Растение маиса dbn9936 и способ применения в детектировании его последовательности нуклеиновой кислоты

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты для детектирования объекта кукурузы DBN9936 с SEQ ID NO: 1. Также раскрыты набор для детектирования, клетка растения и часть растения, содержащие указанную последовательность; сельскохозяйственная композиция, сельскохозяйственный продукт и сельскохозяйственный товар. Раскрыты способы детектирования указанного объекта, способы защиты растения кукурузы, способ борьбы с сорняками, способ культивирования и способ получения трансгенного растения, содержащего указанный объект. Изобретение позволяет получить трансгенное растение кукурузы, устойчивое к гербициду глифосат. 15 н. и 7 з.п. ф-лы, 7 ил., 23 табл., 6 пр.

 

Область техники, к которой относится настоящее изобретение

Настоящее изобретение относится к области молекулярной биологии растений, а именно к области селекции трансгенной сельскохозяйственной культуры в сельскохозяйственном биотехнологическом исследовании. В частности, настоящее изобретение относится к устойчивому к насекомым и толерантному к гербициду глифосат трансгенному объекту кукурузы DBN9936, и последовательностям нуклеиновых кислот, и способам детектирования трансгенного объекта кукурузы DBN9936 в биологическом образце.

Уровень техники настоящего изобретения

Кукуруза (Zea mays L.) является основной зерновой сельскохозяйственной культурой во многих регионах мира. Биотехнологию применяют в отношении кукурузы для усиления агрономических признаков и повышения их качества. Устойчивость к насекомым, а именно устойчивость к насекомому из отряда Lepidoptera, такому как Ostrinia nubilalis, Helicoverpa armigera и Mythimna separata, является важным агрономическим признаком в производстве маиса. Устойчивость к Lepidoptera у кукурузы можно придать путем экспрессии гена устойчивости к Lepidoptera у растений кукурузы с помощью трансгена. Другим важным агрономическим признаком является толерантность к гербицидам, а именно толерантность к гербициду глифосат. Толерантность к гербициду глифосат у кукурузы можно придать путем экспрессии гена толерантности к гербициду глифосат (например, EPSPS) у растений кукурузы с помощью трансгена.

Известно, что экспрессия экзогенных генов у растений зависит от их положений в хромосоме, возможно, из-за структуры хроматина (например, гетерохроматина) или близости элементов регуляции транскрипции (например, энхансера) к сайту встраивания. По этой причине зачастую необходимо проводить скрининг большого количества объектов для выявления объекта, который можно коммерциализировать (т.е. объекта, в котором оптимально экспрессируется внедренный целевой ген). Например, у растений и других организмов наблюдали, что между объектами может быть большое различие в отношении уровня экспрессии введенного гена; и могут также быть различия в отношении пространственных или временных паттернов экспрессии, например, различия в относительной экспрессии трансгена в различных тканях растений, что находит свое отражение в расхождении между фактическим паттерном экспрессии и паттерном экспрессии, ожидаемым исходя из транскрипционных регуляторных элементов у вводимой генной конструкции. По этой причине обычно необходимо получать сотни, а то и тысячи различных объектов и проводить скрининг этих объектов для выявления одного объекта, у которого присутствуют необходимые уровень и паттерны экспрессии трансгена для коммерческих целей. Объект, у которого присутствуют необходимые уровни или паттерны экспрессии трансгена, пригоден для интрогрессии трансгена в другие генетические фоны путем полового межлинейного скрещивания с помощью традиционных способов селекции. Воспроизводимое путем такого скрещивания потомство сохраняет характеристики экспрессии трансгена исходного трансформанта. Эту стратегию используют для обеспечения надежной экспрессии генов у ряда сортов, которые хорошо адаптированы к местным условиям выращивания.

Было бы полезно иметь возможность детектировать наличие конкретного объекта для определения, содержит ли потомство от полового скрещивания целевой ген. Кроме того, способ детектирования конкретного объекта был бы полезен для соблюдения таких норм, как нормы, требующие предпродажного одобрения и маркировки продуктов, полученных из растений рекомбинантной сельскохозяйственной культуры. Наличие трансгена можно детектировать с помощью любых известных способов детектирования полинуклеотида, таких как полимеразная цепная реакция (ПЦР) или гибридизация ДНК с применением полинуклеотидных зондов. Такие способы детектирования обычно сосредоточены на часто применяемых генетических элементах, таких как промоторы, терминаторы, маркерные гены. В результате такие способы могут быть непригодны для дифференцировки различных объектов, особенно тех, которые получены с помощью одной и той же ДНК-конструкции, если только не известна последовательность хромосомной ДНК, примыкающая к вставленной трансгенной ДНК (фланкирующей ДНК). Поэтому для выявления конкретного трансгенного объекта с помощью ПЦР обычно применяют праймерную пару, охватывающую участок присоединения вставленного трансгена и фланкирующей ДНК, в частности, первый праймер, который включает фланкирующую последовательность, а второй праймер, который включает вставленную последовательность.

Сущность настоящего изобретения

Целью настоящего изобретения является создание растения кукурузы DBN9936, и последовательностей нуклеиновых кислот, и способов их детектирования. Трансгенный объект кукурузы DBN9936 обладает хорошей устойчивостью к насекомым, а также хорошей толерантностью к гербициду глифосат, при этом с помощью способов детектирования можно точно и быстро выявить, содержит ли биологический образец молекулу ДНК объекта кукурузы DBN9936.

Для достижения вышеуказанной цели настоящим изобретением предложена последовательность нуклеиновой кислоты, которая содержит по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 3 или комплементарной ей последовательности и/или которая содержит по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 4 или комплементарной ей последовательности.

Предпочтительно, последовательность нуклеиновой кислоты содержит SEQ ID NO: 1 или комплементарную ей последовательность и/или SEQ ID NO: 2 или комплементарную ей последовательность.

Кроме того, последовательность нуклеиновой кислоты содержит SEQ ID NO: 3 или комплементарную ей последовательность и/или SEQ ID NO: 4 или комплементарную ей последовательность.

Более того, последовательность нуклеиновой кислоты содержит SEQ ID NO: 5 или комплементарную ей последовательность.

SEQ ID NO: 1 или комплементарная ей последовательность представляет собой последовательность из 22 нуклеотидов, которая локализована вокруг участка присоединения вставки на 5'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936. SEQ ID NO: 1 или комплементарная ей последовательность охватывает геномную последовательность ДНК, фланкирующую сайт вставки кукурузы, и последовательность ДНК на 5'-конце вставленной последовательности. Таким образом, включение SEQ ID NO: 1 или комплементарной ей последовательности может свидетельствовать о наличии трансгенного объекта кукурузы DBN9936. SEQ ID NO: 2 или комплементарная ей последовательность представляет собой последовательность из 22 нуклеотидов, которая локализована вокруг участка присоединения вставки на 3'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936. SEQ ID NO: 2 или комплементарная ей последовательность охватывает последовательность ДНК на 3'-конце вставленной последовательности и геномную последовательность ДНК, фланкирующую сайт вставки кукурузы. Таким образом, включение SEQ ID NO: 2 или комплементарной ей последовательности может свидетельствовать о наличии трансгенного объекта кукурузы DBN9936.

Последовательность нуклеиновой кислоты по настоящему изобретению может представлять собой последовательность, которая содержит по меньшей мере 11 или более последовательных нуклеотидов в любой части трансгенной вставленной последовательности в SEQ ID NO: 3, или комплементарную ей последовательность (первую последовательность нуклеиновой кислоты), или которая содержит по меньшей мере 11 или более последовательных нуклеотидов в любой части 5'-фланкирующего участка геномной ДНК кукурузы в SEQ ID NO: 3, или комплементарную ей последовательность (вторую последовательность нуклеиновой кислоты). Кроме того, последовательность нуклеиновой кислоты может представлять собой последовательность, которая гомологична или комплементарна части из SEQ ID NO: 3, которая содержит SEQ ID NO: 1. При совместном применении первая последовательность нуклеиновой кислоты и вторая последовательность нуклеиновой кислоты могут действовать как пара ДНК-праймеров в способе амплификации ДНК, в результате осуществления которого получают продукт амплификации. Если продукт амплификации, полученный с применением указанной пары ДНК-праймеров в способе амплификации ДНК, содержит SEQ ID NO: 1, можно говорить об идентификации наличия трансгенного объекта кукурузы DBN9936 или его потомства. Как хорошо известно специалистам в настоящей области, первая и вторая последовательности нуклеиновой кислоты могут состоять не только из ДНК, но могут также представлять собой РНК, смесь ДНК и РНК или комбинацию из ДНК, РНК и других нуклеотидов или их аналогов, которые не служат в качестве матрицы для одной или нескольких полимераз. Кроме того, зонды или праймеры по настоящему изобретению должны составлять в длину по меньшей мере приблизительно 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 последовательных нуклеотидов и могут быть выбраны из нуклеотидов из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 и SEQ ID NO: 5. Если они выбраны из нуклеотидов из SEQ ID NO: 3, SEQ ID NO: 4 и SEQ ID NO: 5, зонды и праймеры могут составлять в длину по меньшей мере от приблизительно 21 до приблизительно 50 или более последовательных нуклеотидов. SEQ ID NO: 3 или комплементарная ей последовательность представляет собой последовательность из 1001 нуклеотидов, которая локализована вокруг участка присоединения вставки на 5'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936. SEQ ID NO: 3 или комплементарная ей последовательность состоит из 832 нуклеотидов из фланкирующей геномной последовательности ДНК кукурузы (нуклеотиды 1-832 из SEQ ID NO: 3), 77 нуклеотидов из последовательности ДНК конструкции DBN10124 (нуклеотиды 833-909 из SEQ ID NO: 3) и 92 нуклеотидов из 3'-конца последовательности ДНК (нопалин-синтазного) терминатора транскрипции tNos (нуклеотиды 910-1001 из SEQ ID NO: 3). Таким образом, включение SEQ ID NO: 3 или комплементарной ей последовательности может свидетельствовать о наличии трансгенного объекта кукурузы DBN9936.

Последовательность нуклеиновой кислоты может представлять собой последовательность, которая содержит по меньшей мере 11 или более последовательных нуклеотидов в любой части трансгенной вставленной последовательности в SEQ ID NO: 4, или комплементарную ей последовательность (третью последовательность нуклеиновой кислоты), или которая содержит по меньшей мере 11 или более последовательных нуклеотидов в любой части 3'-фланкирующего участка геномной ДНК кукурузы в SEQ ID NO: 4, или комплементарную ей последовательность (четвертую последовательность нуклеиновой кислоты). Кроме того, последовательность нуклеиновой кислоты может представлять собой последовательность, которая гомологична или комплементарна части из SEQ ID NO: 4, которая содержит SEQ ID NO: 2. При совместном применении третья последовательность нуклеиновой кислоты и четвертая последовательность нуклеиновой кислоты могут действовать как пара ДНК-праймеров в способе амплификации ДНК, в результате осуществления которого получают продукт амплификации. Если продукт амплификации, полученный с применением указанной пары ДНК-праймеров в способе амплификации ДНК, содержит SEQ ID NO: 2, можно говорить об идентификации наличия трансгенного объекта кукурузы DBN9936 или его потомства. SEQ ID NO: 4 или комплементарная ей последовательность представляет собой последовательность из 1204 нуклеотидов, которая локализована вокруг участка присоединения вставки на 3'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936. SEQ ID NO: 4 или комплементарная ей последовательность состоит из 38 нуклеотидов из последовательности терминатора транскрипции t35S (нуклеотиды 1-38 из SEQ ID NO: 4), 152 нуклеотидов из последовательности ДНК конструкции DBN10124 (нуклеотиды 39-190 из SEQ ID NO: 4) и 1014 нуклеотидов из геномной последовательности ДНК кукурузы, фланкирующей сайт встраивания (нуклеотиды 191-1204 из SEQ ID NO: 4). Таким образом, включение SEQ ID NO: 4 или комплементарной ей последовательности может свидетельствовать о наличии трансгенного объекта кукурузы DBN9936.

SEQ ID NO: 5 или комплементарная ей последовательность является последовательностью из 9215 нуклеотидов, которая характеризует трансгенный объект кукурузы DBN9936. Конкретные геномы и генетические элементы, содержащиеся в SEQ ID NO: 5, показаны в таблице 1. Включение SEQ ID NO: 5 или комплементарной ей последовательности может свидетельствовать о наличии трансгенного объекта кукурузы DBN9936.

Последовательности нуклеиновой кислоты или комплементарные им последовательности можно применять в способах амплификации ДНК для получения ампликонов, детектирование которых можно применять для идентификации наличия трансгенного объекта кукурузы DBN9936 или его потомства в биологическом образце. Последовательности нуклеиновой кислоты или комплементарные им последовательности можно применять в способах детектирования нуклеотидов для детектирования наличия трансгенного объекта кукурузы DBN9936 или его потомства в биологическом образце.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ детектирования наличия ДНК трансгенного объекта кукурузы DBN9936 в образце, включающий:

- приведение в контакт образца по меньшей мере с двумя праймерами в реакции амплификации нуклеиновой кислоты;

- осуществление реакции амплификации нуклеиновой кислоты; и

- детектирование наличия ампликона, причем наличие ампликона свидетельствует о наличии ДНК трансгенного объекта кукурузы DBN9936 в образце;

причем ампликон содержит по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 3 или комплементарной ей последовательности или по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 4 или комплементарной ей последовательности; и

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, ампликон содержит последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 1 или комплементарной ей последовательности или последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 2 или комплементарной ей последовательности.

Предпочтительно, ампликон содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарной ей последовательности.

В соответствии с вышеуказанным способом, праймер содержит по меньшей мере одну последовательность нуклеиновой кислоты по меньшей мере из 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 последовательных нуклеотидов, выбранных из нуклеотидов, происходящих от последовательностей нуклеиновых кислот, которые изложены в настоящем документе.

В качестве альтернативы, праймер включает первый праймер и второй праймер, причем первый праймер выбран из SEQ ID NO: 8 и SEQ ID NO: 10, а второй праймер выбран из SEQ ID NO: 9 и SEQ ID NO: 11.

Для достижения вышеуказанной цели настоящим изобретением также предложен другой способ детектирования наличия ДНК трансгенного объекта кукурузы DBN9936 в образце, включающий:

- приведение в контакт образца с зондом, причем зонд содержит по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 3 или комплементарной ей последовательности или по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 4 или комплементарной ей последовательности;

- гибридизацию образца с зондом в жестких условиях гибридизации; и

- детектирование гибридизации зонда с образцом, причем гибридизация зонда с образцом свидетельствует о наличии ДНК трансгенного объекта кукурузы DBN9936 в образце;

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Жесткие условия могут представлять собой гибридизацию при 65°С в растворе 6×SSC (цитрата натрия) и 0,5% SDS (додецилсульфата натрия) с последующей промывкой мембран в растворе 2×SSC и 0,1% SDS и в растворе 1×SSC и 0,1% SDS (однократно каждым).

Предпочтительно, зонд содержит последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 1 или комплементарной ей последовательности или последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 2 или комплементарной ей последовательности.

Предпочтительно, зонд содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарной ей последовательности. Необязательно, по меньшей мере один зонд помечен по меньшей мере одним флуорофором.

Для достижения вышеуказанной цели настоящим изобретением также предложен другой способ детектирования наличия ДНК трансгенного объекта кукурузы DBN9936 в указанном образце, включающий:

- приведение в контакт образца с маркерной молекулой нуклеиновой кислоты, причем маркерная молекула нуклеиновой кислоты содержит по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 3 или комплементарной ей последовательности или по меньшей мере 11 последовательных нуклеотидов из SEQ ID NO: 4 или комплементарной ей последовательности;

- гибридизацию образца с маркерной молекулой нуклеиновой кислоты в жестких условиях гибридизации;

- детектирование гибридизации образца с маркерной молекулой нуклеиновой кислоты, причем гибридизация образца с маркерной молекулой нуклеиновой кислоты свидетельствует о наличии ДНК трансгенного объекта кукурузы DBN9936 в образце;

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, маркерная молекула нуклеиновой кислоты содержит последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 1 или комплементарной ей последовательности или последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 2 или комплементарной ей последовательности.

