает модификацию точной последовательности ДНК одного аллеля гена (-ов) хромосомного (-ых) локуса (-ов) в геноме. Примеры «модификации аллеля» (МОА) включают, без ограничений, делеции, замены или инсерции всего одного нуклеотида или делеции многих тысяч пар нуклеотидов, охватывающих интересующий (-ие) ген (-ы) или хромосомный (-ые) локус (-ы), а также любые и все возможные модификации между этими двумя крайностями.

В различных вариантах осуществления для облегчения идентификации нацеленной модификации используют высокопроизводительный количественный анализ, а именно - анализ определения модификации аллеля (МОА). Описанный в настоящем документе анализ МОА позволяет проводить крупномасштабный скрининг модифицированного (-ых) аллеля (-ей) в родительской хромосоме после генетической модификации. Анализ МОА можно проводить посредством различных аналитических методик, включая, без ограничений, количественную полимерную цепную реакцию (ПЦР), например ПЦР в реальном времени (кПЦР). Например, ПЦР в реальном времени включает в себя первый набор праймеров-зондов, который распознает целевой локус, и второй набор праймеров-зондов, который распознает нецелевой эталонный локус. Кроме того, набор праймеров-зондов содержит флуоресцентный зонд, который распознает амплифицированную последовательность. Количественный анализ также может быть осуществлен посредством различных аналитических методик, включая, без ограничений, флуоресцентную гибридизацию in situ (FISH), сравнительную геномную гибридизацию, изотермическую амплификацию ДНК, количественную гибридизацию с иммобилизованным (-ыми) зондом (-ами), технологии с использованием зондов Invader Probes®, ММР assays®, TaqMan® Molecular Beacon и Eclipse™. См., например, публикацию US2005/0144655, включенную в настоящий документ в полном объеме путем ссылки. В различных вариантах осуществления в присутствии одно- или двухцепочечного разрыва эффективность нацеливания нацеливающего вектора (такого как LTVEC) в целевом геномном локусе увеличивается по меньшей мере приблизительно в 2 раза, по меньшей мере приблизительно в 3 раза, по меньшей мере приблизительно в 4 раза по сравнению с отсутствием одно- или двухцепочечного разрыва (при использовании, например, того же нацеливающего вектора и тех же гомологичных плеч и соответствующих целевых сайтов в интересующем геномном локусе, но без добавления нуклеазного агента, который выполняет одно- или двухцепочечный разрыв). Различные способы, изложенные выше, могут последовательно повторяться, чтобы обеспечить нацеленную интеграцию любого количества полинуклеотидных вставок в данный целевой геномный локус на хромосоме. Таким образом, различные способы обеспечивают вставку в целевой локус по меньшей мере 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более полинуклеотидных вставок в целевой геномный локус на хромосоме. В некоторых вариантах осуществления такие способы последовательного мозаичного расположения позволяют проводить реконструкцию больших геномных областей из клетки животного или из клетки млекопитающего (т.е. человека, не относящегося к человеку животного, грызуна, мыши, обезьяны, крысы, хомяка, домашнего млекопитающего животного или сельскохозяйственного животного) в целевом геномном локусе на хромосоме. В таких случаях перенос и реконструкция геномных областей, которые включают в себя как кодирующие, так и некодирующие области, позволяет сохранить сложность данной области путем сохранения, по меньшей мере частично, кодирующих областей, некодирующих областей и вариантов числа копий в нативной геномной области. Таким образом, в различных способах предложены, например, способы создания «гетерологичных» или «экзогенных» геномных областей в человеческой ИПС-клетке или неплюрипотентной клетке, трансформированной для проявления плюрипотентного состояния.

v. Интересующие полинуклеотиды

Любой интересующий полинуклеотид может содержаться в различных полинуклеотидных вставках и, таким образом, быть интегрированным в целевой геномный локус на хромосоме. Способы, описанные в настоящем документе, обеспечивают интеграцию в целевой геномный локус по меньшей мере 1, 2, 3, 4, 5, 6 или более интересующих полинуклеотидов.

При интеграции в целевой геномный локус на хромосоме интересующий полинуклеотид, находящийся внутри полинуклеотидной вставки, может вводить одну или более генетических модификаций в плюрипотентную клетку. Генетическая модификация может представлять собой делецию эндогенной нуклеотидной последовательности и/или добавление экзогенного, или гетерологичного, или ортологичного полинуклеотида в целевой геномный локус. В одном варианте осуществления генетическая модификация представляет собой замещение в целевом геномном локусе эндогенной нуклеотидной последовательности интересующим экзогенным полинуклеотидом. Таким образом, в настоящем документе предложены способы, обеспечивающие получение генетической модификации, представляющей собой нокаут, делецию, инсерцию, замещение (нокин), точечную мутацию, перестановку доменов, перестановку экзонов, перестановку интронов, перестановку регуляторных последовательностей, перестановку генов или их комбинацию в целевом геномном локусе на хромосоме. Такие модификации могут происходить при интеграции в целевой геномный локус первой, второй, третьей, четвертой, пятой, шестой, седьмой или любой последующей полинуклеотидной вставки. Интересующий полинуклеотид, находящийся внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус, может содержать последовательность, являющуюся нативной или гомологичной для плюрипотентной клетки, в которую его вводят; интересующий полинуклеотид может быть гетерологичным по отношению к клетке, в которую его вводят; интересующий полинуклеотид может быть экзогенным по отношению к клетке, в которую его вводят; интересующий полинуклеотид может быть ортологичным по отношению к клетке, в которую его вводят; или интересующий полинуклеотид может происходить из вида, отличного от клетки, в которую его вводят.«Гомологичный» в отношении последовательности означает последовательность, которая является нативной по отношению к клетке. «Гетерологичный» в отношении последовательности включает последовательность, полученную из другого вида или, если она получена от того же вида, по существу подвергнутую модификации относительно ее нативной формы в композиции и/или в геномном локусе в результате целенаправленного вмешательства человека. «Экзогенный» в отношении последовательности означает последовательность, которая происходит из другого вида. «Ортологичный» означает полинуклеотид из одного вида, который является функционально эквивалентным известной эталонной последовательности из другого вида (т.е. видовой вариант). Интересующий полинуклеотид может быть получен из любого интересующего организма, включая, без ограничений, не относящегося к человеку животного, грызуна, хомяка, мышь, крысу, человека, обезьяну, птицу, сельскохозяйственное млекопитающее животное или несельскохозяйственное млекопитающее животное. Интересующий полинуклеотид может дополнительно содержать кодирующую область, некодирующую область, регуляторную область или геномную ДНК. Таким образом, 1, 2, 3, 4, 5, 6, 7-я и/или любая из последующих полинуклеотидных вставок может содержать такие последовательности.