Предпочтительно, маркерная молекула нуклеиновой кислоты содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарной ей последовательности.

Предпочтительно, способ дополнительно включает осуществление аналитического скрещивания с использованием маркера для детектирования, имеет ли устойчивость к насекомым и/или толерантность к гербициду генетическую связь с маркерной молекулой нуклеиновой кислоты.

Для достижения вышеуказанной цели настоящим изобретением также предложен набор для детекции ДНК, содержащий по меньшей мере одну молекулу ДНК, причем молекула ДНК содержит по меньшей мере 11 последовательных нуклеотидов из последовательности, которая гомологична или комплементарна SEQ ID NO: 3, или по меньшей мере 11 последовательных нуклеотидов из последовательности, которая гомологична или комплементарна SEQ ID NO: 4, и молекула ДНК может выполнять роль ДНК-праймера или зонда, специфичного для трансгенного объекта кукурузы DBN9936 или его потомства, и причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, молекула ДНК содержит последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 1 или комплементарной ей последовательности или последовательные нуклеотиды 1-11 или 12-22 из SEQ ID NO: 2 или комплементарной ей последовательности.

Предпочтительно, молекула ДНК содержит последовательности, которые гомологичны или комплементарны SEQ ID NO: 1, последовательности, которые гомологичны или комплементарны SEQ ID NO: 2, последовательности, которые гомологичны или комплементарны SEQ ID NO: 6, или последовательности, которые гомологичны или комплементарны SEQ ID NO: 7.

Для достижения вышеуказанной цели настоящим изобретением также предложена клетка или часть растения, содержащая последовательность нуклеиновой кислоты, кодирующую белок Cry1Ab устойчивости к насекомым, последовательность нуклеиновой кислоты, кодирующую белок EPSPS, обеспечивающий толерантность к гербициду глифосат, и последовательность нуклеиновой кислоты конкретного участка, причем последовательность нуклеиновой кислоты конкретного участка включает SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 или SEQ ID NO: 7, и часть растения не может регенерировать в целое растение.

Предпочтительно, клетка или часть растения кукурузы содержит последовательность нуклеиновой кислоты, кодирующую белок Cry1Ab устойчивости к насекомым, последовательность нуклеиновой кислоты, кодирующую белок EPSPS, обеспечивающий толерантность к гербициду глифосат, и последовательность нуклеиновой кислоты конкретного участка, причем последовательность нуклеиновой кислоты конкретного участка включает SEQ ID NO: 3 или SEQ ID NO: 4.

Предпочтительно, клетка или часть растения кукурузы содержит последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ защиты растения кукурузы от поражения насекомыми, включающий внесение по меньшей мере одной клетки или части трансгенного растения кукурузы в рацион целевого насекомого, причем клетка или часть трансгенного растения кукурузы содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7; потребление в пищу клетки или части трансгенного растения кукурузы подавляет дальнейшее кормление целевого насекомого на указанном растении кукурузы.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ защиты растения кукурузы от повреждения, вызываемого гербицидом, включающий внесение эффективного количества гербицида глифосат в поле по меньшей мере с одним трансгенным растением кукурузы, причем трансгенное растение кукурузы содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, и трансгенное растение кукурузы обладает толерантностью к гербициду глифосат.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ борьбы с сорняками в поле с растением кукурузы, включающий внесение эффективного количества гербицида глифосат в поле по меньшей мере с одним трансгенным растением кукурузы, причем трансгенное растение кукурузы содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, и трансгенное растение кукурузы обладает толерантностью к гербициду глифосат.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ селекции устойчивого к насекомым растения кукурузы, включающий:

- высевание по меньшей мере одного семени кукурузы, причем семя кукурузы содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок Cry1Ab устойчивости к насекомым, и последовательность нуклеиновой кислоты конкретного участка;

- выращивание семени кукурузы в растение кукурузы; и

- поражение растения кукурузы целевым насекомым, а затем сбор урожая от растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат последовательность нуклеиновой кислоты конкретного участка;

причем последовательность нуклеиновой кислоты конкретного участка содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, способ включает:

- высевание по меньшей мере одного семени кукурузы, причем семя кукурузы содержит в своем геноме последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5;

- выращивание семени кукурузы в растение кукурузы; и

- поражение растения кукурузы целевым насекомым, а затем сбор урожая от растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат SEQ ID NO: 5.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ селекции толерантного к гербициду глифосат растения кукурузы, включающий:

- высевание по меньшей мере одного семени кукурузы, причем семя кукурузы содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок EPSPS, обеспечивающий толерантность к гербициду глифосат, и последовательность нуклеиновой кислоты конкретного участка;

- выращивание семени кукурузы в растение кукурузы; и

- опрыскивание растения кукурузы эффективным количеством гербицида глифосат, а затем сбор урожая от растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат последовательность нуклеиновой кислоты конкретного участка;

причем последовательность нуклеиновой кислоты конкретного участка содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, способ включает:

- высевание по меньшей мере одного семени кукурузы, причем семя кукурузы содержит в своем геноме последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5;

- выращивание семени кукурузы в растение кукурузы; и

- опрыскивание растения кукурузы эффективным количеством гербицида глифосат, а затем сбор урожая растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат SEQ ID NO: 5.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ селекции устойчивого к насекомым и толерантного к гербициду глифосат растения кукурузы, включающий:

- высевание по меньшей мере одного семени кукурузы, причем семя кукурузы содержит в своем геноме последовательность нуклеиновой кислоты, кодирующую белок Cry1Ab устойчивости к насекомым, последовательность нуклеиновой кислоты, кодирующую белок EPSPS, обеспечивающий толерантность к гербициду глифосат, и последовательность нуклеиновой кислоты конкретного участка;

- выращивание семени кукурузы в растение кукурузы; и

- опрыскивание растения кукурузы эффективным количеством гербицида глифосат, а затем сбор урожая от растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат последовательность нуклеиновой кислоты конкретного участка, и такое растение с уменьшенным повреждением растения также является устойчивым к повреждению от поедания насекомым;

причем последовательность нуклеиновой кислоты конкретного участка содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, способ включает:

- высевание по меньшей мере одного семени кукурузы, причем семя кукурузы содержит в своем геноме последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5;

- выращивание семени кукурузы в растение кукурузы; и

- опрыскивание растения кукурузы эффективным количеством гербицида глифосат, а затем сбор урожая растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат SEQ ID NO: 5, и такое растение с уменьшенным повреждением растения также является устойчивым к повреждению от поедания насекомым.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ получения устойчивого к насекомым растения кукурузы, включающий введение последовательности нуклеиновой кислоты, кодирующей белок Cry1Ab устойчивости к насекомым, и последовательности нуклеиновой кислоты конкретного участка в геном растения кукурузы, причем последовательность нуклеиновой кислоты конкретного участка содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, способ включает введение последовательности нуклеиновой кислоты, которая изложена в SEQ ID NO: 5, в геном растения кукурузы.

В частности, способ получения устойчивого к насекомым растения кукурузы включает:

- половое скрещивание первого родительского устойчивого к насекомым растения кукурузы, представляющего собой трансгенный объект кукурузы DBN9936, со вторым родительским растением кукурузы, у которого отсутствует признак устойчивости к насекомым, тем самым получая множество растений-потомков;

- поражение растений-потомков целевым насекомым; и

- отбор растений-потомков с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат последовательность нуклеиновой кислоты конкретного участка или последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5;

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ получения толерантного к гербициду глифосат растения кукурузы, включающий введение последовательности нуклеиновой кислоты, кодирующей белок EPSPS, обеспечивающий толерантность к гербициду глифосат, и последовательности нуклеиновой кислоты конкретного участка в геном растения кукурузы, причем последовательность нуклеиновой кислоты конкретного участка содержит по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6 и SEQ ID NO: 7.

Предпочтительно, способ включает введение последовательности нуклеиновой кислоты, которая изложена в SEQ ID NO: 5, в геном растения кукурузы.

В частности, способ получения толерантного к гербициду глифосат растения кукурузы включает:

- половое скрещивание первого родительского толерантного к гербициду глифосат растения кукурузы, представляющего собой трансгенный объект кукурузы DBN9936, со вторым родительским растением кукурузы, у которого отсутствует признак толерантности к гербициду глифосат, тем самым получая множество растений-потомков;

- обработку растений-потомков гербицидом глифосат; и

- отбор толерантных к глифосату растений-потомков;

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели настоящим изобретением также предложен способ получения устойчивого к насекомым и толерантного к гербициду глифосат растения кукурузы, включающий:

- половое скрещивание первого родительского толерантного к гербициду глифосат и устойчивого к насекомым растения кукурузы, представляющего собой трансгенный объект кукурузы DBN9936, со вторым родительским растением кукурузы, у которого отсутствует признак толерантности к гербициду глифосат и/или устойчивости к насекомым, и тем самым получая множество растений-потомков;

- обработку растений-потомков гербицидом глифосат; и

- отбор толерантных к глифосату растений-потомков, причем толерантные к глифосату растения-потомки также устойчивы к повреждению от поедания насекомым;

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме по меньшей мере одну последовательность нуклеиновой кислоты, выбранную из группы, состоящей из SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7.

Для достижения вышеуказанной цели настоящим изобретением также предложена композиция, содержащая полинуклеотиды, которые изложены в SEQ ID NO: 1 или SEQ ID NO: 2, причем композиция представляет собой кукурузную муку грубого помола, кукурузную муку, кукурузное масло, кукурузные рыльца или кукурузный крахмал.

Для достижения вышеуказанной цели настоящим изобретением также предложен сельскохозяйственный продукт или товар, содержащий полинуклеотиды, которые изложены в SEQ ID NO: 1 или SEQ ID NO: 2, причем сельскохозяйственный продукт или товар представляет собой кукурузную муку грубого помола, кукурузную муку, кукурузное масло, кукурузный крахмал, кукурузный глютен, кукурузную лепешку, косметическое средство или наполнитель.

В последовательностях нуклеиновой кислоты и способах настоящей заявки для детектирования растений кукурузы, для лучшего определения настоящего изобретения и для руководства для специалистов в настоящей области техники при осуществлении на практике настоящего изобретения предложены приведенные далее определения и способы. Если не указано иное, термины следует понимать в соответствии с обычным применением специалистами в настоящей области техники.

Термин «кукуруза» относится к Zea mays и включает в себя все сорта растения, которые можно скрещивать с кукурузой, в том числе виды дикой кукурузы.

Термин «включающий» или «содержащий» означает «в том числе без ограничения».

Термин «растение» включает растения целиком, растительные клетки, органы растения, протопласты растения, культуры клеток ткани растения, из которых можно регенерировать растения, каллусы растения, растительные агрегаты и растительные клетки, которые являются интактными в растениях или частях растений, причем части растений могут представлять собой, например, зародыши, пыльцу, семязачатки, семена, листья, цветки, ветви, плоды, цветоножки, корни, корневые кончики или пыльники. Следует понимать, что в объеме настоящего изобретения части трансгенных растений включают без ограничения растительные клетки, протопласты, ткани, каллусы, зародыши, цветки, стебли, плоды, листья и корни. Вышеупомянутые части растений происходят от трансгенных растений или их потомства, которые ранее были трансформированы молекулой ДНК по настоящему изобретению и, следовательно, по меньшей мере частично состоят из трансгенных клеток.

Термин «ген» относится к фрагменту нуклеиновой кислоты, который экспрессирует конкретный белок, в том числе к регуляторным последовательностям, расположенным перед кодирующей последовательностью (5'-некодирующие последовательности) и после кодирующей последовательности (3'-некодирующие последовательности). «Нативный ген» относится к гену, который встречается в природе, с его собственными регуляторными последовательностями. «Химерный ген» относится к любому гену, который не является нативным геном и содержит регуляторные и кодирующие последовательности, которые не встречаются в природе. «Эндогенный ген» относится к нативному гену в его естественной локализации в геноме организма. «Экзогенный ген» представляет собой чужеродный ген, который в настоящее время присутствует в геноме организма, который в норме его не содержит, а также относится к гену, введенному в рецепторную клетку с помощью трансгенного процесса. Экзогенные гены могут представлять собой нативные гены или химерные гены, включенные в ненативный организм. «Трансген» представляет собой ген, который был внесен в геном посредством процедуры трансформации. «Сайт вставки» или «целевой сайт» относится к сайту в геноме растения, в который была вставлена рекомбинантная ДНК.

«Фланкирующая ДНК» может включать либо геномную, присутствующую в природе в организме, таком как растение, либо экзогенную (гетерологичную) ДНК, включенную посредством процесса трансформации, например, фрагмент, связанный с событием трансформации. Таким образом, фланкирующая ДНК может включать комбинацию нативной ДНК и экзогенной ДНК. Применяемые в контексте настоящего описания термины «фланкирующая последовательность», «фланкирующая геномная последовательность», «фланкирующая геномная ДНК», «геномная фланкирующая последовательность» или «ДНК-последовательность фланкирующего генома» относятся к последовательности по меньшей мере из 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500 или 5000 пар оснований или более, которая локализована непосредственно либо выше, либо ниже исходной вставленной экзогенной молекулы ДНК и примыкает к ней. Если этот фланкирующий участок локализован ниже, его также можно назвать «левой граничной фланкирующей последовательностью», «3'-фланкирующей последовательностью», «3'-геномным граничным участком» или «геномной 3'-граничной последовательностью» и т.п. Если этот фланкирующий участок локализован выше, его также можно назвать «правой граничной фланкирующей последовательностью», «5'-фланкирующей последовательностью», «5'-геномным граничным участком» или «геномной 5'-граничной последовательностью» и т.п.

Процедуры трансформации, приводящие к случайному встраиванию экзогенной ДНК, дадут в результате трансформанты, содержащие различные фланкирующие участки, которые характерны и уникальны для каждого трансформанта. Если рекомбинантную ДНК вводят в растение путем традиционного скрещивания, ее фланкирующие участки обычно не будут изменяться. Трансформанты также будут содержать уникальные участки присоединения между ДНК гетерологичной вставки и фрагментами геномной ДНК, или между двумя фрагментами геномной ДНК, или между двумя фрагментами гетерологичной ДНК. «Участок присоединения» представляет собой точку, в которой соединяются два конкретных фрагмента ДНК. Например, участок присоединения присутствует в положении, в котором ДНК-вставка соединяется с фланкирующей ДНК. Точка присоединения также присутствует у трансформированного организма, в котором два фрагмента ДНК соединены друг с другом таким способом, который является модифицированным относительно способа соединения, который встречается у нативного организма. «ДНК участка присоединения» или «участок присоединения» относится к ДНК, которая содержит точку присоединения.

Настоящее изобретение относится к трансгенному объекту кукурузы под названием DBN9936 и его потомству. Трансгенный объект кукурузы DBN9936 строго представляет собой растение кукурузы DBN9936, в том числе растения и семена трансгенного объекта кукурузы DBN9936, вместе с их растительными клетками или возобновляемыми частями растений, причем части растений трансгенного объекта кукурузы DBN9936 включают без ограничения клетки, пыльцу, семязачатки, цветки, почки, корни, стебли, рыльца, соцветие, початки, листья и продукты, полученные из растений кукурузы DBN9936, такие как кукурузная мука, кукурузная мука грубого помола, кукурузное масло, кукурузная патока, кукурузные рыльца, кукурузный крахмал и биомасса, оставшаяся на поле после выращивания кукурузных сельскохозяйственных культур.

Трансгенный объект кукурузы DBN9936 по настоящему изобретению содержит ДНК-конструкцию DBN10124, которая при экспрессии в растительных клетках придает трансгенному объекту кукурузы DBN9936 устойчивость к насекомым и толерантность к гербициду глифосат. ДНК-конструкция содержит две расположенные в тандеме кассеты экспрессии. Первая кассета экспрессии содержит промотор, подходящий для экспрессии в растении, и подходящую сигнальную последовательность полиаденилирования, причем промотор функционально связан с последовательностью нуклеиновой кислоты белка Cry1Ab, который в целом устойчив к насекомым отряда Lepidoptera. Вторая кассета экспрессии содержит промотор, подходящий для экспрессии в растении, и подходящую сигнальную последовательность полиаденилирования, причем промотор функционально связан с геном, кодирующим 5-енолпируват-шикимат-3-фосфатсинтазу (EPSPS), которая толерантна к гербициду глифосат. Кроме того, промотор может представлять собой подходящий промотор, выделенный из растений, в том числе конститутивный, индуцируемый и/или тканеспецифический промоторы. Подходящий промотор включает без ограничения промотор 35S вируса мозаики цветной капусты (CaMV), промотор 35S вируса мозаики норичника (FMV), убиквитиновый промотор, актиновый промотор, нопалин-синтазный промотор (NOS) Agrobacterium tumefaciens, октопин-синтазный промотор (OCS), промотор вируса желтой курчавости листьев Cestrum, пататиновый промотор, промотор гена рибулозо-1,5-бисфосфат-карбоксилазы/оксигеназы (RuBisCO), глутатион-S-трансферазный промотор (GST), промотор Е9, промотор GOS, промотор alcA/alcR, промотор RolD Agrobacterium rhizogenes и промотор Suc2 Arabidopsis thaliana. Сигнальной последовательностью полиаденилирования может быть подходящая сигнальная последовательность полиаденилирования, которая функционирует в растениях. Подходящая сигнальная последовательность полиаденилирования включает без ограничения сигнальную последовательность полиаденилирования, полученную от гена нопалин-синтазы (NOS) Agrobacterium tumefaciens, сигнальную последовательность полиаденилирования, полученную от терминатора 35S вируса цветной мозаики капусты (CaMV), сигнальную последовательность полиаденилирования, полученную от гена ингибитора протеаз II (PIN II), и сигнальную последовательность полиаденилирования, полученную от гена α-тубулина.

Кроме того, кассета экспрессии может дополнительно содержать другие генетические элементы, в том числе без ограничения энхансер и сигнальный пептид/транзитный пептид. К энхансеру, усиливающему уровень экспрессии гена, относятся без ограничения активатор трансляции вируса гравировки табака (TEV), энхансер CaMV35S и энхансер FMV35S. Сигнальный пептид/транзитный пептид может направлять белок Cry1Ab и/или белок EPSPS для его транспортировки во внеклеточное пространство, или в конкретную внутриклеточную органеллу, или в конкретный внутриклеточный компартмент, например, для целенаправленной доставки в хлоропласт с помощью последовательности, кодирующей транзитный пептид хлоропласта, или для целенаправленной доставки в эндоплазматический ретикулум с помощью удерживающей последовательности «KDEL».

Ген Cry1Ab может быть выделен из Bacillus thuringiensis (сокращенно Bt), и нуклеотидная последовательность гена Cry1Ab может быть изменена путем оптимизации ко дона или другими способами для повышения стабильности и доступности транскрипта в трансформированных клетках.

Термин «Lepidoptera», включая как мотыльков, так и бабочек, охватывает наибольший отряд насекомых-вредителей в сельском хозяйстве и лесной промышленности. Он включает, например, Ostrinia nubilalis, Helicoverpa armigera, Pseudaletia separata, Athetis lepigone и Conogethes punctiferalis.

Ген 5-енолпируват-шикимат-3-фосфатсинтазы (EPSPS) можно выделить из штамма СР4 Agrobacterium tumefaciens. Полинуклеотиды, кодирующие ген EPSPS, можно изменить путем оптимизации кодона или другими способами для повышения стабильности и доступности транскрипта в трансформированных клетках. Ген 5-енолпируват-шикимат-3-фосфатсинтазы (EPSPS) можно применять в качестве селектируемого маркерного гена.

«Глифосат» относится к N-фосфонометил-глицину и его солям. Обработки «гербицидом глифосат» относятся к обработкам при помощи любого гербицидного состава, содержащего глифосат. Рядовой специалист в области сельского хозяйства вполне сможет подобрать нормы внесения для глифосатного состава для получения биологически эффективного количества. Обработка поля, содержащего растительные материалы от трансгенного объекта кукурузы DBN9936, с помощью любого гербицидного состава, содержащего глифосат, будет обеспечивать борьбу с ростом сорняков в поле, не влияя на рост или урожай растительных материалов, полученных от трансгенного объекта кукурузы DBN9936.

ДНК-конструкцию вводят в растение посредством способов трансформации, включая без ограничения Agrobacterium-опосредованную трансформацию, баллистическую трансформацию и трансформацию с использованием прорастающих пыльцевых трубок.

Agrobacterium-опосредованная трансформация является широко применяемым способом трансформации растений. Экзогенную ДНК, подлежащую включению в растение, клонируют в вектор между левой и правой граничными консенсусными последовательностями, затем получают последовательность Т-ДНК. Вектор трансформируют в клетки Agrobacterium, которые впоследствии используют для заражения растительной ткани. Последовательность Т-ДНК в векторе, содержащем экзогенную ДНК, встраивается в виде вставки геном растения.

Баллистическая трансформация представляет собой бомбардировку растительных клеток вектором, содержащим экзогенную ДНК (опосредуемая частицами биолистическая трансформация).

Трансформация с использованием прорастающих пыльцевых трубок является способом переноса экзогенной ДНК через нуцеллярный канал в зародышевый мешок с помощью естественной пыльцевой трубки (также известной как передающая ткань пыльцевой трубки), формирующейся после опыления растений.

После трансформации необходимо регенерировать трансгенное растение из трансформированной растительной ткани и произвести отбор потомства с экзогенной ДНК с помощью подходящего маркера.

ДНК-конструкция представляет собой сборку из молекул ДНК, соединенных друг с другом, что дает одну или несколько кассет экспрессии. ДНК-конструкция предпочтительно представляет собой плазмиду, которая может самореплицироваться в бактериальной клетке и содержит сайты рестрикции различных эндонуклеазных ферментов, которые полезны для введения молекул ДНК, которые несут функциональные генетические элементы, т.е. промоторы, интроны, лидерные последовательности, кодирующие последовательности, 3'-терминаторные участки и другие последовательности. Кассеты экспрессии, содержащиеся в ДНК-конструкции, содержат генетические элементы, необходимые для транскрипции информационной РНК, и могут быть сконструированы для экспрессии в прокариотических клетках или эукариотических клетках. Наиболее предпочтительно, чтобы кассеты экспрессии по настоящему изобретению были сконструированы для экспрессии в растительных клетках.

Трансгенный «объект» получают путем трансформации растительных клеток гетерологичной ДНК-конструкцией, что включает стадии вставки кассеты экспрессии нуклеиновой кислоты, содержащей по меньшей мере один целевой ген, в геном растения посредством трансгенного способа для создания популяции растения, регенерации популяции растений и отбора конкретного растения, имеющего характеристики вставки в конкретной локализации генома. Термин «объект» относится к исходному трансформанту и его потомству, которые включают гетерологичную ДНК. Термин «объект» также относится к потомству, полученному в результате полового скрещивания трансформанта и индивидуума других сортов, которые включают гетерологичную ДНК. Даже после многократного возвратного скрещивания с родителем от обратного скрещивания вставленная ДНК и фланкирующая геномная ДНК от родителя-трансформанта все еще присутствуют в той же хромосомной локализации у полученного в результате скрещивания потомства. Термин «объект» также относится к последовательности ДНК от исходного трансформанта, содержащего вставленную ДНК и фланкирующую геномную последовательность, непосредственно примыкающую к вставленной ДНК, причем ожидается, что последовательность ДНК будет передаваться потомству, которое получает вставленную ДНК, включающую целевой ген, и которое получено в результате полового скрещивания родительской линии, которая включает вставленную ДНК (например, исходного трансформанта и его потомства, полученного в результате самоопыления), и родительской линии, которая не содержит вставленную ДНК.

Применяемый в контексте настоящего документа термин «рекомбинация» относится к форме ДНК, и/или белка, и/или организма, которая в норме не встречается в природе и по сути создана путем человеческого вмешательства. Такое человеческое вмешательство может в результате давать рекомбинантную молекулу ДНК и/или рекомбинантное растение. «Рекомбинантную молекулу ДНК» получают путем искусственного объединения в комбинацию двух в ином случае раздельных сегментов последовательности, например, с помощью химического синтеза или с помощью манипуляции с выделенными сегментами нуклеиновой кислоты с помощью технологии генетической инженерии. Технология работы с нуклеиновыми кислотами хорошо известна в настоящей области техники.

Термин «трансген» включает в себя любую клетку, клеточную линию, каллус, ткань, часть растения или растение, генотип которых был изменен в связи с наличием гетерологичной нуклеиновой кислоты. «Трансген» включает такие трансгенные организмы, которые первоначально были изменены таким образом, а также потомство, полученное от первоначального трансгенного организма в результате полового скрещивания или бесполого размножения. Применяемый в контексте настоящего описания термин «трансген» не охватывает изменение генома традиционными способами селекции растений или естественными событиями (внутрихромосомными или внехромосомными), такими как случайное перекрестное оплодотворение, инфицирование нерекомбинантными вирусами, трансформация нерекомбинантными бактериями, нерекомбинантная транспозиция или спонтанная мутация.

«Гетерологичный» относится к первой молекуле, которая обычно не встречается в комбинации со второй молекулой в природе. Например, молекула может быть получена от первого вида и вставлена в геном второго вида. Таким образом, молекула будет гетерологична по отношению к хозяину и искусственно введена в геном клетки-хозяина.

Трансгенный объект кукурузы DBN9936, имеющий устойчивость к насекомым Lepidoptera и толерантность к гербициду глифосат, можно селекционировать согласно следующим стадиям: во-первых, половое скрещивание первого родительского растения кукурузы, состоящего из растения кукурузы, культивированного из трансгенного объекта кукурузы DBN9936, и его потомства, со вторым родительским растением кукурузы, у которого отсутствует устойчивость к насекомым Lepidoptera и толерантность к гербициду глифосат, тем самым получая множество первых растений-потомков, причем трансгенный объект кукурузы DBN9936 и его потомство получены в результате трансформации с помощью кассеты экспрессии по настоящему изобретению, которая обеспечивает устойчивость к насекомому Lepidoptera и толерантность к гербициду глифосат; а затем отбор растения-потомка, которое является устойчивым к поражению насекомым Lepidoptera и/или толерантным к гербициду глифосат, тем самым селекционируя растение кукурузы, которое является устойчивым к поражению насекомым Lepidoptera и толерантным к гербициду глифосат. Эти стадии дополнительно могут включать возвратное скрещивание устойчивого к насекомым отряда Lepidoptera и/или толерантного к глифосату растения-потомка со вторым родительским растением кукурузы или третьим родительским растением кукурузы, затем скрининг потомства путем поражения насекомыми отряда Lepidoptera, внесения гербицида глифосат или путем выявления молекулярных маркеров (например, молекулы ДНК, содержащей участки присоединения, выявленные на 5'- и 3'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936), ассоциированных с признаком, таким образом получая устойчивое к насекомым отряда Lepidoptera и толерантное к гербициду глифосат растение кукурузы.

Также следует понимать, что два различных трансгенных растения также можно скрещивать для получения потомства, которое содержит два независимых и раздельно внесенных экзогенных гена. Самоопыление соответствующего потомства может давать растения-потомки, гомозиготные по обоим внесенным экзогенным генам. Также предусмотрено возвратное скрещивание с родительским растением и межлинейное скрещивание с нетрансгенным растением, как описано выше, а также вегетативное размножение.

Термин «зонд» означает выделенную молекулу нуклеиновой кислоты, которая присоединена к обычной детектируемой метке или репортерной молекуле, например, радиоактивному изотопу, лиганду, хемилюминесцентному средству или ферменту. Такой зонд комплементарен цепи целевой нуклеиновой кислоты, в соответствии с настоящим изобретением, цепи ДНК из генома трансгенного объекта кукурузы DBN9936, независимо от того, получена ли геномная ДНК от трансгенного объекта кукурузы DBN9936 либо семени или от растения, либо семени, либо их экстракта, происходящих от трансгенного объекта кукурузы DBN9936. Зонды по настоящему изобретению включают не только дезоксирибонуклеиновые или рибонуклеиновые кислоты, но также полиамиды и другие выполняющие роль зонда материалы, которые специфически связываются с целевой последовательностью ДНК и могут быть использованы для детектирования наличия этой целевой последовательности ДНК.

Термин «праймер» обозначает выделенную молекулу нуклеиновой кислоты, которая соединяется с комплементарной целевой цепью ДНК путем гибридизации нуклеиновой кислоты с образованием гибрида между праймером и целевой цепью ДНК, а затем достраивается вдоль целевой цепи ДНК под действием полимеразы (например, ДНК-полимеразы). Праймерные пары по настоящему изобретению относятся к их применению при амплификации целевой последовательности нуклеиновой кислоты, например, с помощью полимеразной цепной реакции (ПЦР) или других традиционных способов амплификации нуклеиновой кислоты.

Зонды и праймеры обычно составляют в длину 11 нуклеотидов или более, предпочтительно 18 нуклеотидов или более, более предпочтительно 24 нуклеотида или более, наиболее предпочтительно 30 нуклеотидов или более. Такие зонды и праймеры специфически гибридизируются с целевой последовательностью в очень жестких условиях гибридизации. Предпочтительно, зонды и праймеры по настоящему изобретению имеют полную идентичность последовательности ДНК с последовательными нуклеотидами в целевой последовательности, хотя с помощью традиционных способов можно сконструировать зонд, который отличается от целевой последовательности ДНК и сохраняет способность гибридизироваться с целевыми последовательностями в условиях высокой жесткости.

Праймеры и зонды на основе фланкирующей геномной ДНК и вставленной последовательности по настоящему изобретению можно определить традиционными способами, например, путем выделения соответствующей молекулы ДНК из растительного материала, полученного от трансгенного объекта кукурузы DBN9936, и определения последовательности нуклеиновой кислоты этой молекулы ДНК. Молекула ДНК содержит трансгенную вставленную последовательность и геномную фланкирующую последовательность кукурузы, и в качестве праймера или зонда можно использовать некоторый фрагмент этой молекулы ДНК.

Зонд и праймер нуклеиновой кислоты по настоящему изобретению гибридизируются с целевой последовательностью ДНК в жестких условиях. Для выявления наличия ДНК из трансгенного объекта кукурузы DBN9936 в образце можно применять любой традиционный способ гибридизации или амплификации нуклеиновой кислоты. Молекулы нуклеиновой кислоты или их фрагменты при определенных обстоятельствах могут специфически гибридизироваться с другими молекулами нуклеиновой кислоты. В контексте настоящего описания две молекулы нуклеиновой кислоты могут специфически гибридизироваться друг с другом, если две молекулы могут образовывать антипараллельную двухцепочечную структуру нуклеиновой кислоты. Считают, что молекула нуклеиновой кислоты является «комплементарной последовательностью» другой молекулы нуклеиновой кислоты, если они проявляют полную комплементарность. В контексте настоящего описания считают, что две молекулы нуклеиновой кислоты проявляют «полную комплементарность», если каждый нуклеотид молекулы нуклеиновой кислоты является комплементарным соответствующему нуклеотиду другой молекулы нуклеиновой кислоты. Считают, что две молекулы нуклеиновой кислоты являются «минимально комплементарными», если они могут гибридизироваться друг с другом с достаточной стабильностью, так чтобы они могли соединяться и связываться друг с другом по меньшей мере в обычных условиях «малой жесткости». Аналогично, считают, что две молекулы нуклеиновой кислоты обладают «комплементарностью», если они могут гибридизироваться друг с другом с достаточной стабильностью, так чтобы они могли соединяться и связываться друг с другом в обычных условиях «высокой жесткости». Отклонения от полной комплементарности допустимы, если такие отклонения не полностью исключают образования двумя молекулами двухцепочечной структуры. Для того, чтобы выполнять роль праймера или зонда, молекуле нуклеиновой кислоты необходимо лишь иметь достаточную комплементарность последовательности, так чтобы она могла образовывать стабильную двухцепочечную структуру при определенных используемых концентрациях растворителя и солей.