В одном варианте осуществления интересующий полинуклеотид, находящийся внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус на хромосоме, является гомологичным человеческой нуклеиновой кислоте В еще дополнительных вариантах осуществления интересующий полинуклеотид, интегрированный в целевой локус, представляет собой фрагмент геномной нуклеиновой кислоты. В одном варианте осуществления геномная нуклеиновая кислота представляет собой геномную нуклеиновую кислоту мыши, геномную нуклеиновую кислоту человека, нуклеиновую кислоту не относящегося к человеку животного, нуклеиновую кислоту грызуна, нуклеиновую кислоту крысы, нуклеиновую кислоту хомяка, нуклеиновую кислоту обезьяны, нуклеиновую кислоту сельскохозяйственного млекопитающего животного или нуклеиновую кислоту несельскохозяйственного млекопитающего животного или их комбинацию. В одном варианте осуществления интересующий полинуклеотид может иметь длину в диапазоне от приблизительно 500 нуклеотидов до приблизительно 200 т.п.н., как описано выше. Интересующий полинуклеотид может составлять от приблизительно 500 нуклеотидов до приблизительно 5 т.п.н., от приблизительно 5 т.п.н. до приблизительно 200 т.п.н., от приблизительно 5 т.п.н. до приблизительно 10 т.п.н., от приблизительно 10 т.п.н. до приблизительно 20 т.п.н., от приблизительно 20 т.п.н. до приблизительно 30 т.п.н., от приблизительно 30 т.п.н. до приблизительно 40 т.п.н., от приблизительно 40 т.п.н. до приблизительно 50 т.п.н., от приблизительно 60 т.п.н. до приблизительно 70 т.п.н., от приблизительно 80 т.п.н. до приблизительно 90 т.п.н., от приблизительно 90 т.п.н. до приблизительно 100 т.п.н., от приблизительно 100 т.п.н. до приблизительно 110 т.п.н., от приблизительно 120 т.п.н. до приблизительно 130 т.п.н., от приблизительно 130 т.п.н. до приблизительно 140 т.п.н., от приблизительно 140 т.п.н. до приблизительно 150 т.п.н., от приблизительно 150 т.п.н. до приблизительно 160 т.п.н., от приблизительно 160 т.п.н. до приблизительно 170 т.п.н., от приблизительно 170 т.п.н. до приблизительно 180 т.п.н., от приблизительно 180 т.п.н. до приблизительно 190 т.п.н. или от приблизительно 190 т.п.н. до приблизительно 200 т.п.н.

Интересующий полинуклеотид внутри полинуклеотидной вставки и/или вставленный в целевой геномный локус на хромосоме может кодировать полипептид, может кодировать микроРНК, может кодировать длинную некодирующую РНК или может содержать любые регуляторные области или интересующие некодирующие области, включая, например, регуляторную последовательность, последовательность промотора, последовательность энхансера, последовательность, связывающую транскрипционный репрессор, или делецию не кодирующей белок последовательности, но не содержит делецию кодирующей белок последовательности. Кроме того, интересующий полинуклеотид внутри полинуклеотидной вставки и/или вставленный в целевой геномный локус на хромосоме может кодировать белок, который экспрессируется в нервной системе, костной системе, пищеварительной системе, кровеносной системе, мышечной системе, дыхательной системе, сердечнососудистой системе, лимфатической системе, эндокринной системе, мочевыделительной системе, репродуктивной системе или их комбинации. Интересующий полинуклеотид внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус на хромосоме может содержать генетическую модификацию в кодирующей последовательности. Такие генетические модификации включают, без ограничений, мутацию делеции кодирующей последовательности или слияние двух кодирующих последовательностей.

Интересующий полинуклеотид внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус на хромосоме может содержать полинуклеотид, кодирующий мутантный белок. В одном варианте осуществления мутантный белок характеризуется измененной характеристикой связывания, измененной локализацией, измененной экспрессией и/или измененным характером экспрессии. В одном варианте осуществления интересующий полинуклеотид, находящийся внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус на хромосоме, содержит по меньшей мере один аллель заболевания. В таких случаях аллель заболевания может быть доминантным аллелем, или аллель заболевания является рецессивным аллелем. Кроме того, аллель заболевания может представлять собой аллель однонуклеотидного полиморфизма (SNP). Интересующий полинуклеотид, кодирующий мутантный белок, может быть получен из любого организма, включая, без ограничений, кодирующий мутантный белок полинуклеотид от млекопитающего, не относящегося к человеку млекопитающего, грызуна, мыши, крысы, человека, обезьяны, сельскохозяйственного млекопитающего животного или домашнего млекопитающего животного.

Интересующий полинуклеотид внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус на хромосоме может также содержать регуляторную последовательность, включая, например, последовательность промотора, последовательность энхансера, последовательность, связывающую транскрипционный репрессор, или последовательность терминатора транскрипции. В конкретных вариантах осуществления интересующий полинуклеотид внутри полинуклеотидной вставки и/или интегрированный в целевой геномный локус на хромосоме содержит полинуклеотид с делецией не кодирующей белок последовательности, но не содержит делецию кодирующей белок последовательности. В одном варианте осуществления делеция не кодирующей белок последовательности содержит делецию регуляторной последовательности. В другом варианте осуществления делеция регуляторного элемента содержит делецию последовательности промотора. В одном варианте осуществления делеция регуляторного элемента содержит делецию последовательности энхансера. Такой интересующий полинуклеотид может быть получен из любого организма, включая, без ограничений, кодирующий мутантный белок полинуклеотид от млекопитающего, не относящегося к человеку млекопитающего, грызуна, мыши, крысы, человека, обезьяны, сельскохозяйственного млекопитающего животного или домашнего млекопитающего животного.

Все патентные заявки, веб-сайты, другие публикации, учетные номера и т.п., упомянутые выше или ниже, полностью включены в настоящий документ путем ссылки для любых целей в равной мере, как если бы было указано, что та или иная индивидуальная позиция отдельно и в индивидуальном порядке включена таким образом путем ссылки на нее. Если в различные моменты времени с тем или иным учетным номером связаны различные версии той или иной последовательности, подразумевается версия, связанная с учетным номером на действительную дату подачи настоящей заявки. Под действительной датой подачи подразумевается наступающая ранее из фактической даты подачи или даты подачи приоритетной заявки, где приводится ссылка на учетный номер (если применимо). Аналогичным образом, если в различные моменты времени издаются различные редакции публикации, веб-сайта и т.п., то, если не указано иное, подразумевается наиболее поздняя изданная версия на действительную дату подачи заявки. Если специально не указано иное, любое свойство, стадия, элемент, вариант осуществления или аспект настоящего изобретения может использоваться в сочетании с любым другим из перечисленного. Специалисту в области, к которой принадлежат эти способы и композиции, будут ясны многие модификации и другие варианты осуществления представленных в настоящем документе способов и композиций, имеющих преимущества идей, представленных в изложенных ниже описаниях и связанных рисунках. Таким образом, следует понимать, что способы и композиции не должны быть ограничены конкретными описанными вариантами осуществления и что модификации и другие варианты осуществления включены в объем приложенных пунктов формулы изобретения. Хотя в настоящем документе используются конкретные термины, они применяются только в общем и описательном смысле, а не для целей ограничения.

Описанное изобретение может быть осуществлено в других конкретных формах без отклонения от его духа или необходимых атрибутов, и, соответственно, следует обращаться к прилагаемым пунктам формулы изобретения, обозначающим объем изобретения, а не к вышеизложенному описанию.

Следующие примеры предлагаются в качестве иллюстрации, а не в качестве ограничения.

ПРИМЕРЫ

Пример 1. Получение человеческих ИПС-клеток.

В настоящем примере описывается получение человеческих ИПС-клеток из неплюрипотентных человеческих клеток. Пример протокола приведен в таблице 2. Векторы PiggyBac (System Biosciences) (PB-600A_CAGGGS Bst XI (0,64 мкг/мкл) и PB-200 (0,99 мкг/мкл), содержащие гены, которые кодируют четыре репрограммирующих фактора (hOct4, hSox2, hKLF-4, hMYC), функционально связанные с промотором СМ7, были введены в фибробласты крайней плоти новорожденных людей с использованием реагентов для трансфекции RED и BLUE GeneIn™ (GlobalStem). Трансфицированные клетки инкубировали на питающих клетках NuFF1 b среде Е7 (Life Technologies), чтобы обеспечить внедрение векторов и экспрессию репрограммирующих факторов. Среда Е7 содержала DMEM/F-12, NaHCO3, L-аскорбиновую кислоту, инсулин, трансферрин, селен и FGF-2.

Пуромициновую селекцию начинали через 10 дней после трансфекции, используя 2 мкг/мл пуромицина в среде Е7. На 21-й день колонии отбирали и культивировали в среде mTeSR™ (среда mTeSR™1 производства STEMCELL Technologies), содержащей DMEM/F-12, NaHCO3, L-аскорбиновую кислоту, инсулин, трансферрин, селен, FGF-2, TGF-β1, глутатион, L-глутамин, определенные липиды, тиамин, следовые количества элементов В и С, β-маркаптоэтанол, бычий сывороточный альбумин, пипеколиновую кислоту, хлорид лития и ГАМК. Сравнение компонентов среды mTeSR™ и среды Е7 показано в таблице 3. С 29-го по 57-й день клетки размножали и пассировали в среде mTeSR™ до достижения ~50% конфлюэнтности в 6-луночных планшетах. С 65-го по 73-й день размножение клеток и пассирование продолжали, используя среду mTeSR™ и реагент Gentle Cell Dissociation Reagent (Stem Cell Technologies). На 76-й день среду меняли на среду с низкой осмоляльностью VG2i для дальнейшего размножения, пассирования и поддержания клеток, содержащих интактные или выглядящие интактными клетки hiPSC. Время пассирования в вышеуказанном способе определяли по морфологии клеток.

Пример 2. Нацеливание LTVEC в человеческих ИПС-клетках.

В этом примере описано использование нацеливания LTVEC в человеческих ИПС-клетках. Как показано на Фиг. 1, мы внедрили методом электропорации в человеческие ИПС-клетки, размноженные в среде VG2i, следующие молекулы нуклеиновых кислот: (1) LTVEC (0,67 мкг); (2) плазмиду, кодирующую эндонуклеазу Cas9 (5 мкг); и (3) плазмиду, кодирующую одноцепочечную гидовую РНК CRISPR (гРНК) (10 мкг). В одном наборе образцов Cas9 и гРНК были исключены. В частности, 3×106 клеток подвергли электропорации при напряжении 700 В, емкости 25 мкФ и сопротивлении 400 Ом. LTVEC содержал нуклеиновую кислоту длиной 16,7 т.п.н., содержащую мышиные гены Adam6a и Adam6b, фланкированные гомологичными плечами, содержащими 34 т.п.н. и 105 т.п.н. геномной ДНК, происходящей из геномных областей, фланкирующих последовательность из 4,1 т.п.н. человеческого локуса ADAM6, предназначенного к удалению. Этот LTVEC также содержал кассету селекции лекарственными средствами, управляющую экспрессией фермента, придающего устойчивость к антибиотику (гигромицину). Использованная человеческая гРНК ADAM6 имела следующую последовательность: GTATAGCCCTGTTACACATT (SEQ ID NO: 1). Клетки, захватившие LTVEC и внедрившие его в свои геномы, были способны расти и образовывать колонии на покрытых материалом GELTREX™ чашках Петри в питательной среде, содержащей антибиотик. Поскольку мы внедрили в 500-1000 раз больше молекул нуклеиновых кислот, кодирующих CRISPR/Cas9, чем молекул LTVEC, большинство LTVEC-содержащих устойчивых к лекарству колоний также содержали, по меньшей мере временно, компоненты CRISPR/Cas9. Мы собрали устойчивые к лекарству колонии и провели скрининг методом потери аллеля (Valenzuela et al. (2003) Nat. Biotech. 21:652-660; Frendewey et al. (2010) Methods Enzymol. 476:295-307; полностью включены в настоящий документ путем ссылки) с целью идентификации клонов, имеющих аллель с правильным нацеливанием. Результаты облегченного с помощью CRISPR/Cas9 нацеливания LTVEC для локуса ADAM6 представлены в таблице 4.