В контексте настоящего описания практически гомологичная последовательность представляет собой молекулу нуклеиновой кислоты, которая будет специфически гибридизироваться с комплементарной цепью другой парной молекулы нуклеиновой кислоты в условиях высокой жесткости. Соответствующие жесткие условия, которые способствуют гибридизации ДНК, известны специалистам в настоящей области, например, обработка 6,0 × хлоридом натрия/цитратом натрия (SSC) при температуре приблизительно 45°С с последующим промыванием 2,0 × SSC при 50°С. Например, концентрация солей на стадии промывки может составлять от приблизительно 2,0 × SSC при 50°С при низкой жесткости до приблизительно 0,2 × SSC при 50°С при высокой жесткости. Кроме того, температура на стадии промывки может быть увеличена от комнатной температуры (приблизительно 22°С) в условиях низкой жесткости до приблизительно 65°С в условиях высокой жесткости. Как температура, так и концентрация солей могут варьировать, или же одна из них может оставаться постоянной, а другая переменная изменяется. Предпочтительно, молекула нуклеиновой кислоты по настоящему изобретению будет специфически гибридизироваться с одной или несколькими молекулами нуклеиновой кислоты SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, или комплементарными им последовательностями, или любым фрагментом вышеуказанных последовательностей в условиях умеренной жесткости, например, приблизительно 2,0 × SSC и приблизительно 65°С. Более предпочтительно, молекула нуклеиновой кислоты по настоящему изобретению будет специфически гибридизироваться с одной или несколькими молекулами нуклеиновой кислоты SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 и SEQ ID NO: 7, или их комплементарными последовательностями, или любым фрагментом вышеуказанных последовательностей в условиях высокой жесткости. Предпочтительная маркерная молекула нуклеиновой кислоты по настоящему изобретению содержит SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 и SEQ ID NO: 7, или комплементарные им последовательности, или любой фрагмент вышеуказанных последовательностей. Другая предпочтительная маркерная молекула нуклеиновой кислоты по настоящему изобретению имеет последовательность, которая на 80% - 100% или 90% - 100% идентична с SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 и SEQ ID NO: 7, или комплементарными им последовательностями, или любым фрагментом вышеуказанных последовательностей. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 6 и SEQ ID NO: 7 можно применять в качестве маркеров в способах селекции растений для выявления потомства генетического скрещивания. Гибридизацию зонда с целевой молекулой ДНК можно детектировать любым известным специалистам в настоящей области способом, включая без ограничения способы с использованием флуоресцентных меток, радиоактивных меток, меток на основе антител и хемилюминесцентных меток.

Что касается амплификации целевой последовательности нуклеиновой кислоты с использованием отдельной праймерной пары для амплификации (например, ПЦР), то «жесткие условия» являются условиями, которые позволяют праймерной паре гибридизироваться только с целевой последовательностью нуклеиновой кислоты в ходе термической реакции амплификации ДНК, причем праймер имеет последовательность дикого типа, соответствующую целевой последовательности нуклеиновой кислоты (или ее комплементарной последовательности), и поэтому может связываться с ней, предпочтительно с образованием уникального продукта амплификации, т.е ампликона.

Термин «специфическое связывание с (целевой последовательностью)» указывает на то, что в жестких условиях гибридизации зонд или праймер гибридизируется только с целевой последовательностью в образце, содержащем целевую последовательность.

В контексте настоящего описания термин «амплифицированная ДНК» или «ампликон» относится к продукту амплификации нуклеиновой кислоты от целевой последовательности нуклеиновой кислоты, используемой в качестве части матрицы нуклеиновой кислоты. Например, для определения, получено ли растение кукурузы в результате полового скрещивания трансгенного объекта кукурузы DBN9936, или содержит ли образец кукурузы, взятый на поле, трансгенный объект кукурузы DBN9936, или содержит ли экстракт кукурузы (такой как мука грубого помола, мука или масло) трансгенный объект кукурузы DBN9936, ДНК, экстрагированную из образца или экстракта ткани растения кукурузы, можно подвергнуть способу амплификации нуклеиновой кислоты с применением праймерной пары для получения ампликона, который позволяет идентифицировать наличие ДНК трансгенного объекта кукурузы DBN9936. В праймерную пару входит первый праймер, полученный из фланкирующей последовательности в геноме растения, которая примыкает к сайту вставки вставленной геномной ДНК, и второй праймер, полученный из вставленной экзогенной ДНК. Ампликон имеет определенную длину и последовательность, что также позволяет идентифицировать трансгенный объект кукурузы DBN9936. Ампликон может иметь длину, равную сумме объединенной длины праймерной пары плюс одна пара нуклеотидных оснований, или предпочтительно плюс приблизительно пятьдесят пар нуклеотидных оснований, или более предпочтительно плюс приблизительно двести пятьдесят пар нуклеотидных оснований, или наиболее предпочтительно плюс приблизительно четыреста пятьдесят пар нуклеотидных оснований или более.

В качестве альтернативы, праймерная пара может быть получена из фланкирующей геномной последовательности на обеих сторонах вставленной ДНК, с тем чтобы получить ампликон, который включает всю вставленную нуклеотидную последовательность. Один праймер из праймерной пары, полученный из геномной последовательности растения, может быть локализован на расстоянии от вставленной последовательности ДНК, и это расстояние может варьировать от одной пары нуклеотидных оснований до приблизительно двадцати тысяч пар нуклеотидных оснований. В контексте настоящего описания термин «ампликон», в частности, исключает димеры праймеров, образующиеся в ходе термической реакции амплификации ДНК.

Реакцию амплификации нуклеиновой кислоты можно осуществить любым из ряда способов амплификации нуклеиновой кислоты, которые известны из уровня техники, включая полимеразную цепную реакцию (ПЦР). Специалистам в настоящей области известно множество способов амплификации. Были разработаны ПЦР-способы амплификации для амплификации геномной ДНК размером 22 т.о. и ДНК бактериофага размером 42 т.о. В настоящем изобретении можно применять эти способы, а также другие способы амплификации ДНК, которые известны из уровня техники. Последовательность вставленной экзогенной ДНК и последовательность фланкирующей ДНК из трансгенного объекта кукурузы DBN9936 можно получить путем амплификации генома трансгенного объекта кукурузы DBN9936 с применением предлагаемых праймерных последовательностей с последующим осуществлением стандартных способов секвенирования ДНК на ПЦР-ампликоне или клонированной ДНК.

Наборы для детекции ДНК, в основе которых лежат способы амплификации ДНК, содержат молекулы ДНК-праймеров, которые специфически гибридизируются с целевой ДНК и амплифицируют диагностический ампликон в соответствующих условиях реакции. Набор может предусматривать возможность осуществления способа детекции на агарозном геле или многих известных в настоящей области способов детектирования диагностического ампликона. Настоящее изобретение относится к набору, который содержит ДНК-праймеры, которые гомологичны или комплементарны любой части геномного участка кукурузы в SEQ ID NO: 3 или SEQ ID NO: 4 и любой части трансгенного вставленного участка в SEQ ID NO: 5. Праймерная пара, которая специфически выявлена как пригодная в способе амплификации ДНК, содержит SEQ ID NO: 8 и SEQ ID NO: 9, которые амплифицируются с образованием диагностического ампликона, который гомологичен части 5'-трансгенного/геномного участка трансгенного объекта кукурузы DBN9936, причем ампликон содержит SEQ ID NO: 1. Другие молекулы ДНК, пригодные в качестве ДНК-праймеров, могут быть получены из SEQ ID NO: 5.

Ампликон, полученный этими способами, можно детектировать с помощью множества методик. Одним таким способом является Genetic Bit Analysis (анализ генетической информации или удлинение на твердой фазе), при котором конструируют олигонуклеотидную цепь ДНК, которая охватывает вставленную последовательность ДНК и прилегающую фланкирующую последовательность геномной ДНК. Олигонуклеотидную цепь иммобилизуют в лунках микролуночного планшета. После ПЦР-амплификации целевого участка (с использованием двух праймеров соответственно для вставленной последовательности и прилегающей фланкирующей геномной последовательности) одноцепочечный ПЦР-продукт можно гибридизировать с иммобилизованным олигонуклеотидом, и он послужит в качестве матрицы для реакции удлинения на одно основание с помощью ДНК-полимеразы и специфически меченных ddNTP для ожидаемого следующего основания. Результат можно получить с помощью флуоресцентных или ELISA способов. Сигнал свидетельствует о наличии вставленной/фланкирующей геномной последовательности, из чего понятно, что амплификация, гибридизация и удлинение на одно основание были успешными.

Другим способом является методика пиросеквенирования. Настоящий способ включает конструирование олигонуклеотидной цепи, охватывающей вставленную последовательность ДНК и прилегающую часть присоединения геномной ДНК. Олигонуклеотидную цепь гибридизируют с одноцепочечным ПЦР-продуктом из целевого участка (с использованием двух праймеров соответственно для вставленной последовательности и прилегающей фланкирующей геномной последовательности) и инкубируют вместе с ДНК-полимеразой, АТФ, сульфилазой, люциферазой, апиразой, аденозин-5'-фосфосульфатом и люциферином. Отдельно добавляют dNTP и измеряют производимый световой сигнал. Световой сигнал свидетельствует о наличии вставленной/фланкирующей последовательности, из чего понятно, что амплификация, гибридизация и удлинение на одно или несколько оснований были успешными.

Явление флуоресцентной поляризации, описанное Chen и соавт. (Genome Res., 1999, 9: 492-498), также представляет собой способ, который можно применять для детектирования ампликона по настоящему изобретению. Для применения этого способа необходимо сконструировать олигонуклеотидную цепь, охватывающую вставленную последовательность ДНК и прилегающую часть присоединения геномной ДНК. Олигонуклеотид гибридизируют с одноцепочечным ПЦР-продуктом из целевого участка (с использованием двух праймеров соответственно для вставленной последовательности и прилегающей фланкирующей геномной последовательности) и инкубируют вместе с ДНК-полимеразой и флуоресцентно меченым ddNTP. Удлинение на одно основание приводит к включению ddNTP. Такое включение можно измерить как изменение поляризации с помощью флуорометра. Изменение поляризации свидетельствует о наличии вставленной/фланкирующей последовательности, из чего понятно, что амплификация, гибридизация и удлинение на одно основание были успешными.

Taqman описывают как способ детектирования и количественного анализа наличия последовательности ДНК, и этот способ полностью описан в инструкциях производителя и кратко проиллюстрирован далее. Конструируют олигонуклеотидный зонд FRET, который охватывает вставленную последовательность ДНК и прилегающую геномную фланкирующую часть присоединения. Зонд FRET и ПЦР-праймеры (с использованием двух праймеров соответственно для вставленной последовательности и прилегающей фланкирующей геномной последовательности) подвергают нескольким циклам реакции в присутствии термостабильной полимеразы и dNTP. Гибридизация зонда FRET приводит к расщеплению между флуоресцентным фрагментом и гасящим фрагментом на зонде FRET и высвобождению флуоресцентного фрагмента. Выработка флуоресцентного сигнала свидетельствует о наличии вставленной/фланкирующей последовательности, из чего понятно, что амплификация и гибридизация были успешными.

Исходя из принципа гибридизации, в число подходящих методик для детектирования растительных материалов из трансгенного объекта кукурузы DBN9936 также входят саузерн-блоттинг, нозерн-блоттинг и гибридизация in situ. В частности, подходящие методики включают инкубацию зонда с образцом, промывку их для удаления несвязавшегося зонда и детектирование, гибридизировался ли зонд. Способ детектирования зависит от типа метки, прикрепленной к зонду, например, радиоактивно меченый зонд можно детектировать путем экспозиции на рентгеновскую пленку и ее проявления, или ферментативно меченый зонд можно детектировать по преобразованию субстрата, что вызывает изменение цвета.

Применение молекулярных маркеров при детектировании последовательности было описано в работе Tyangi и соавт. (Nat. Biotech., 1996, 14: 303-308), которая кратко описана далее. Конструируют олигонуклеотидный зонд FRET, который охватывает вставленную последовательность ДНК и прилегающую геномную фланкирующую часть присоединения. Благодаря уникальной структуре зонда FRET он содержит вторичную структуру, которая удерживает флуоресцентный фрагмент и гасящий фрагмент в непосредственной близости друг от друга. Зонд FRET и ПЦР-праймеры (с использованием двух праймеров соответственно для вставленной последовательности и фланкирующей геномной последовательности) подвергают нескольким циклам реакции в присутствии термостабильной полимеразы и dNTP. После успешной ПЦР-амплификации гибридизация зонда FRET с целевой последовательностью приводит к утрате вторичной структуры зонда, так чтобы флуоресцентный фрагмент и гасящий фрагмент стали пространственно разделены и выработался флуоресцентный сигнал. Выработка флуоресцентного сигнала свидетельствует о наличии вставленной/фланкирующей последовательности, из чего понятно, что амплификация и гибридизация были успешными.

Другие описанные способы, такие как микроструйная техника, обеспечивают способы и устройства для разделения и амплификации образцов ДНК. Для детектирования и определения конкретных молекул ДНК применяют оптические красители. Для детектирования молекул ДНК по настоящему изобретению пригодны устройства на нанотрубках, которые содержат электронный датчик для детектирования молекул ДНК или наночастиц для связывания конкретных молекул ДНК и, таким образом, могут быть детектированы.

Можно разработать наборы для детекции ДНК с использованием описанных в настоящем документе композиций и способов, описанных или известных в области детекции ДНК. Наборы пригодны для выявления того, содержит ли образец ДНК трансгенный объект кукурузы DBN9936 и можно ли его применять для селекции растений кукурузы, содержащих ДНК трансгенного объекта кукурузы DBN9936. Наборы могут содержать ДНК-праймеры или зонды, которые гомологичны или комплементарны по меньшей мере части SEQ ID NO: 1, 2, 3, 4 или 5, или содержать другие ДНК-праймеры или зонды, гомологичные или комплементарные ДНК, содержащейся в трансгенных генетических элементах ДНК, и эти последовательности ДНК могут быть использованы в реакциях амплификации ДНК или в качестве зондов в способах гибридизации ДНК. ДНК-структура трансгенной вставленной последовательности и геномной части присоединения кукурузы, содержащаяся в геноме кукурузы и проиллюстрированная на фиг. 1 и в таблице 1, содержит: фланкирующий геномный участок кукурузы DBN9936, прилегающий к 5'-концу трансгенной вставленной последовательности; часть вставленной последовательности от левого граничного участка (LB) Agrobacterium; первую кассету экспрессии, состоящую из промотора вируса мозаики цветной капусты (pr35S), содержащего тандемный повтор энхансерного участка, функционально связанный с интроном 70 кДа белка теплового шока Zea mays (iZmHSP70), функционально связанным с последовательностью, кодирующей белок Cry1Ab устойчивости к насекомым (cCry1Ab) Bacillus thuringiensis, и функционально связанной с нопалин-синтазным (Tnos) терминатором; вторую кассету экспрессии, состоящую из промотора рисового актина 1 (prOsAct1), функционально связанного с последовательностью, кодирующей транзитный пептид хлоропласта белка EPSPS Arabidopsis (spAtCTP2), функционально связанной с последовательностью, кодирующей устойчивую к глифосату 5-енолпирувил-шикимат-3-фосфат-синтазу (cEPSPS) от штамма СР4 Agrobacterium, и функционально связанной с терминатором 35S вируса мозаики цветной капусты (t35S); часть вставленной последовательности от правого граничного участка (RB) Agrobacterium; и фланкирующий геномный участок растения кукурузы DBN9936 на 3'-конце трансгенной вставленной последовательности (SEQ ID NO: 5). В способах амплификации ДНК молекулы ДНК, пригодные в качестве праймеров, могут представлять собой любую часть трансгенной вставленной последовательности, полученной от трансгенного объекта кукурузы DBN9936, или любую часть фланкирующей геномной последовательности ДНК кукурузы, полученной от трансгенного объекта кукурузы DBN9936.

Трансгенный объект кукурузы DBN9936 можно применять в комбинации с другими трансгенными сортами кукурузы, например, толерантными к гербицидам (таким как глюфосинат и дикамба) сортами кукурузы или трансгенными сортами кукурузы, несущими другие гены устойчивости к насекомым. Различные комбинации таких различных трансгенных объектов при использовании для селекции с трансгенным объектом кукурузы DBN9936 по настоящему изобретению могут давать улучшенные гибридные трансгенные сорта кукурузы, устойчивые к различным насекомым и толерантные к различным гербицидам. Эти сорта характеризуются более высокими показателями, такими как повышенная продуктивность, по сравнению с нетрансгенными сортами и трансгенными по одному признаку сортами.

Трансгенный объект кукурузы DBN9936 является устойчивым к повреждению от поедания вредителями отряда Lepidoptera и толерантным к фитотоксичности от сельскохозяйственных гербицидов, содержащих глифосат. Растение кукурузы с двумя модифицированными признаками экспрессирует белок Cry1Ab от Bacillus thuringiensis, обеспечивающий устойчивость к повреждению от поедания вредителями отряда Lepidoptera (такими как Ostrinia furnacalis), и экспрессирует белок устойчивости к глифосату 5-енолпирувил-шикимат-3-фосфат-синтаза (EPSPS) от штамма СР4 Agrobacterium, придающий растению устойчивость к глифосату. Кукуруза с двумя модифицированными признаками обладает следующими преимуществами: 1) появляется возможность избежать экономических потерь, связанных с вредителями отряда Lepidoptera (такими как Ostrinia furnacalis, Pseudaletia separata и Conogethes punctiferalis), причем Ostrinia furnacalis, Pseudaletia separata и Conogethes punctiferalis являются основными вредителями на площадях посева растений кукурузы; 2) применение сельскохозяйственных гербицидов, содержащих глифосат, обеспечивает возможность борьбы с широким спектром сорняков кукурузы; и 3) продуктивность кукурузы не снижается. Кроме того, гены, кодирующие признаки устойчивости к насекомым и толерантности к глифосату, сцеплены с одним и тем же сегментом ДНК и присутствуют в одном локусе генома трансгенного объекта кукурузы DBN9936, что обеспечивает повышенную эффективность селекции и позволяет отслеживать вставленные трансгенные фрагменты в популяции пропагул и их потомстве с помощью молекулярных маркеров. Между тем, в способах детектирования по настоящему изобретению можно применять SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарную ей последовательность в качестве ДНК-праймеров или зондов для получения продуктов амплификации, которые позволяют идентифицировать трансгенный объект кукурузы DBN9936 или его потомство, и с помощью этих способов можно быстро, точно и стабильно выявлять наличие растительных материалов от трансгенного объекта кукурузы DBN9936.

Краткое описание последовательностей

SEQ ID NO: 1: последовательность из 22 нуклеотидов, которая локализована вокруг участка присоединения вставки на 5'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936, причем нуклеотиды 1-11 и нуклеотиды 12-22 соответственно локализуются на каждой стороне сайта вставки в геноме кукурузы;

SEQ ID NO: 2: последовательность из 22 нуклеотидов, которая локализована вокруг участка присоединения вставки на 3'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936, причем нуклеотиды 1-11 и нуклеотиды 12-22 соответственно локализуются на каждой стороне сайта вставки в геноме кукурузы;

SEQ ID NO: 3: последовательность из 1001 нуклеотида, которая локализована вокруг участка присоединения вставки на 5'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936;

SEQ ID NO: 4: последовательность из 1204 нуклеотидов, которая локализована вокруг участка присоединения вставки на 3'-конце вставленной последовательности у трансгенного объекта кукурузы DBN9936;

SEQ ID NO: 5: 5'-фланкирующая геномная последовательность кукурузы, вставленная последовательность Т-ДНК и 3'-фланкирующая геномная последовательность кукурузы;

SEQ ID NO: 6: внутренняя последовательность SEQ ID NO: 3, охватывающая нуклеотидную последовательность и последовательность терминации транскрипции tNos в последовательности ДНК конструкции DBN10124;

SEQ ID NO: 7 внутренняя последовательность SEQ ID NO: 4, охватывающая последовательность терминации транскрипции t35S и нуклеотидную последовательность в последовательности ДНК конструкции DBN10124;

SEQ ID NO: 8: первый праймер, с помощью которого амплифицируют SEQ ID NO: 3;

SEQ ID NO: 9: второй праймер, с помощью которого амплифицируют SEQ ID NO: 3;

SEQ ID NO: 10: первый праймер, с помощью которого амплифицируют SEQ ID NO: 4;

SEQ ID NO: 11: второй праймер, с помощью которого амплифицируют SEQ ID NO: 4;

SEQ ID NO: 12: праймер от 5'-фланкирующей геномной последовательности;

SEQ ID NO: 13: праймер от Т-ДНК, который образует пару с SEQ ID NO: 12;

SEQ ID NO: 14: праймер от 3'-фланкирующей геномной последовательности, который можно применять в паре с SEQ ID NO: 12 для детектирования, является ли трансген гомозиготным или гетерозиготным;

SEQ ID NO: 15: праймер от Т-ДНК, который образует пару с SEQ ID NO: 14;

SEQ ID NO: 16: праймер 1 для детектирования Cry1Ab в реакции Taqman;

SEQ ID NO: 17: праймер 2 для детектирования Cry1Ab в реакции Taqman;

SEQ ID NO: 18: зонд 1 для детектирования Cry1Ab в реакции Taqman;

SEQ ID NO: 19: праймер 3 для детектирования EPSPS в реакции Taqman;

SEQ ID NO: 20: праймер 4 для детектирования EPSPS в реакции Taqman;

SEQ ID NO: 21: зонд 2 для детектирования EPSPS в реакции Taqman;

SEQ ID NO: 22: первый праймер к эндогенному гену кукурузы белка убиквитина;

SEQ ID NO: 23: второй праймер к эндогенному гену кукурузы белка убиквитина;

SEQ ID NO: 24: зонд к Cry1Ab в анализе гибридизации с использованием саузерн-блоттинга;

SEQ ID NO: 25: зонд к EPSPS в анализе гибридизации с использованием саузерн-блоттинга;

SEQ ID NO: 26: праймер от Т-ДНК, который имеет такое же направление, что и SEQ ID NO: 13;

SEQ ID NO: 27: праймер от Т-ДНК, который имеет противоположное направление к SEQ ID NO: 13, и его применяют для получения фланкирующей последовательности;

SEQ ID NO: 28: праймер от Т-ДНК, который имеет противоположное направление к SEQ ID NO: 13, и его применяют для получения фланкирующей последовательности;

SEQ ID NO: 29: праймер от Т-ДНК, который имеет такое же направление, что и SEQ IDNO: 15;

SEQ ID NO: 30: праймер от Т-ДНК, который имеет противоположное направление к SEQ ID NO: 15, и его применяют для получения фланкирующей последовательности;

SEQ ID NO: 31: праймер от Т-ДНК, который имеет противоположное направление к SEQ ID NO: 15, и его применяют для получения фланкирующей последовательности.

Далее будут подробно описаны технические решения по настоящему изобретению с привязкой к чертежам и примерам.

Краткое описание чертежей

На фиг. 1 представлена структурная схема трансгенной вставленной последовательности кукурузной геномной части присоединения у объекта кукурузы DBN9936 и схема относительного положения последовательностей нуклеиновой кислоты, применяемых в способе детектирования объекта кукурузы DBN9936;

на фиг. 2 представлена структурная схема рекомбинантного вектора экспрессии DBN10124 для детектирования объекта кукурузы DBN9936;

на фиг. 3 показано сравнение результатов испытания в полевых условиях между объектом кукурузы DBN9936 и растениями дикого типа, которые инокулированы посредством Ostrinia furnacalis, на стадии мутовки и стадии выметывания пестичных столбиков;

на фиг. 4 показано сравнение результатов испытания в полевых условиях между объектом кукурузы DBN9936 и растениями дикого типа (нетрансгенными, NGM), которые инокулированы посредством Mythimna separata;

на фиг. 5 показано сравнение результатов испытания в полевых условиях между объектом кукурузы DBN9936 и растениями дикого типа (нетрансгенными, NGM), которые инокулированы посредством Helicoverpa armigera;

на фиг. 6 показано сравнение результатов испытания в полевых условиях между объектом кукурузы DBN9936 и растениями дикого типа (нетрансгенными, NGM) в условиях присутствия встречающихся в природе Conogethes punctiferalis;

на фиг. 7 показано сравнение результатов испытания в полевых условиях между объектом кукурузы DBN9936 и растениями дикого типа (нетрансгенными, NGM) в условиях присутствия встречающейся в природе Spodoptera exigua.

Подробное раскрытие настоящего изобретения

Некоторые предпочтительные варианты осуществления настоящего изобретения далее будут проиллюстрированы на основе конкретных примеров.

Пример 1

Получение трансгенного объекта кукурузы DBN9936

1.1 Клонирование вектора

Рекомбинантный вектор экспрессии DBN10124 (показанный на фиг. 2) строили с помощью стандартных методик клонирования генов. Вектор DBN10124 содержал две трансгенных кассеты экспрессии, расположенные в тандеме: первая кассета экспрессии состояла из промотора вируса мозаики цветной капусты (pr35S), содержащего тандемный повтор энхансерного участка, функционально связанный с интроном 70-кДа белка теплового шока Zea mays (iZmHSP70), функционально связанного с последовательностью, кодирующей белок Cry1Ab устойчивости к насекомым (cCry1Ab) от Bacillus thuringiensis, и функционально связанной с нопалин-синтазным терминатором (tNos); вторая кассета экспрессии состояла из промотора рисового актина 1 (prOsAct1), функционально связанного с последовательностью, кодирующей транзитный пептид хлоропласта белка EPSPS Arabidopsis (spAtCTP2), функционально связанной с последовательностью, кодирующей устойчивую к глифосату 5-енолпирувил-шикимат-3-фосфат-синтазу (cEPSPS) от штамма СР4 Agrobacterium, и функционально связанной с терминатором 35S вируса мозаики цветной капусты (t35S).

Вектор DBN10124 вводили путем трансформации в штамм LBA4404 Agrobacterium с помощью способа, включающего использование жидкого азота (Invitrogen, Чикаго, США; кат. №18313-015), и применяли 5-енолпирувил-шикимат-3-фосфат-синтазу (EPSPS) в качестве селективного маркера для скрининга трансформированных клеток.

1.2 Трансформация растений

Трансформацию осуществляли с помощью традиционного способа Agrobacterium-опосредованной трансформации, который включает: совместное культивирование культивированных в стерильных условиях незрелых зародышей кукурузы с Agrobacterium, как описано в примере 1.1, для введения Т-ДНК в рекомбинантном векторе экспрессии DBN10124 путем трансформации в геном кукурузы с получением трансгенного объекта кукурузы DBN9936.

Вкратце, Agrobacterium-опосредованная трансформация кукурузы включает: приведение в контакт незрелых зародышей, выделенных из кукурузы, с суспензией Agrobacterium, при этом Agrobacterium может передавать нуклеотидные последовательности генов Cry1Ab и EPSPS по меньшей мере в одну клетку в одном из незрелых зародышей (стадия 1: стадия инфицирования), а на следующей стадии незрелые зародыши предпочтительно погружали в суспензию Agrobacterium (OD660=0,4-0,6, среда для инфицирования (4,3 г/л солей MS, витамины MS, 300 мг/л казеина, 68,5 г/л сахарозы, 36 г/л глюкозы, 40 мг/л ацетосирингона (AS), 1 мг/л 2,4-дихлорфеноксиуксусной кислоты (2,4-D); рН 5,3)) для начала инокуляции. Незрелых зародышей совместно культивировали с Agrobacterium в течение некоторого периода времени (стадия 2: стадия совместного культивирования). Предпочтительно, незрелых зародышей культивировали на твердой среде (4,3 г/л солей MS, витамины MS, 300 мг/л казеина, 20 г/л сахарозы, 10 г/л глюкозы, 100 мг/л ацетосирингона (AS), 1 мг/л 2,4-дихлорфеноксиуксусной кислоты (2,4-D), 8 г/л агара, рН 5,8) после стадии инфицирования. После стадии совместного культивирования могла идти необязательная стадия «восстановления». На стадии «восстановления» восстанавливающая среда (4,3 г/л солей MS, витамины MS, 300 мг/л казеина, 30 г/л сахарозы, 1 мг/л 2,4-дихлорфеноксиуксусной кислоты (2,4-D), 3 г/л растительного геля, рН 5,8) содержала по меньшей мере один антибиотик, который известен как ингибитор роста Agrobacterium, при этом она не содержит никакого селективного средства для растительных трансформантов (стадия 3: стадия восстановления). Предпочтительно, незрелых зародышей культивировали на твердой среде, содержащей антибиотик, но без селективного средства, для устранения Agrobacterium и обеспечения периода восстановления инфицированных клеток. Затем инокулированные незрелые зародыши культивировали на среде, содержащей селективное средство (N-(фосфонометил)глицин), и отбирали растущие трансформированные каллусы (стадия 4: стадия отбора). Предпочтительно, незрелых зародышей культивировали на твердой селективной среде (4,3 г/л солей MS, витамины MS, 300 мг/л казеина, 30 г/л сахарозы, 0,25 моль/л N-(фосфонометил)глицина, 1 мг/л 2,4-дихлорфеноксиуксусной кислоты (2,4-D), 3 г/л растительного геля, рН 5,8), содержащей селективное средство, что приводило к селективному росту трансформированных клеток. Затем каллусы регенерировали в растения (стадия 5: стадия регенерации). Предпочтительно, каллусы, растущие на среде, содержащей селективное средство, культивировали на твердой среде (дифференциальной среде MS и среде MS для укоренения) для регенерации растений.

Устойчивые каллусы, полученные в результате скрининга, переносили в дифференциальную среду MS (4,3 г/л солей MS, витамины MS, 300 мг/л казеина, 30 г/л сахарозы, 2 мг/л 6-бензиладенина, 0,125 моль/л N-(фосфонометил)глицина, 3 г/л растительного геля, рН 5,8), культивировали для дифференцировки при 25°С. Дифференцированные проростки переносили в среду MS для укоренения (2,15 г/л солей MS, витамины MS, 300 мг/л казеина, 30 г/л сахарозы, 1 мг/л индол-3-уксусной кислоты, 8 г/л агара, рН 5,8) и культивировали при 25°С. При достижении проростками приблизительно 10 см в высоту их перемещали в теплицу и культивировали до плодоношения. В теплице их культивировали при 28°С в течение 16 часов, затем при 20°С в течение 8 часов в сутки.

1.3 Выявление и скрининг трансгенных объектов

Всего было получено 770 независимых отдельных трансгенных растений Т0.

С помощью анализа TaqMan™ (см. пример 2) проводили детекцию регенерированных растения кукурузы в отношении наличия генов Cry1Ab и EPSPS, и устойчивые к насекомым и толерантные к гербициду глифосат линии характеризовали в отношении числа копий. С помощью скрининга по этим характеристикам, в том числе по числу копий целевых генов, хорошей устойчивости к насекомым, толерантности к гербициду глифосат и агротехническим свойствам (см. примеры 5 и 6), объект DBN9936 был выбран как превосходный объект. Объект DBN9936 содержал одну копию трансгена, обладал хорошей устойчивостью к насекомым, толерантностью к гербициду глифосат и агротехническими свойствами (см. примеры 5 и 6).

Пример 2

Детектирование трансгенного объекта кукурузы DBN9936 с помощью TaqMan

С помощью набора для экстракции ДНК растений (DNeasy plant Maxi Kit, Qiagen) геномную ДНК экстрагировали из листа (приблизительно 100 мг) трансгенного объекта кукурузы DBN9936 в качестве образца и детектировали число копий Cry1Ab и EPSPS с помощью способа флуоресцентной количественной ПЦР с применением зонда Taqman. В то же время, в качестве контроля подвергали детектированию и анализу растение кукурузы дикого типа согласно описанным выше способам. Эксперименты проводили в трех повторностях, а значения усредняли.

Конкретный способ заключался в следующем:

стадия 11: 100 мг листа трансгенного объекта кукурузы DBN9936 измельчали до гомогената в ступке с жидким азотом и каждый образец готовили в трех повторностях;

стадия 12: геномные ДНК вышеуказанных образцов экстрагировали с помощью набора DNeasy plant Mini Kit от Qiagen (подробности способа см. в инструкциях к продуктам);

стадия 13: концентрации геномных ДНК вышеуказанных образцов измеряли с использованием ультрамикроспектрофотометра (NanoDrop 2000, Thermo Scientific);

стадия 14: концентрации геномных ДНК вышеуказанных образцов корректировали до одинакового значения концентрации в диапазоне от 80 до 100 нг/мкл (конкретный способ хорошо известен специалистам в настоящей области техники или может быть найден в инструкциях к продуктам);

стадия 15: число копий в образцах выявляли с помощью способа флуоресцентной количественной ПЦР с использованием зонда Taqman с применением выявленного образца с известным числом копий в качестве стандарта и растения кукурузы дикого типа в качестве контроля. Каждый образец тестировали в трех повторностях, а значения усредняли. Далее приведены последовательности праймеров и зондов для флуоресцентной количественной ПЦР.