Если в человеческие ИПС-клетки внедрялся только LTVEC, то эффективность нацеливания составляла 3,1%. С другой стороны, комбинация LTVEC с Cas9, направляемым гРНК ADAM6, приводила к эффективности нацеливания 7,3%).

Пример 3. Влияние среды с низкой осмоляльностью на морфологию человеческих ИПС-клеток.

В настоящем примере описано влияние концентрации соли, ионной силы и/или осмоляльности на состояние плюрипотентности человеческих ИПС-клеток в культуре. Человеческие ИПС-клетки культивировали на субстрате MATRIGEL™ или GELTREX™ в среде, описанной в таблице 5 (итоговая концентрация hLIF 100 ед/мл; итоговая концентрация CHIR99021 3 мкМ и итоговая концентрация PD0325901 0,5 мкМ), или в среде mTeSR™-hLIF.

Когда используемая основная среда представляла собой DMEM, эта среда называлась 2i. Когда используемая основная среда представляла собой VG-DMEM, эта среда с низкой осмоляльностью называлась VG2i. Осмоляльность среды VG2i (233 мОсм/кг) ниже, чем осмоляльность традиционной среды 2i (261 мОсм/кг). В таблице 6 показаны осмоляльности этих сред, а также осмоляльности разных основных сред и компонентов сред.

Как показано на Фиг. 2, человеческие ИПС-клетки, культивированные на субстрате MATRIGEL™ в среде 2i в течение периода времени 8 дней (Фиг. 2А) или 12 дней (Фиг. 2В), проявляли морфологию, характерную для ИПС-клеток в праймированном состоянии, в частности рост в эпителиальном монослое и проявление апикально-базальной полярности.

Далее проводили оценку влияния среды mTeSR™-hLIF и среды VG2i на морфологию и состояние плюрипотентности человеческих ИПС-клеток. В этом исследовании человеческие ИПС-клетки культивировали на субстрате MATRIGEL™ или питающих клетках NuFF в среде mTeSR™-hLIF (Фиг. 3А и 3С) или в среде VG2i (Фиг. 3В и 3D) в течение периода времени 6 дней. При культивировании в среде mTeSR™-hLIF на субстрате MATRIGEL™ или питающих клетках NuFF человеческие ИПС-клетки проявляли морфологию, характерную для праймированного плюрипотентного состояния, в частности рост в эпителиальном монослое и проявление апикально-базальной полярности. Некоторые клетки, культивированные в среде mTeSR™-hLIF, начинали проявлять морфологию, характеризующуюся трехмерными скоплениями. Напротив, при культивировании в среде VG2i на субстрате MATRIGEL™ или питающих клетках NuFF человеческие ИПС-клетки проявляли морфологию, характерную для интактного плюрипотентного состояния, в частности рост в виде круглых, куполообразных колоний и отсутствие апикально-базальной полярности.

Пример 4. Влияние среды с низкой осмоляльностью на экспрессию маркеров плюрипотентности в человеческих ИПС-клетках.

В данном примере описывается влияние концентрации соли, ионной силы и/или осмоляльности на экспрессию маркеров плюрипотентности в человеческих ИПС-клетках, перепрограммированных из праймированного в интактное состояние. После 24 дней культивирования в среде VG2i на субстрате MATRIGEL™ перепрограммированные интактные человеческие ИПС-клетки окрашивались на экспрессию щелочной фосфатазы или NANOG. Наблюдали, что перепрограммированные клетки сильно экспрессировали как щелочную фосфатазу (Фиг. 4А), так и NANOG (Фиг. 4В и 4С), что является показателем интактного плюрипотентного состояния.

Пример 5. Влияние среды с низкой осмоляльностью на ферментативную диссоциацию и пересев человеческих ИПС-клеток.

В этом примере человеческие ИПС-клетки, перепрограммированные в интактное состояние с использованием среды с низкой осмоляльностью VG2i, подвергали ферментативной диссоциации с использованием трипсина для создания суспензии одиночных клеток (Фиг. 5А). Суспензию клеток пассировали на новые планшеты, покрытые субстратом GELTREX™, для пересева в среде VG2i. Наблюдали, что после 1 дня (Фиг. 5В) и 4 дней (Фиг. 5С) пересеянные клетки продолжали проявлять морфологические характеристики клеток, находящихся в интактном плюрипотентном состоянии. В частности, клетки росли в виде округлых куполообразных колоний и не проявляли апикально-базальной полярности. Было отмечено, что ферментативную диссоциацию можно выполнять в отсутствие ингибитора ROCK, который обычно необходим для предотвращения активации проапоптозных путей. Это предполагает, что проапоптозные пути не так сильно активируются при ферментативной диссоциации и пересеве в интактных человеческих ИПС-клетках, культивированных в описанных в настоящем документе условиях. Кроме этого, человеческие ИПС-клетки, культивированные в среде VG2i и пассированные в виде одиночных клеток после ферментативной диссоциации трипсином, сохраняют нормальный кариотип. Две относящиеся к 10-му пассажу человеческие ИПС-клетки, происходящие от разных клонов и полученные после диссоциации трипсином для создания суспензии одиночных клеток, были кариотипированы, и обе имели нормальный кариотип 46 XY (Фиг. 6А и 6В).

1. Способ получения популяции человеческих индуцированных плюрипотентных стволовых клеток (hiPSC), включающий культивирование in vitro популяции фибробластов, трансформированных для экспрессии плюрипотентного состояния, в среде с низкой осмоляльностью, содержащей основную среду и добавки, в котором добавки содержат:

(a) полипептид, являющийся фактором, ингибирующим лейкемию (LIF);

(b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и

(c) ингибитор MEK, и

причем среда с низкой осмоляльностью имеет осмоляльность от 200 до 250 мОсм/кг.

2. Способ по п. 1, в котором трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до культивирования в среде с низкой осмоляльностью, причем среда с высокой осмоляльностью содержит bFGF, необязательно причем среда с высокой осмоляльностью имеет осмоляльность по меньшей мере приблизительно 290 мОсм/кг и необязательно причем:

(a) трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят характеристики интактного состояния;

(b) трансформированные клетки сначала культивируют в среде с высокой осмоляльностью в течение периода приблизительно двух месяцев;

(c) трансформированные клетки сначала культивируют в среде с высокой осмоляльностью до тех пор, пока они не проявят морфологию, характеризующуюся трехмерными скоплениями клеток, или

(d) их комбинация.