Следующие праймеры и зонд применяли для детекции последовательности гена Cry1Ab:

праймер 1: CGAACTACGACTCCCGCAC, изложенный в SEQ ID NO: 16 в ПЕРЕЧНЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ;

праймер 2: GTAGATTTCGCGGGTCAGTTG, изложенный в SEQ ID NO: 17 в ПЕРЕЧНЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ;

зонд 1: CTACCCGATCCGCACCGTGTCC, изложенный в SEQ ID NO: 18 в ПЕРЕЧНЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ;

Следующие праймеры и зонд применяли для детекции последовательности гена EPSPS:

праймер 3: CTGGAAGGCGAGGACGTCATCAATA, изложенный в SEQ ID NO: 19 в ПЕРЕЧНЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ;

праймер 4: TGGCGGCATTGCCGAAATCGAG, изложенный в SEQ ID NO: 20 в ПЕРЕЧНЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ;

зонд 2: ATGCAGGCGATGGGCGCCCGCATCCGTA, изложенный в SEQ ID NO: 21 в ПЕРЕЧНЕ ПОСЛЕДОВАТЕЛЬНОСТЕЙ.

Система для проведения ПЦР-реакции включала:

мастер-микс ПЦР (JumpStart™ Taq ReadyMix™, Sigma), 10 мкл;

50 × смесь праймеров/зонда, 1 мкл;

геномную ДНК, 3 мкл;

дважды дистиллированную воду (ddFbO), 6 мкл;

причем 50 × смесь праймеров/зонда содержала 45 мкл каждого праймера в концентрации 1 мМ, 50 мкл зонда в концентрации 100 мкМ и 860 мкл 1 × ТЕ буфера (10 мМ Tris-HCl, рН 8,0; 1 мМ EDTA, рН 8,0), и ее хранили в янтарной пробирке при 4°С.

Условия для проведения ПЦР-реакции включали:

Данные анализировали с помощью программного обеспечения для системы быстрого проведения флуоресцентной количественной ПЦР (Applied Biosystems 7900НТ Fast Real-Time PCR System SDS v2.3, Applied Biosystems), из результатов чего было видно, что полученный трансгенный объект кукурузы DBN9936 нес одну копию.

Пример 3

Детекция трансгенного объекта кукурузы DBN9936

3.1. Экстракция геномной ДНК

ДНК экстрагировали традиционным способом с применением СТАВ (цетилтриметиламмония бромида): после измельчения 2 г молодого листа трансгенного объекта кукурузы DBN9936 в порошок в жидком азоте добавляли 0,5 мл буфера для экстракции ДНК с СТАВ (20 г/л СТАВ, 1,4 М NaCl, 100 мМ Tris-HCl и 20 мМ EDTA (этилендиаминтетрауксусной кислоты), доведенные посредством NaOH до рН 8,0), предварительно нагретого до 65°С, затем их тщательно перемешивали и экстрагировали при 65°С в течение 90 мин.; добавляли 0,5 объема фенола и 0,5 объема хлороформа и смешивали путем переворачивания емкости; смесь центрифугировали на 12000 об./мин. (оборотов в минуту) в течение 10 мин.; отбирали супернатант и добавляли 2 объема абсолютного этанола; центрифужную пробирку слегка встряхивали, а затем оставляли отстаиваться при 4°С в течение 30 мин.; центрифужную пробирку снова центрифугировали на 12000 об./мин. в течение 10 мин., так чтобы ДНК собиралась на дне пробирки; удаляли супернатант, а осадок промывали 1 мл 70% этанола (массовая концентрация); смесь центрифугировали при 12000 об./мин. в течение 5 мин.; осадок сушили под вакуумом или просушивали потоком воздуха на очень чистом столе; и полученный осадок ДНК растворяли в соответствующем количестве ТЕ-буфера и хранили при -20°С.

3.2 Анализ последовательности фланкирующей ДНК

Измеряли концентрацию вышеуказанного экстрагированного образца ДНК (тем же способом, что и на стадии 13 примера 2) и доводили ее до 80-100 нг/мкл. Геномную ДНК соответственно расщепляли с помощью избранных ферментов рестрикции Sac I, Kpn I, Xma I, Nhe I (анализ 5'-конца) и Spe I, Pst I, BssH II (анализ 3'-конца). В каждую систему для ферментативного расщепления добавляли 26,5 мкл геномной ДНК, 0,5 мкл вышеупомянутых избранных ферментов рестрикции и 3 мкл буфера для ферментативного расщепления (все использованные ферменты рестрикции представляли собой ферменты и подходящие для них буферы от компании NEB (теперь NEBCutSmart), и таким образом 3 мкл буфера для ферментативного расщепления могли представлять собой, в частности, 3 мкл буфера NEBCutSmart) и проводили расщепление в течение 1 часа. После расщепления в систему для ферментативного расщепления добавляли 70 мкл безводного этанола, выдерживали на ледяной бане в течение 30 мин. и центрифугировали на 12000 об./мин. в течение 7 мин. После удаления супернатанта осадок просушивали потоком воздуха, затем в него вносили 8,5 мкл дважды дистиллированной воды, 1 мкл буфера для 10 × Т4 ДНК-лигазы (реакционного буфера для Т4 ДНК-лигазы от NEB; для его подробного состава см. веб-сайты компании NEB или см. https://www.neb.com/products/restriction-endonucleases или https://www.neb.com/products/b0202-t4-dna-ligase-reaction-buffer) и 0,5 мкл Т4-ДНК, а затем лигировали в течение ночи при 4°С. 5'- и 3'-трансгенную/геномную ДНК выделяли с помощью ПЦР-амплификации с применение набора гнездовых праймеров. В частности, комбинация праймеров для выделения 5'-трансгенной/геномной ДНК включала SEQ ID NO: 13 и SEQ ID NO: 26 в качестве первых праймеров, SEQ ID NO: 27 и SEQ ID NO: 28 в качестве вторых праймеров и SEQ ID NO: 13 в качестве праймера для секвенирования. Комбинация праймеров для выделения 3'-трансгенной/геномной ДНК включала SEQ ID NO: 15 и SEQ ID NO: 29 в качестве первых праймеров, SEQ ID NO: 30 и SEQ ID NO: 31 в качестве вторых праймеров и SEQ ID NO: 15 в качестве праймера для секвенирования. Условия реакции ПЦР приведены в таблице 3.

ПЦР-реагент отделяли путем электрофореза полученного ампликона на 2,0% агарозном геле и путем выделения целевого фрагмента из агарозной матрицы с использованием набора для экстракции из геля (набора QIAquick Gel Extraction Kit, каталожный №28704, Qiagen Inc., Валенсия, Калифорния). Затем очищенные ПЦР-продукты секвенировали (например, с использованием ABI PrismTM 377, РЕ Biosystems, Фостер Сити, Калифорния) и анализировали (например, с помощью программного обеспечения для анализа последовательностей DNASTAR, DNASTAR Inc., Мэдисон, Висконсин).

5'- и 3'-фланкирующие последовательности и последовательности участка присоединения подтверждали с помощью стандартных ПЦР-процедур. 5'-фланкирующие и последовательности участка присоединения подтверждали с помощью SEQ ID NO: 8 или SEQ ID NO: 12 в комбинации с SEQ ID NO: 9, SEQ ID NO: 13 или SEQ ID NO: 26. 3'-фланкирующие и последовательности участка присоединения подтверждали с помощью SEQ ID NO: 11 или SEQ ID NO: 14 в комбинации с SEQ ID NO: 10, SEQ ID NO: 15 или SEQ ID NO: 29. Системы для ПЦР-реакции и условия амплификации приведены в таблицах 2 и 3. Специалистам в настоящей области техники будет понятно, что для подтверждения фланкирующих последовательностей и последовательностей участка присоединения также можно применять другие праймерные последовательности.

Секвенирование ДНК ПЦР-продукта давало ДНК, которую можно было применять для конструирования других молекул ДНК, которые можно было бы применять в качестве праймеров и зондов для выявления растений или семян кукурузы, происходящих от трансгенного объекта кукурузы DBN9936.

Было обнаружено, что вставленная последовательность у трансгенного объекта кукурузы DBN9936 фланкирована на правой границе (5'-фланкирующая последовательность) геномной последовательностью кукурузы, показанной в виде нуклеотидов 1-832 под SEQ ID NO: 5, а на левой границе фланкирована (3'-фланкирующая последовательность) геномной последовательностью кукурузы, показанной в виде нуклеотидов 8202-9215 под SEQ ID NO: 5. 5'-последовательность участка присоединения была изложена в SEQ ID NO: 1, а 3'-последовательность участка присоединения была изложена в SEQ ID NO: 2.

3.3. ПЦР-анализ на зиготность

Последовательность участка присоединения представляет собой относительно короткую полинуклеотидную молекулу, которая является новой последовательностью ДНК и в случае детекции позволяет идентифицировать ДНК трансгенного объекта кукурузы DBN9936 в ходе детекции и анализа полинуклеотида. Последовательность участка присоединения соответственно в SEQ ID NO: 1 и в SEQ ID NO: 2 представляет собой полинуклеотиды из 11 нуклеотидов на каждой стороне сайта вставленного трансгенного фрагмента и геномной ДНК кукурузы у трансгенного объекта кукурузы DBN9936. Более длинные или более коротки полинуклеотидные последовательности участка присоединения можно выбрать из SEQ ID NO: 3 или SEQ ID NO: 4. Последовательности участка присоединения (SEQ ID NO: 1, используемая в качестве 5' участка присоединения, и SEQ ID NO: 2, используемая в качестве 3' участка присоединения) были пригодны для способа детектирования ДНК в качестве ДНК-зондов или ДНК-праймерных молекул. Последовательности участка присоединения SEQ ID NO: 6 и SEQ ID NO: 7 также были новыми последовательностями ДНК трансгенного объекта кукурузы DBN9936, и их также можно было применять для детектирования наличия трансгенного объекта кукурузы DBN9936 в качестве ДНК-зондов или ДНК-праймерных молекул. SEQ ID NO: 6 (нуклеотиды 833-1001 из SEQ ID NO: 3) охватывает последовательность ДНК и последовательность терминации транскрипции tNos в конструкции DBN10124, a SEQ ID N0: 7 (нуклеотиды 1-190 из SEQ ID NO: 4) охватывает последовательность терминации транскрипции t35S и последовательность ДНК в конструкции DBN10124.

Кроме того, ампликон получали с использованием по меньшей мере одного праймера, происходящего от SEQ ID NO: 3 или SEQ ID NO: 4, и указанный праймер при применении согласно ПЦР-способу давал ампликон, который позволял идентифицировать трансгенный объект кукурузы DBN9936.

В частности, с 5'-конца трансгенной вставленной последовательности получали ПЦР-продукт, содержащий часть геномной ДНК, фланкирующей 5'-конец вставленной последовательности Т-ДНК в геноме растительных материалов, полученных от трансгенного объекта кукурузы DBN9936. ПЦР-продукт содержал SEQ ID NO: 3. Для ПЦР-амплификации были разработаны праймер 5 (SEQ ID NO: 8), который может гибридизироваться с геномной последовательностью ДНК, фланкирующей 5'-конец трансгенной вставленной последовательности, и праймер 6 (SEQ ID NO: 9), который может быть в паре с праймером 5 и локализоваться в трансгенной последовательности терминации транскрипции t35S.

С 3'-конца трансгенной вставленной последовательности получали ПЦР-продукт, содержащий часть геномной ДНК, фланкирующей 3'-конец вставленной последовательности Т-ДНК в геноме растительных материалов, полученных от трансгенного объекта кукурузы DBN9936. ПЦР-продукт содержал SEQ ID NO: 4. Для ПЦР-амплификации были разработаны праймер 8 (SEQ ID NO: 11), который может гибридизироваться с геномной последовательностью ДНК, фланкирующей 3'-конец трансгенной вставленной последовательности, и праймер 7 (SEQ ID NO: 10), который может быть в паре с праймером 8 и локализоваться в трансгенной последовательности терминации транскрипции t35S.

Условия амплификации ДНК, описанные в таблице 2 и таблице 3, можно использовать в вышеописанных ПЦР-анализах на зиготность для получения ампликона, который позволяет идентифицировать трансгенный объект кукурузы DBN9936. Детекцию ампликонов можно проводить с применением следующих термоцикл еров: Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700 или Eppendorf Mastercycler Gradien и тому подобных, или согласно способам и с использованием устройства, которые известны специалистам в настоящей области техники.

Реакционные растворы осторожно смешивали, и если на термоциклере отсутствовала теплоизолирующая крышка, сверху добавляли 1-2 капли минерального масла. ПЦР проводили в термоциклере Stratagene Robocycler (Stratagene, Ла-Хойя, Калифорния), MJ Engine (MJ R-Biorad, Геркулес, Калифорния), Perkin-Elmer 9700 (Perkin Elmer, Бостон, Массачусетс) или Eppendorf Mastercycler Gradient (Eppendorf, Гамбург, Германия) с применением вышеуказанных параметров цикла (таблица 3). Термоцикл MJ Engine или Eppendorf Mastercycler Gradient необходимо было запускать в расчетном режиме. Скорость изменения температуры для термоциклера Perkin-Elmer 9700 в процессе работы должна была быть выставлена на максимум.

Из результатов было видно, что при использовании в ПЦР-реакции геномной ДНК трансгенного объекта кукурузы DBN9936 праймеры 5 и 6 (SEQ ID NO: 8 и 9) давали в результате продукт амплификации, представлявший собой фрагмент из 1001 п. о., но при использовании этих праймеров в ПЦР-реакциях с геномной ДНК нетрансформированной кукурузы и геномной ДНК кукурузы не из DBN9936, не амплифицировалось никаких фрагментов; при использовании в ПЦР-реакции геномной ДНК трансгенного объекта кукурузы DBN9936 праймеры 7 и 8 (SEQ ID NO: 10 и 11) давали в результате продукт амплификации, представлявший собой фрагмент из 1204 п. о., но при использовании этих праймеров в ПЦР-реакциях с геномной ДНК нетрансформированной кукурузы и геномной ДНК кукурузы не из DBN9936, не амплифицировалось никаких фрагментов.

ПЦР-анализ на зиготность можно было использовать для выявления, является ли материал, полученный от трансгенного объекта кукурузы DBN9936, гомозиготным или гетерозиготным. Праймер 9 (SEQ ID NO: 12), праймер 10 (SEQ ID NO: 13) и праймер 11 (SEQ ID NO: 14) применяли в реакции амплификации для получения ампликона, который позволяет идентифицировать трансгенный объект кукурузы DBN9936. Условия амплификации ДНК, описанные в таблицах 4 и 5, можно использовать в вышеописанных анализах на зиготность для получения ампликона, который позволяет идентифицировать трансгенный объект кукурузы DBN9936.

ПЦР проводили в термоциклере Stratagene Robocycler (Stratagene, Ла-Хойя, Калифорния), MJ Engine (MJ R-Biorad, Геркулес, Калифорния), Perkin-Elmer 9700 (Perkin Elmer, Бостон, Массачусетс) или Eppendorf Mastercycler Gradient (Eppendorf, Гамбург, Германия) с применением вышеуказанных параметров цикла (таблица 5). Термоциклер MJ Engine или Eppendorf Mastercycler Gradient необходимо было запускать в расчетном режиме. Скорость изменения температуры для термоциклера Perkin-Elmer 9700 в процессе работы должна была быть выставлена на максимум.