3. Способ поддержания популяции человеческих индуцированных плюрипотентных стволовых клеток (hiPSC) в интактном состоянии в культуре in vitro, включающий культивирование популяции клеток hiPSC в среде с низкой осмоляльностью, содержащей основную среду и добавки, в котором добавки содержат:

(a) полипептид, являющийся фактором, ингибирующим лейкемию (LIF);

(b) ингибитор гликоген-синтазы-киназы 3 (GSK3) и

(c) ингибитор MEK, и

причем среда с низкой осмоляльностью имеет осмоляльность от 200 до 250 мОсм/кг.

4. Способ по любому из пп. 1-3, дополнительно включающий ферментативную диссоциацию hiPSC в суспензию одиночных клеток и пересеивание ферментативно диссоциированных hiPSC.

5. Способ по п. 4, в котором ферментативную диссоциацию:

(a) выполняют с использованием трипсина;

(b) выполняют в отсутствие ингибитора ROCK или

(c) их комбинация, и

причем пересеянные hiPSC:

(a) продолжают экспрессировать один или более маркеров плюрипотентности;

(b) сохраняют интактное состояние и проявляют морфологию, характеризующуюся компактными куполообразными колониями, или

(c) их комбинация, и

причем пересеянные hiPSC сохраняют нормальный кариотип.

6. Способ модификации целевого геномного локуса в человеческой индуцированной плюрипотентной стволовой клетке (hiPSC), включающий:

(a) введение в hiPSC нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5'- и 3'-гомологичными плечами, соответствующими 5'- и 3'-целевым сайтам в целевом геномном локусе, и

(b) идентификацию генетически модифицированной hiPSC, содержащей в своем геноме полинуклеотидную вставку, встроенную в целевой геномный локус,

причем hiPSC культивируют в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем добавки содержат:

(i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF);

(ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и

(iii) ингибитор MEK, и

причем среда с низкой осмоляльностью имеет осмоляльность от 200 до 250 мОсм/кг.

7. Способ по п. 6, в котором нацеливающий вектор представляет собой большой нацеливающий вектор (LTVEC), причем общая суммарная длина 5'- и 3'-гомологичных плеч составляет по меньшей мере 10 т. п. н.

8. Способ по п. 6 или 7, в котором нацеленная генетическая модификация включает:

(a) делецию эндогенной человеческой нуклеотидной последовательности;

(b) вставку экзогенной нуклеотидной последовательности, необязательно причем экзогенная нуклеотидная последовательность содержит одно или более из следующего:

(i) нуклеотидная последовательность, которая является гомологичной или ортологичной эндогенной человеческой нуклеотидной последовательности;

(ii) химерная нуклеотидная последовательность;

(iii) условный аллель, фланкированный целевыми последовательностями сайт-специфичной рекомбиназы, и

(iv) репортерный ген, функционально связанный с промотором, активным в hiPSC; или

(с) замену эндогенной человеческой нуклеотидной последовательности экзогенной нуклеотидной последовательностью,

необязательно причем нацеленная генетическая модификация является биаллельной.

9. Способ по любому из пп. 6-8, в котором начальный этап (а) дополнительно включает введение нуклеазного агента, стимулирующего гомологичную рекомбинацию между нацеливающим вектором и целевым геномным локусом в hiPSC.

10. Способ модификации целевого геномного локуса в человеческой индуцированной плюрипотентной стволовой клетке (hiPSC), включающий:

(a) внедрение в hiPSC нуклеазного агента, который создает один или более одноцепочечных или двухцепочечных разрывов в сайте распознавания в целевом геномном локусе для создания модификации целевого геномного локуса, и

(b) идентификацию по меньшей мере одной hiPSC, содержащей в своем геноме модификацию целевого геномного локуса;

причем hiPSC культивируют в среде с низкой осмоляльностью, содержащей основную среду и добавки, причем добавки содержат:

(i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF);

(ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и

(iii) ингибитор MEK, и

причем среда с низкой осмоляльностью имеет осмоляльность от 200 до 250 мОсм/кг.

11. Способ по п. 9 или 10, в котором нуклеазный агент содержит:

(a) нуклеазу с «цинковыми пальцами» (ZFN);

(b) эффекторную нуклеазу, подобную активатору транскрипции (TALEN);

(c) мегануклеазу или

(d) белок Cas, ассоциированный с короткими палиндромными повторами, регулярно расположенными группами (CRISPR), и гидовую РНК (гРНК), содержащую CRISPR РНК (крРНК), распознающую геномную целевую последовательность, и трансактивирующую CRISPR РНК (тракрРНК).

12. Способ по п. 11, в котором нуклеазный агент содержит белок Cas и гидовую РНК, причем белок Cas представляет собой Cas9.

13. Способ по любому из пп. 6-12, в котором до этапа (a) hiPSC подвергают ферментативной диссоциации в суспензию одиночных клеток и пересеивают.

14. Способ по п. 13, в котором ферментативную диссоциацию:

(a) выполняют с использованием трипсина;

(b) выполняют в отсутствие ингибитора ROCK или

(c) их комбинация, и

причем пересеянные hiPSC:

(a) продолжают экспрессировать один или более маркеров плюрипотентности;

(b) сохраняют интактное состояние и проявляют морфологию, характеризующуюся компактными куполообразными колониями, или

(c) их комбинация, и

причем пересеянные hiPSC сохраняют нормальный кариотип.

15. Способ по любому из пп. 1-14, в котором hiPSC имеют нормальный кариотип, и причем hiPSC:

(a) включают интактные hiPSC;

(b) экспрессируют один или более маркеров плюрипотентности, необязательно причем маркеры плюрипотентности включают в себя NANOG, щелочную фосфатазу или их комбинацию;

(c) проявляют морфологию, характеризующуюся компактными куполообразными колониями;

(d) могут дифференцироваться в клетки любого из зародышевых листков эндодермы, эктодермы или мезодермы;

(e) имеют время удвоения от приблизительно 16 часов до приблизительно 24 часов или

(f) любая комбинация (а)-(е).

16. Способ по любому из пп. 1-15, в котором hiPSC происходят от фибробластов, трансформированных для экспрессии плюрипотентного состояния, причем трансформированные фибробласты экспрессируют репрограммирующие гены, включающие в себя Oct4, Sox2, Klf4, Мус или любую их комбинацию.