В реакции амплификации биологический образец, который содержал матричную ДНК, содержал ДНК, которая позволяет идентифицировать наличие трансгенного объекта кукурузы DBN9936. Или же реакция приводила к образованию двух различных ампликонов ДНК, получаемых из биологического образца, содержащего ДНК, полученную из генома кукурузы, а ДНК, полученная из генома кукурузы, была гетерозиготной по отношению к соответствующему аллелю вставленной ДНК у трансгенного объекта кукурузы DBN9936. Два различных ампликона могут соответствовать первому ампликону, полученному с локуса генома кукурузы дикого типа, и второму ампликону, который позволяет идентифицировать наличие ДНК трансгенного объекта кукурузы DBN9936. Тот результат, что образец ДНК кукурузы дает лишь один ампликон, соответствующий второму ампликону, описанному в отношении гетерозиготного генома, может указывать на наличие трансгенного объекта кукурузы DBN9936 в таком образце, а сам образец был получен из семян кукурузы, гомозиготных по соответствующему аллелю ДНК вставки у трансгенного растения кукурузы DBN9936.

Следует отметить, что праймерные пары для трансгенного объекта кукурузы DBN9936 применяли с целью получения ампликона, который позволяет идентифицировать геномную ДНК трансгенного объекта кукурузы DBN9936. В число этих праймерных пар входят без ограничения праймеры 5 и 6 (SEQ ID NO: 8 и SEQ ID NO: 9) и праймеры 7 и 8 (SEQ ID NO: 10 и SEQ ID NO: 11), и их применяли в способе амплификации ДНК. Кроме того, в качестве внутреннего стандарта условий реакции были включены праймеры 12 и 13 (SEQ ID NO: 22 и 22) для амплификации эндогенного гена кукурузы. Анализ образца экстракции ДНК трансгенного объекта кукурузы DBN9936 должен был включать положительный контроль экстракта ДНК ткани от трансгенного объекта кукурузы DBN9936, отрицательный контроль экстракта ДНК от растения кукурузы, которое не являлось трансгенным объектом кукурузы DBN9936, и отрицательный контроль, который не содержал экстракта матричной ДНК кукурузы. Помимо этих праймерных пар можно было применять любую праймерную пару из SEQ ID NO: 3 или SEQ ID NO: 4 или комплементарных им последовательностей. При применении этих праймеров для реакции амплификации ДНК они соответственно давали ампликоны, которые содержали SEQ ID NO: 1 или SEQ ID NO: 2 и позволяли идентифицировать ткань трансгенного растения кукурузы, происходящую от трансгенного объекта кукурузы DBN9936. Условия амплификации ДНК, которые описаны в таблицах 2-5, можно применять при получении ампликона, который позволяет идентифицировать трансгенный объект кукурузы DBN9936 с помощью подходящей праймерной пары. Для амплификации с целью определения наличия трансгенного объекта кукурузы DBN9936 в качестве матрицы можно применять ДНК-экстракт растения или семян кукурузы, который дает ампликон, позволяющий идентифицировать трансгенный объект кукурузы DBN9936 в ходе способа амплификации ДНК, ДНК-экстракт растения или семени кукурузы, который предположительно содержит материал трансгенного объекта кукурузы DBN9936, или продукт, полученный из трансгенного объекта кукурузы DBN9936.

Пример 4

Определение трансгенного объекта кукурузы DBN9936 с помощью саузерн-блоттинга

4.1 Экстракция ДНК для применения в саузерн-блоттинге

Саузерн-блоттинг проводили с применений гомозиготных полученных путем трансформации объектов поколений Т4 и Т5. Примерно 5-10 г растительной ткани измельчали в жидком азоте с применением ступки и пестика. Растительную ткань ресуспендировали в 12,5 мл экстракционного буфера А (0,2 М Tris, рН 8,0, 50 мМ EDTA, 0,25 М NaCl, 0,1% об./об. β-меркаптоэтанола, 2,5% мас./об. поливинилпирролидона) и центрифугировали на 4000 об./мин. (2755 g) в течение 10 минут. После удаления супернатанта осадок ресуспендировали в 2,5 мл экстракционного буфера В (0,2 М Tris, рН 8,0, 50 мМ EDTA, 0,5 М NaCl, 1% об./об. β-меркаптоэтанола, 2,5% мас./об. поливинилпирролидона, 3% саркозила, 20% этанола) и инкубировали при 37°С в течение 30 минут. В процессе инкубации образец перемешивали один раз с помощью стерильной инокуляционной петли. После инкубации добавляли равный объем хлороформа/изоамилового спирта (24:1) аккуратно перемешивали путем переворачивания емкости и центрифугировали на 4000 об./мин. в течение 20 минут. Собирали водный слой и добавляли 0,54 объема изопропанола, а затем центрифугировали на 4000 об./мин. в течение 5 минут для осаждения ДНК. Супернатант отбрасывали, а осадок ДНК ресуспендировали в 500 мкл ТЕ. Для разрушения любой возможной РНК в течение 30 минут при 37°С инкубировали ДНК с 1 мкл 30 мг/мл РНКазы, центрифугировали на 4000 об./мин. в течение 5 минут и осаждали путем центрифугирования на 14000 об./мин. в течение 10 минут в присутствии 0,5 объема 7,5 М ацетата аммония и 0,54 объема изопропанола. После удаления супернатанта осадок промывали 500 мкл 70 мас. % этанола и оставляли сохнуть перед ресуспендированием в 100 мкл ТЕ-буфера.

4.2 Расщепление рестрикционными ферментами

Концентрацию ДНК определяли количественно с использованием спектрофотометра или флуорометра (с применением 1 × TNE-буфера (TNE-буфер: 0,01 М Tris, 0,1 М NaCl, 0,001 М EDTA, рН 7,4) и красителя Хехст (Hoechst 33258 от компании Hoechst AG)).

В реакционной системе, объемом 100 мкл, на каждое расщепление применяли 5 мкг ДНК. Геномную ДНК расщепляли соответственно рестрикционным ферментом EcoR V и Hind III с применением части последовательностей Cry1Ab и EPSPS в Т-ДНК в качестве зондов. В случае каждого фермента реакционные смеси для расщепления инкубировали в течение ночи при соответствующей температуре. Образцы крутили в Speed Vac (Thermo Scientific) до уменьшения их объемов до 30 мкл.

4.3 Гель-электрофорез

Краситель для загрузки бромфеноловый синий добавляли к каждому образцу из примера 4.2 и каждый образец загружали на 0,7% агарозный гель, содержащий бромид этидия. Смесь разделяли с помощью электрофореза с применением ТВЕ-буфера для электрофореза (89 мМ Tris-бората, 2 мМ EDTA, рН 8,3). Гель гнали при напряжении 20 В в течение ночи.

Гель промывали в 0,25 М HCl в течение 15 минут для депуринирования ДНК, а затем промывали водой. Саузерн-блоттинг ставили как описано далее. В лоток помещали 20 листов толстой сухой фильтровальной бумаги, а сверху помещали 4 листа тонкой сухой фильтровальной бумаги. Один лист тонкой фильтровальной бумаги предварительно смачивали в 0,4 М NaOH и помещали поверх стопки бумаги с последующим размещением листа нейлоновой блоттинг-мембраны N+ (Hybond-N +, Amersham Pharmacia Biotech, №RPN303B), которую также предварительно смачивали в 0,4 М NaOH. Поверх размещали гель, причем между гелем и мембраной не должны были оставаться пузырьки воздуха. На верхнюю часть геля помещали три дополнительных листа предварительно смоченной фильтровальной бумаги и лоток для буфера заполняли 0,4 М NaOH. Полученный гелевый блок соединяли с лотком для буфера с помощью фитиля, предварительно смоченного 0,4 М NaOH, и начинали перенос ДНК на мембрану. Перенос ДНК занимал примерно 4 часа при комнатной температуре. После переноса блоттинг-мембрану промывали в 2 × SSC в течение 10 секунд и ДНК связывали с мембраной посредством УФ-сшивания.

4.4 Гибридизация

Подходящую последовательность ДНК амплифицировали с помощью ПЦР для получения зонда. ДНК-зонды представляли собой SEQ ID NO: 24 и SEQ ID NO: 25 или были частично гомологичны или комплементарны вышеупомянутым последовательностям. 25 нг ДНК-зонда кипятили в 45 мкл ТЕ-буфера в течение 5 минут, помещали на лед на 7 минут, а затем переносили в пробирку Rediprime II (Amersham Phannacia Biotech, №RPN1633). После добавления 5 мкл 32Р-меченного dCTP в пробирку Rediprime зонд инкубировали при 37°С в течение 15 минут. Согласно инструкциям производителя, зонд очищали центрифугированием в микроцентрифужной колонке G-50 (Amersham Pharmacia Biotech, №27-20-5330-01) для удаления невключенных dNTP. Активность зонда измеряли с помощью сцинтилляционного счетчика.

Блоттинг-мембрану предварительно гибридизировали путем смачивания посредством 20 мл предварительно нагретого раствора для предгибридизации Черча (500 мМ Na3PO4, 1 мМ EDTA, 7% SDS, 1% BSA) при 65°C в течение 30 минут. Меченый зонд кипятили в течение 5 минут и помещали на лед на 10 минут. Соответствующее количество зонда (1 миллион шт. на 1 мл буфера для предгибридизации) добавляли в буфер для предгибридизации и проводили гибридизацию при 65°С в течение ночи. На следующий день буфер для гибридизации отбрасывали, а мембрану промывали посредством 20 мл промывочного раствора Черча 1 (40 мМ Na3PO4, 1 мМ EDTA, 5% SDS, 0,5% BSA) и промывали в 150 мл промывочного раствора Черча 1 при 65°С в течение 20 минут. Этот процесс повторяли дважды с промывочным раствором Черча 2 (40 мМ Na3PO4, 1 мМ EDTA, 1% SDS). Мембрану экспонировали на люминофорный экран или рентгеновскую пленку (4Х-пленку: модель ХВТ, компания CarestreamHealth) для детектирования положения, в котором связался зонд.

Каждый саузерн-блоттинг включал три контрольных образца: (1) ДНК от отрицательного (несвязавшегося) сегреганта, которую также использовали для выявления любых эндогенных последовательностей кукурузы, которые могли гибридизироваться с элемент-специфичным зондом; (2) ДНК от отрицательного сегреганта, в которую была введена DBN10124, выщепляемая посредством Hind III, в количестве, эквивалентном однокопийному количеству, исходя из длины зонда, с тем чтобы продемонстрировать чувствительность эксперимента при детектировании одной копии гена в геноме кукурузы; и (3) плазмиду DBN10124, выщепляемую посредством Hind III, в количестве, эквивалентном однокопийному количеству, исходя из длины зонда, которую применяли в качестве положительного контроля для гибридизации и для демонстрации чувствительности эксперимента.

Данные по гибридизации предоставляли убедительные доказательства в поддержку результатов ПЦР-анализа TaqMan™, а именно, что растение кукурузы DBN9936 содержало гены Cry1Ab и EPSPS в одной копии. При применении зонда Cry1Ab расщепления соответственно ферментами EcoR V и Hind III давали отдельные бэнды размером приблизительно 10 т.о. и 9 т.о.; а при применении зонда EPSPS расщепления соответственно ферментами EcoR V и Hind III давали отдельные бэнды размером приблизительно 8 т.о. и 15 т.о. Это свидетельствовало о том, что Cry1Ab и EPSPS соответственно присутствовали у полученного путем трансформации объекта кукурузы DBN9936 в одной копии.

Пример 5

Детекция устойчивости к насекомым у объекта кукурузы DBN9936

5.1 Биоанализ

Два вида растения, трансгенный объект кукурузы DBN9936 и растение кукурузы дикого типа, тестировали с применением Ostrinia furnacalis (АСВ), Conogethes punctiferalis (YPM), Athetis lepigone (LPG), Sesamia inferens (PSB), Mythimna separata (OAW), Spodoptera litura (TCW), Chilo suppressalis (SSB), Helicoverpa armigera (CBW) и Spodoptera exigua (BAW) посредством описанных далее биоанализов.

Свежие листья (периода V3-V4) от растений двух типов, трансгенного объекта кукурузы DBN9936 и растения кукурузы дикого типа (нетрансгенного, NGM) соответственно подготавливали, промывали стерильной водой и марлей удаляли с них воду. Затем, путем удаления жилок, листья кукурузы разрезали на длинные полоски размером приблизительно 1 см × 3 см. 1-3 кусочка листа в виде длинной полоски (количество листа зависело от потребления листа насекомым) помещали на фильтровальную бумагу, смоченную дистиллированной водой, на дне круглых пластиковых чашек для культивирования. 10 свежевылупившихся личинок путем искусственного скармливания помещали в каждую на каждую чашку для культивирования. Чашку для культивирования накрывали и выдерживали в течение 3 дней в условиях, которые включали температуру 26-28°С, относительную влажность 70%-80% и фотопериод (день/ночь) 16:8, перед получением статистического результата. Была статистически проанализирована смертность Ostrinia furnacalis, и был выявлен уровень устойчивости по скорректированной смертности, причем скорректированная смертность (%)=(1 - количество выживших/плотность личинок - смертность контроля дикого типа) / (1 - смертность контроля дикого типа) × 100%. Для других насекомых были статистически проанализированы три показателя: скорость развития личинок, их смертность и степень повреждения листа, с получением общей оценки признака устойчивости (полная оценка: 300 баллов). Общая оценка признака устойчивости = 100 × скорректированная смертность + [100 × смертность + 90 × (количество свежевылупившихся насекомых/плотность личинок) + 60 × (количество свежевылупившихся насекомых - количество насекомых отрицательного контроля/плотность личинок) + 10 × (количество насекомых отрицательного контроля/плотность личинок)] + 100 × (1 - степень повреждения листьев), где плотность личинок обозначает количество инокулированных личинок, т.е. 10 личинок в каждой чашке; скорость развития личинок отражалась формулой общей оценки признака устойчивости; а степень повреждения листьев обозначает долю потребленной насекомыми площади от общей площади листа. Как в случае трансгенного объекта кукурузы DBN9936, так и в случае растения кукурузы дикого типа (нетрансгенного, NGM) тестировали пять растений, и для каждого образца было сделано шесть повторностей. Результаты показаны в таблицах 6 и 7.

Из результатов видно, что трансгенный объект кукурузы DBN9936 обладал хорошей устойчивостью к Ostrinia furnacalis, Conogethes punctiferalis, Athetis lepigone, Sesamia inferens, Mythimna separata, Spodoptera litura, Chilo suppressalis, Helicoverpa armigera и Spodoptera exigua, и у трансгенного объекта кукурузы DBN9936 наблюдали значимо более высокую смертность тестируемых насекомых и общую оценку признака устойчивости, чем у растения кукурузы дикого типа.

5.2 Результат испытаний в полевых условиях

Семена растений двух типов: трансгенного объекта кукурузы DBN9936 и растения кукурузы дикого типа (нетрансгенного, NGM) были схематически распределены на два типа обработки. Каждый тип обработки следовал схеме рандомизированных блоков с четырьмя повторностями. Участок имел площадь 30 м2 (5 м × 6 м), расстояние между рядами 60 см и расстояние между растениями 25 см. Растения возделывали и обрабатывали традиционным образом, избегая опрыскивания инсектицидами на протяжении всего периода выращивания. Между участками проведения эксперимента был установлен двухметровый интервал для различных инокуляций насекомых во избежание распространения насекомых на различные участки.

(1) Ostrinia furnacalis

Искусственную инокуляцию проводили дважды: на стадии мутовки (стадия образования малого расширения на конце, растение кукурузы выращивали до стадии развертывания 6-8 листьев) и на стадии выметывания пестичных столбиков у кукурузы. В каждом участке искусственной инокуляции подвергали не менее 40 растений. Каждое растение кукурузы подвергали инокуляции приблизительно 60 свежевылупившимися личинками путем искусственного скармливания в области сердцевины его листа/рылец. Через 3 дня после инокуляции производили вторую инокуляцию с той же плотностью личинок, как и в случае первой инокуляции. На 14-21 день после инокуляции поочередно исследовали степень повреждения кукурузы. Исследование обычно проводили через 14 дней после инокуляции. Если уровень повреждения материала отрицательного контроля (NGM) достигал восприимчивости или высокой восприимчивости (см. таблицы 8 и 9), его считали достоверным. Если уровень повреждения не достигал восприимчивости или высокой восприимчивости, исследование можно было соответствующим образом отложить; однако, если он все еще не достигал соответствующего уровня через 21 день, эту инокуляцию считали недостоверной. После инокуляции на стадии мутовки исследовали повреждения верхних листьев растений кукурузы, причиненные поеданием Ostrinia furnacalis. После инокуляции на стадии выметывания пестичных столбиков исследовали степень повреждения початков и растений. Затем для каждого типа обработки были случайно выбраны 15-20 растений на линию.