17. Способ по любому из пп. 1-16, в котором основная среда имеет осмоляльность от приблизительно 180 до приблизительно 250 мОсм/кг, необязательно причем основная среда содержит хлорид натрия в концентрации приблизительно 3 мг/мл, бикарбонат натрия в концентрации приблизительно 2,2 мг/мл и имеет осмоляльность приблизительно 200 мОсм/кг, и необязательно причем основная среда содержит глюкозу в концентрации приблизительно 4,5 мг/мл.

18. Способ по любому из пп. 1-17, в котором среда с низкой осмоляльностью имеет осмоляльность от приблизительно 220 до приблизительно 240 мОсм/кг, необязательно причем среда с низкой осмоляльностью имеет осмоляльность от приблизительно 225 до приблизительно 235 мОсм/кг, и необязательно причем среда с низкой осмоляльностью имеет осмоляльность приблизительно 233 мОсм/кг.

19. Способ по любому из пп. 1-18, в котором:

(a) добавки дополнительно содержат

(i) среду F-12;

(ii) добавку N2;

(iii) среду NEUROBASAL;

(iv) добавку В-27;

(v) L-глутамин;

(vi) 2-меркаптоэтанол или

(vii) любую комбинацию (i)-(vi);

(b) полипептид LIF представляет собой человеческий полипептид LIF (hLIF);

(c) ингибитор GSK3 включает CHIR99021;

(d) ингибитор MEK включает PD0325901 или

(e) любая комбинация (a)-(d),

необязательно причем hiPSC культивируют на MATRIGEL, питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) или GELTREX.

20. Способ по любому из пп. 1-19, в котором среда с низкой осмоляльностью содержит среду F-12 и среду NEUROBASAL.

21. Способ по любому из пп. 1-20, в котором среда с низкой осмоляльностью содержит ингибиторы, состоящие по существу из ингибитора гликоген-синтазы-киназы 3 (GSK3) и ингибитора MEK.

22. Способ по любому из пп. 1-21, в котором среда с низкой осмоляльностью содержит основную среду в концентрации приблизительно 24,75% (об./об.), среду F-12 в концентрации приблизительно 24,75% (об./об.), добавку N2 в концентрации приблизительно 0,5% (об./об.), среду NEUROBASAL в концентрации приблизительно 49% (об./об.), добавку В-27 в концентрации приблизительно 1% (об./об.), L-глутамин в концентрации приблизительно 2 мМ, 2-меркаптоэтанол в концентрации приблизительно 0,1 мМ, hLIF в концентрации приблизительно 100 единиц/мл, CHIR99021 в концентрации приблизительно 3 мкМ и PD0325901 в концентрации приблизительно 0,5 мкМ, необязательно причем hiPSC культивируют на MATRIGEL, питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) или GELTREX.

23. Способ по любому из пп. 1-22, в котором среда с низкой осмоляльностью не содержит одного или более из следующего: добавки bFGF; добавки TGF-β1; ингибитора JNK; ингибитора р38; ингибитора ROCK и ингибитора PKC.

24. Способ по п. 23, в котором среда с низкой осмоляльностью не содержит добавки bFGF.

25. Способ по любому из пп. 1-24, в котором hiPSC представляют собой интактные hiPSC, которые проявляют морфологию, характеризующуюся компактными куполообразными колониями.

26. Композиция для культивирования и поддержания человеческих индуцированных плюрипотентных стволовых клеток (hiPSC), содержащая:

(a) популяцию hiPSC, необязательно причем hiPSC были получены способом по любому из пп. 1-25, и

(b) среду с низкой осмоляльностью, содержащую основную среду и добавки, причем добавки содержат:

(i) полипептид, являющийся фактором, ингибирующим лейкемию (LIF);

(ii) ингибитор гликоген-синтазы-киназы 3 (GSK3) и

(iii) ингибитор MEK, и

причем среда с низкой осмоляльностью имеет осмоляльность от 200 до 250 мОсм/кг.

27. Композиция по п. 26, в которой hiPSC имеют нормальный кариотип, и причем hiPSC:

(a) включают интактные hiPSC;

(b) экспрессируют один или более маркеров плюрипотентности, необязательно причем маркеры плюрипотентности включают в себя NANOG, щелочную фосфатазу или их комбинацию;

(c) проявляют морфологию, характеризующуюся компактными куполообразными колониями;

(d) могут дифференцироваться в клетки любого из зародышевых листков эндодермы, эктодермы или мезодермы;

(e) имеют время удвоения от приблизительно 16 часов до приблизительно 24 часов или

(f) любая комбинация (а)-(е).

28. Композиция по п. 27, в которой hiPSC представляют собой интактные hiPSC, которые проявляют морфологию, характеризующуюся компактными куполообразными колониями.

29. Композиция по любому из пп. 26-28, в которой hiPSC происходят от фибробластов, трансформированных для экспрессии плюрипотентного состояния, необязательно причем трансформированные фибробласты экспрессируют репрограммирующие гены, включающие в себя Oct4, Sox2, Klf4, Мус или любую их комбинацию.

30. Композиция по любому из пп. 26-29, в которой основная среда имеет осмоляльность от приблизительно 180 до приблизительно 250 мОсм/кг, необязательно причем основная среда содержит NaCl в концентрации приблизительно 3 мг/мл, бикарбонат натрия в концентрации приблизительно 2,2 мг/мл и имеет осмоляльность приблизительно 200 мОсм/кг, необязательно причем основная среда содержит глюкозу в концентрации приблизительно 4,5 мг/мл.

31. Композиция по любому из пп. 26-30, которая имеет осмоляльность от приблизительно 220 до приблизительно 240 мОсм/кг, необязательно причем среда с низкой осмоляльностью имеет осмоляльность от приблизительно 225 мОсм/кг до приблизительно 235 мОсм/кг, и необязательно причем среда с низкой осмоляльностью имеет осмоляльность приблизительно 233 мОсм/кг.

32. Композиция по любому из пп. 26-31, в которой:

(a) добавки дополнительно содержат

(i) среду F-12;

(ii) добавку N2;

(iii) среду NEUROBASAL;

(iv) добавку В-27;

(v) L-глутамин;

(vi) 2-меркаптоэтанол или

(vii) любую комбинацию (i)-(vi);

(b) полипептид LIF представляет собой человеческий полипептид LIF (hLIF);

(c) ингибитор GSK3 представляет собой CHIR99021;

(d) ингибитор MEK представляет собой PD0325901 или

(e) любая комбинация (a)-(d),

необязательно причем hiPSC культивируют на MATRIGEL, питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) или GELTREX.

33. Композиция по любому из пп. 26-32, в которой среда с низкой осмоляльностью содержит среду F-12 и среду NEUROBASAL.

34. Композиция по любому из пп. 26-33, в которой среда с низкой осмоляльностью содержит ингибиторы, состоящие по существу из ингибитора гликоген-синтазы-киназы 3 (GSK3) и ингибитора MEK.

35. Композиция по любому из пп. 26-34, в которой среда с низкой осмоляльностью содержит основную среду в концентрации приблизительно 24,75% (об./об.), среду F-12 в концентрации приблизительно 24,75% (об./об.), добавку N2 в концентрации приблизительно 0,5% (об./об.), среду NEUROBASAL в концентрации приблизительно 49% (об./об.), добавку В-27 в концентрации приблизительно 1% (об./об.), L-глутамин в концентрации приблизительно 2 мМ, 2-меркаптоэтанол в концентрации приблизительно 0,1 мМ, hLIF в концентрации приблизительно 100 единиц/мл, CHIR99021 в концентрации приблизительно 3 мкМ и PD0325901 в концентрации приблизительно 0,5 мкМ, необязательно причем hiPSC культивируют на MATRIGEL, питающих клетках-фибробластах крайней плоти новорожденных людей (NuFF) или GELTREX.

36. Композиция по любому из пп. 26-35, в которой среда с низкой осмоляльностью не содержит одного или более из следующего: добавки bFGF; добавки TGF-β1; ингибитора JNK; ингибитора р38; ингибитора ROCK и ингибитора PKC.

37. Композиция по п. 36, в которой среда с низкой осмоляльностью не содержит добавки bFGF.

38. Композиция по любому из пп. 26-37, в которой hiPSC представлены в форме суспензии одиночных клеток, необязательно причем hiPSC в форме суспензии одиночных клеток сохраняют нормальный кариотип, и необязательно причем hiPSC в форме суспензии одиночных клеток:

(a) сохраняют экспрессию одного или более маркеров плюрипотентности;

(b) сохраняют интактное состояние или

(c) их комбинация.



 

Похожие патенты:
Изобретение относится к области биотехнологии, а именно к клеточному сфероиду, его получению и оценке эффекта воздействия на функциональную активность меланоцитов.

Изобретение относится к области биотехнологии, а именно к получению одногормональных инсулинположительных клеток. Способ, за исключением способа, в котором клетки поджелудочной железы передней кишки и клетки энтодермы поджелудочной железы получены с использованием человеческих эмбрионов, включает дифференцировку клеток поджелудочной железы передней кишки, экспрессирующих PDX-1 и NKX6.1, в клетки энтодермы поджелудочной железы путем обработки клеток поджелудочной железы передней кишки, экспрессирующих PDX-1 и NKX6.1, ингибитором shh, низкой дозой ретиноевой кислоты и аскорбиновой кислотой.
Изобретение относится к области биотехнологии, а именно к обратимому ингибированию в опухолевых клетках гепатоцеллюлярной карциномы экспрессии гена, кодирующего синтез аполипопротеина В.

Изобретение относится к области биотехнологии. Предложена композиция для активации роста дифференцированных эндотелиальных клеток роговицы, содержащая эффективное количество, по меньшей мере, одного из ламинина 511, и/или ламинина 521, и/или его функционального фрагмента Е8, которые экспрессируются в эндотелиальных клетках роговицы.

Изобретение относится к области биотехнологии, а именно к бессывороточной питательной среде, и включает основной компонентный состав питательной среды Игла MEM, а также дополнительно содержит микроэлементы (соли кадмия, кобальта, цинка, никеля, селена, молибдена) в концентрации 0,00001-4,0 г/л, пируват натрия в концентрации 0,04-4,0 г/л, витамины B12 и Е в концентрации 0,0001-0,1 г/л, олеиновую кислоту в концентрации 0,000005-0,5 г/л, цистеин, глютатион, пролин, аланин, аспарагин, аспарагиновую кислоту в концентрации 0,001-1,5 г/л, (всего 45 компонентов), рекомбинантный инсулин человека в концентрации 0,000025-0,025 г/л, а также увеличена концентрация лейцина, фенилаланина, триптофана, лизина до 0,035-0,072 г/л.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ выявления генома возбудителя бруцеллезной инфекции (Brucella spp.) у сельскохозяйственных животных, включающий выделение ДНК из биологического материала от инфицированных животных сорбционным методом, постановку одноэтапной полимеразной цепной реакции - с одновременным проведением циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома (Brucella spp.) олигонуклеотидных праймеров, зондов, красителей и контрольных образцов в виде внутреннего и положительного, измерение специфического сигнала и сигнала контроля по каналам соответствующих красителей и интерпретацию результатов, где проводят флуоресцентную детекцию, измеряют по каналу JOE(HEX)/Yellow накопление флуоресцентного сигнала для специфического сигнала тестирования наличия генома возбудителя бруцеллезной инфекции (Brucella spp.), а по каналу FAM/Green - сигнал внутреннего контрольного образца, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный, а интерпретацию результатов проводят на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией, при этом для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома ДНК Brucella spp.

Изобретение относится к биотехнологии, а именно к идентификации гетерогенной популяции клеток почек, пригодной для обеспечения регенеративного стимула для почки, и лечению болезни почек у человека.

Изобретение относится к медицине, а именно к экспериментальной медицине, и может быть использовано для моделирования туберкулезной инфекции in vitro. Гранулемоподобные структуры получают из мононуклеарных клеток венозной крови в присутствии микобактерий туберкулеза, культивируемых в трехмерном матриксе.

Изобретение относится к области биотехнологии, а именно к получению клеток первичной кишечной трубки. Способ включает контактирование популяции, содержащей клетки первичной кишечной трубки, полученные последовательным дифференцированием плюрипотентных стволовых клеток человека, за исключением способа, где плюрипотентные стволовые клетки человека получены путем использования эмбриона человека, с лигандом или антителом, которые связывают Lif-рецептор.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для ингибирования экспрессии фактора комплемента В (CFB) (варианты), фармацевтическую композицию для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, способ лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, применение вышеуказанного соединения или композиции для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента, применение вышеуказанного соединения или композиции при изготовлении лекарственного средства для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента.
Данное изобретение относится к области геномной инженерии. Предложен способ мультиплексирования инсерций экзогенных последовательностей нуклеиновых кислот в ДНК клетки, экспрессирующей РНК-направляемый ДНК-связывающий белок из системы CRISPR II типа, включающий введение в клетку нескольких гидРНК, комплементарных различным сайтам ДНК, и нескольких экзогенных последовательностей донорных нуклеиновых кислот, получая несколько изменений ДНК клетки, и повторение указанной стадии множество раз.

Изобретение относится к области биотехнологии, молекулярной биологии и вирусологии. Предложен нереплицируемый, поглощаемый клеткой рабдовирус, представляющий собой вирус везикулярного стоматита, причем указанный вирус получен путем воздействия на живой вирус УФ излучением, применяемым в дозе от 100 мДж/см2 до 1000 мДж/см2, так что по меньшей мере 0,05%, но не более 80% нуклеотидов РНК вируса сшивается и/или РНК вируса расщепляется на по меньшей мере две дискретные полинуклеотидные последовательности, и при этом поверхность оболочки вирусной частицы содержит по меньшей мере 5% от числа G белков вирусной частицы дикого типа.

Изобретение относится к области биотехнологии, а именно к получению одногормональных инсулинположительных клеток. Способ, за исключением способа, в котором клетки поджелудочной железы передней кишки и клетки энтодермы поджелудочной железы получены с использованием человеческих эмбрионов, включает дифференцировку клеток поджелудочной железы передней кишки, экспрессирующих PDX-1 и NKX6.1, в клетки энтодермы поджелудочной железы путем обработки клеток поджелудочной железы передней кишки, экспрессирующих PDX-1 и NKX6.1, ингибитором shh, низкой дозой ретиноевой кислоты и аскорбиновой кислотой.

Изобретение относится к биотехнологии. Описаны способы для модулирования экспрессии целевой нуклеиновой кислоты в клетке, включающие применение множества ортогональных белков Cas9 для того, чтобы одновременно и независимо регулировать соответствующие гены или одновременно и независимо редактировать соответствующие гены.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для снижения количества РНК прекалликреина (ПКП), содержащее модифицированный олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеозидную связь, модифицированный сахар или модифицированное основание, и группу конъюгата, соль вышеуказанного соединения, фармацевтическую композицию для лечения, предупреждения или облегчения протекания заболевания, расстройства или состояния, связанного с ПКП, пролекарство для снижения количества РНК прекалликреина (ПКП), применение соединения, соли, фармацевтической композиции или пролекарства для предупреждения, лечения или облегчения заболевания, расстройства или состояния, связанного с ПКП.

Изобретение относится к области биотехнологии, конкретно к получению антибактериальных рекомбинантных белков, и может быть использовано в медицине в качестве антибактериальной композиции, проявляющей активность в отношении грамотрицательных бактерий Pseudomonas aeruginosa.

Изобретение относится к биотехнологии. Описано соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность нуклеотидных оснований, содержащую часть из по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных нуклеотидных оснований, комплементарных:(a) части равной длины нуклеотидных оснований 1053-1109 SEQ ID NO: 1;(b) части равной длины нуклеотидных оснований 606-656 SEQ ID NO: 1;(c) части равной длины нуклеотидных оснований 1693-1767 SEQ ID NO: 1;(d) части равной длины нуклеотидных оснований 1789-1826 SEQ ID NO: 1;(e) части равной длины нуклеотидных оснований 1844-1877 SEQ ID NO: 1;(f) части равной длины нуклеотидных оснований 1957-1988 SEQ ID NO: 1;(g) части равной длины нуклеотидных оснований 2291-2350 SEQ ID NO: 1;(h) части равной длины нуклеотидных оснований 3082-3141 SEQ ID NO: 1;(i) части равной длины нуклеотидных оснований 3903-3946 SEQ ID NO: 1;(j) части равной длины нуклеотидных оснований 4005-4054 SEQ ID NO: 1 или(k) части равной длины нуклеотидных оснований 4429-4454 SEQ ID NO: 1;причем модифицированный олигонуклеотид содержит по меньшей мере одну модификацию, выбранную из модифицированного сахарида и модифицированной межнуклеозидной связи, и причем модифицированный олигонуклеотид способен снижать уровни мРНК атаксина 2.

Настоящее изобретение относится к биотехнологии. Предложены композиции и системы, содержащие векторы, включающие полинуклеотидные последовательности, кодирующие компоненты комплекса CRISPR-Cas типа II, а также набор, содержащий одну из таких композиций или систем.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для ингибирования экспрессии фактора комплемента В (CFB) (варианты), фармацевтическую композицию для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, способ лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, применение вышеуказанного соединения или композиции для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента, применение вышеуказанного соединения или композиции при изготовлении лекарственного средства для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению терапевтических белков и может быть использовано для получения активного фрагмента (1-34) эндогенного человеческого паратиреоидного гормона.

Изобретение относится к области биотехнологии, а именно к получению популяции человеческих индуцированных плюрипотентных стволовых клеток, поддержанию hiPSC, модификации целевого геномного локуса в hiPSC и композиции для культивирования и поддержания hiPSC. Способ включает культивирование in vitro популяции фибробластов, трансформированных для экспрессии плюрипотентного состояния, в среде с низкой осмоляльностью от 200 мОсмкг до 250 мОсмкг, содержащей основную среду и полипептид, являющийся фактором, ингибирующим лейкемию, ингибитор гликоген-синтазы-киназы 3 и ингибитор MEK. Модификацию целевого геномного локуса в hiPSC осуществляют путем введения в hiPSC нацеливающего вектора, содержащего полинуклеотидную вставку, фланкированную 5- и 3-гомологичными плечами, соответствующими 5- и 3-целевым сайтам в целевом геномном локусе или внедрения в hiPSC нуклеазного агента, который создает один или более одноцепочечных или двухцепочечных разрывов в сайте распознавания в целевом геномном локусе для создания модификации целевого геномного локуса и идентификации генетически модифицированной hiPSC, содержащей в своем геноме полинуклеотидную вставку, встроенную в целевой геномный локус. Изобретение позволяет расширить арсенал технических средств. 5 н. и 33 з.п. ф-лы, 6 табл., 6 ил., 5 пр.

Наверх