Стадия мутовки: уровень поедания листьев насекомым вида Ostrinia furnacalis поочередно регистрировали согласно описанию в таблице 8. Рассчитывали среднюю степень повреждения (уровень поедания листьев) насекомым Ostrinia furnacalis относительно каждого обработанного листа. Средний уровень поедания листьев = ∑ (уровень поедания листьев × количество растений с таким уровнем) / общее количество исследованных растений. Уровень устойчивости для каждой обработки к Ostrinia furnacalis классифицировали в соответствии со средним уровнем поедания листьев, как показано в таблице 9. Результат устойчивости к Ostrinia furnacalis у трансгенного объекта кукурузы DBN9936 на стадии мутовки показан в таблице 12.

Стадия выметывания пестичных столбиков: по степени повреждения початка, количеству червоточин, длине тоннеля в червоточине (см) и личиночной стадии и количества выживших личинок в каждом участке рассчитывали средний уровень повреждения от Ostrinia furnacalis у початков кукурузы на стадии выбрасывания колосков, и этот критерий приведен в таблице 10. Уровень устойчивости кукурузы на стадии початка к насекомым Ostrinia furnacalis определяли согласно критерию, приведенному в таблице 11. Результат устойчивости к Ostrinia furnacalis у трансгенного объекта кукурузы DBN9936 на стадии выметывания пестичных столбиков показан в таблице 13.

Из результатов видно, что трансгенный объект кукурузы DBN9936, как на стадии мутовки, так и на стадии выметывания пестичных столбиков, обладал хорошей устойчивостью к Ostrinia furnacalis. На стадии мутовки у трансгенного объекта кукурузы DBN9936 наблюдали значимо более низкое среднее значение уровня поедания листьев, чем у растения кукурузы дикого типа. На стадии выметывания пестичных столбиков у трансгенного объекта кукурузы DBN9936 наблюдали значимо более низкую степень повреждения початков, значимо более низкое количество выживших личинок, значимо более низкую длину туннеля и значимо более низкий уровень повреждения початков, чем у растения кукурузы дикого типа. Результат испытаний в полевых условиях у трансгенного объекта кукурузы DBN9936, инокулированного личинками Ostrinia furnacalis, на стадии мутовки и на стадии выметывания пестичных столбиков показан на фиг. 3.

(2) Mythimna separata

Эксперимент проводили с использованием практически такой же схемы и такого же способа, которые были описаны выше для оценки устойчивости к Ostrinia furnacalis, за исключением того, что искусственную инокуляцию проводили дважды только на стадии мутовки (растений кукурузы, развившихся до стадии развертывания 4-6 листьев). Сердцевину листа каждого растения кукурузы подвергали инокуляции приблизительно 20 личинками возрастом 2-й личиночной стадии путем искусственного скармливания. Через 3 дня после инокуляции производили вторую инокуляцию с той же плотностью личинок, как и в случае первой инокуляции. Через 14 дней после инокуляции исследовали степень повреждения от Mythimna separata на листьях кукурузы. По степени повреждения от Mythimna separata на листьях кукурузы рассчитывали среднее значение уровня повреждения (уровень поедания листьев) Mythimna separata на листе кукурузы для каждого участка, и критерий показан в таблице 14. Уровень устойчивости кукурузы к Mythimna separata определяли согласно критерию, приведенному в таблице 15. Результат устойчивости к Mythimna separata у трансгенного объекта кукурузы DBN9936 на стадии мутовки показан в таблице 16.

Из результатов видно, что трансгенный объект кукурузы DBN9936 обладал хорошим уровнем устойчивости к Mythimna separata и обладал значимо более низкой долей борозд и уровнем поедания листьев, чем растение кукурузы дикого типа. Результат испытаний в полевых условиях у трансгенного объекта кукурузы DBN9936, инокулированного личинками Mythimna separata, показан на фиг. 4.

(3) Helicoverpa armigera

Эксперимент проводили с использованием практически такой же схемы и такого же способа, которые были описаны выше для оценки устойчивости к Ostrinia furnacalis, за исключением того, что искусственную инокуляцию проводили дважды только на стадии выметывания пестичных столбиков. Рыльца каждого растения кукурузы подвергали инокуляции приблизительно 20 свежевылупившимися личинками путем искусственного скармливания. Через 3 дня после инокуляции производили вторую инокуляцию с той же плотностью личинок, как и в случае первой инокуляции. Через 14-21 день после инокуляции поочередно исследовали степень повреждения початков, количество выживших личинок на каждом початке и длину повреждения початков. Исследование обычно проводили через 14 дней после инокуляции. Если уровень повреждения материала отрицательного контроля (NGM) достигал восприимчивости или высокой восприимчивости (см. таблицы 17 и 18), его считали достоверным. Если уровень повреждения не достигал восприимчивости или высокой восприимчивости, исследование можно было соответствующим образом отложить; однако, если он все еще не достигал соответствующего уровня через 21 день, эту инокуляцию считали недостоверной. По степени повреждения початков, количеству выживших личинок и длине повреждения (см) початков в каждом участке рассчитывали средний уровень повреждения от Helicoverpa armigera у початков кукурузы на стадии выбрасывания колосков, и этот критерий приведен в таблице 17. Уровень устойчивости кукурузы на стадии початка к насекомым Helicoverpa armigera определяли согласно стандарту, приведенному в таблице 18. Результат устойчивости к Helicoverpa armigera у трансгенного объекта кукурузы DBN9936 на стадии выметывания пестичных столбиков показан в таблице 19.

Из результатов видно, что трансгенный объект кукурузы DBN9936 обладал хорошим уровнем устойчивости к Helicoverpa armigera и имел значимо более низкую степень повреждения початков, значимо более низкое количество выживших личинок, значимо более низкую длину повреждения початков и значимо более низкий уровень повреждения початков, чем у растения кукурузы дикого типа. Результат испытаний в полевых условиях у трансгенного объекта кукурузы DBN9936, инокулированного личинками Helicoverpa armigera, показан на фиг. 5.

(4) Conogethes punctiferalis

Эксперимент проводили с использованием практически такой же схемы и такого же способа, которые были описаны выше для оценки устойчивости к Ostrinia furnacalis, за исключением того, что кукуруза подвергалась лишь естественному заражению в зоне с высокой естественной встречаемостью Conogethes punctiferalis (условия получения естественного повреждения от насекомого). В период 14-21 день после первого повреждения насекомым и повреждением большей части NGM личинками на последних стадиях развития, то есть 4-5 стадии, поочередно исследовали степень повреждения (долю растений кукурузы, съеденную насекомыми, от общего числа изученных растений) от Conogethes punctiferalis на растениях кукурузы. Результат устойчивости к Conogethes punctiferalis у трансгенного объекта кукурузы DBN9936 показан в таблице 20.

Из результатов видно, что в условиях естественной встречаемости Conogethes punctiferali, по сравнению с растением кукурузы дикого типа, трансгенный объект кукурузы DBN9936 имел значимо сниженную степень повреждения от Conogethes punctiferalis, что свидетельствовало о том, что трансгенный объект кукурузы DBN9936 обладает хорошей устойчивостью к Conogethes punctiferalis. Результат испытаний в полевых условиях трансгенного объекта кукурузы DBN9936 в условиях естественной встречаемости Conogethes punctiferalis показан на фиг. 6.

(5) Spodoptera exigua

Эксперимент проводили с использованием практически такой же схемы и такого же способа, которые были описаны выше для оценки устойчивости к Conogethes punctiferalis, за исключением того, что в период 10-15 дней после первого повреждения насекомым и повреждением большей части NGM личинками на последних стадиях развития, то есть 4-6 стадии, поочередно исследовали степень повреждения от Spodoptera exigua на растениях кукурузы. Результат устойчивости к Spodoptera exigua у трансгенного объекта кукурузы DBN9936 показан в таблице 21.

Из результатов видно, что в условиях естественной встречаемости Spodoptera exigua, по сравнению с растением кукурузы дикого типа, трансгенный объект кукурузы DBN9936 имел значимо сниженную степень повреждения от Spodoptera exigua, что свидетельствовало о том, что трансгенный объект кукурузы DBN9936 обладает хорошей устойчивостью к Spodoptera exigua. Результат испытаний в полевых условиях трансгенного объекта кукурузы DBN9936 в условиях естественной встречаемости Spodoptera exigua показан на фиг. 7.

Особо следует отметить, что в соответствии с раскрытиями, которые описаны в заявках на выдачу китайского патента №201210509817.2, №201210511214.6, №201310576970.1, №201310578129.6 и №201310681139.2, и результатами испытания в полевых условиях в отношении насекомых у трансгенного объекта кукурузы DBN9936 по настоящей заявке и результатами его анализов, трансгенный объект кукурузы DBN9936 по настоящей заявке делает возможной реализацию способа и/или применения в борьбе с вредителями, в частности с Athetis lepigone, Conogethes punctiferalis, Spodoptera litura, Sesamia inferens и Mythimna separata; то есть любое трансгенное растение кукурузы, экспрессирующее белок Cry1Ab, может сделать возможным реализацию способа и/или применения в борьбе с Athetis lepigone, Conogethes punctiferalis, Spodoptera litura, Sesamia inferens и/или Mythimna separata.

Пример 6

Детекция толерантности к гербициду у объекта кукурузы DBN9936

Для внесения опрыскиванием в ходе эксперимента был выбран гербицид раундап (41% водный раствор изопропиламмония глифосата, Monsanto Company). Использовали схему рандомизированных блоков с тремя повторностями. Участок имел площадь 15 м2 (5 м × 3 м), расстояние между рядами 60 см и расстояние между растениями 25 см. Растения возделывали и обрабатывали традиционным образом, а между участками задавали однометровый интервал. Трансгенный объект кукурузы DBN9936 подвергали следующим двум обработкам: 1) без внесения опрыскиванием; и 2) внесение опрыскиванием гербицида раундап на стадии развития листьев V3 дозой 1680 г а.и./га (а.и./га означает «эквивалента активного ингредиента на гектар») с последующим внесением опрыскиванием гербицида раундап на стадии развития листьев V8 такой же дозой. Параллельный контрольный эксперимент проводили на растении кукурузы дикого типа (нетрансгенного, NGM). Следует отметить, что гербициды на основе глифосата в различных концентрациях и составах также применимы к приведенному далее выводу, если они были преобразованы в эквивалентное количество глифосат-кислоты.

Исследование симптома фитотоксичности проводили соответственно через 1 неделю и через 2 недели после внесения и определяли урожаи с участков в момент сбора урожая. Классификация симптомов фитотоксичности показана в таблице 22. Толерантность к гербициду у полученного путем трансформации объекта оценивали с помощью степени повреждения, наносимого гербицидом, в качестве оценочного показателя. В частности, степень повреждения от гербицида (%) = ∑ (количество растений с одинаковым уровнем повреждения × номер уровня) / (общее количестве растений × наивысший уровень), где степень повреждения гербицидом обозначает степень повреждения глифосатом, которая была определена по результатам исследования фитотоксичности через две недели после обработки глифосатом. Урожай кукурузы для каждого участка получали путем взвешивания общего урожая (по массе) зерен кукурузы от 3 линий в середине каждого участка. Различие в урожаях для различных обработок измеряли в виде процентной доли урожая. Процентная доля урожая (%) = урожай с внесением опрыскиванием / урожай без внесения опрыскиванием. Результаты толерантности к гербициду у трансгенного объекта кукурузы DBN9936 и урожай кукурузы показаны в таблице 23.

Из результатов видно, что в отношении степени повреждения гербицидом (глифосатом): 1) степень повреждения трансгенного объекта кукурузы DBN9936, обработанного гербицидом глифосат (1680 г а. и./га), была фактически равна нулю. Таким образом, трансгенный объект кукурузы DBN9936 обладает хорошей толерантностью к гербициду глифосат.

Что касается урожая, существенное различие в урожае трансгенного объекта кукурузы DBN9936 между группой обработки без внесения опрыскиванием и группой обработки с внесением опрыскиванием в количестве 1680 г а. и./га глифосата отсутствовало. После опрыскивания глифосатом трансгенный объект кукурузы DBN9936, вместо этого, имел легкое увеличение урожая. Таким образом, из этого дополнительно было видно, что трансгенный объект кукурузы DBN9936 обладает хорошей толерантностью к гербициду глифосат.

Пример 7

Из трансгенного объекта кукурузы DBN9936 могут быть получены сельскохозяйственные продукты или товары. Если в сельскохозяйственных продуктах или товарах была детектирована достаточная экспрессия, то можно ожидать, что они содержат нуклеотидные последовательности, которые позволяют идентифицировать наличие в сельскохозяйственных продуктах или товарах материала от трансгенного объекта кукурузы DBN9936. В число сельскохозяйственных продуктов или товаров входят без ограничения кукурузное масло, кукурузная мука грубого помола, кукурузная мука, кукурузный глютен, кукурузные лепешки, кукурузный крахмал и любые другие пищевые продукты, предназначенные для употребления в качестве источника пищи животным, или, в ином случае, любые другие материалы, предназначенные в качестве наполнителя или в качестве компонента в косметической композиции для косметического применения и т.д. Способы и/или наборы для детектирования нуклеиновой кислоты, в основе которых лежат зонды или праймеры, могут быть разработаны для детектирования в биологическом образце нуклеотидных последовательностей от трансгенного объекта кукурузы DBN9936, таких как SEQ ID NO: 1 или SEQ ID NO: 2, с тем чтобы идентифицировать наличие трансгенного объекта кукурузы DBN9936, причем последовательность зонда или последовательность праймера выбраны из последовательностей, которые представлены в SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 и SEQ ID NO: 5.

В заключение необходимо отметить, что трансгенный объект кукурузы DBN9936 по настоящему изобретению обладает хорошей устойчивостью к насекомым отряда Lepidoptera и высокой толерантностью к гербициду глифосат, при этом оказывается незначительное влияние на урожай, а с помощью способов детектирования по настоящему изобретению можно точно и быстро выявить, содержит ли биологический образец молекулу ДНК от трансгенного объекта кукурузы DBN9936.

Семена, соответствующие трансгенному объекту кукурузы DBN9936, были депонированы в Китайском главном центре коллекций микробиологических культур Китайского административного комитета по коллекциям культур микроорганизмов (General Microbiological Center of China Microbiological Culture Collection Management Committee, сокращенно - CGMCC, адрес: No.3, No. 1 Precinct, Beichen West Road, Chaoyang District. Beijing, Institute of Microbiology, Academy of Sciences of China, почтовый индекс 100101) 24 декабря 2014 года, которые по классификационным и номенклатурным данным являются кукурузой (Zea mays) и имеют регистрационный номер CGMCC №10219. Депонирование будет храниться в депозитарии в течение 30 лет.

Наконец, следует отметить, что приведенные выше примеры использованы лишь с целью иллюстрации технических решений по настоящему изобретению, а не для ограничения настоящего изобретения. Несмотря на то, что настоящее изобретение подробно описано со ссылкой на предпочтительные примеры, специалисты в настоящей области техники должны понимать, что технические решения по настоящему изобретению можно модифицировать или эквивалентным образом заменить без отступления от идеи и объема технических решений по настоящему изобретению.

1. Молекула нуклеиновой кислоты для детектирования наличия ДНК трансгенного объекта кукурузы DBN9936 в образце, характеризующаяся тем, что молекула нуклеиновой кислоты содержит SEQ ID NO: 1 или комплементарную ей последовательность и/или SEQ ID NO: 2 или комплементарную ей последовательность, причем трансгенный объект кукурузы DBN9936 содержит SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или SEQ ID NO: 5.

2. Молекула нуклеиновой кислоты по п. 1, характеризующаяся тем, что молекула нуклеиновой кислоты содержит SEQ ID NO: 3 или комплементарную ей последовательность и/или SEQ ID NO: 4 или комплементарную ей последовательность.

3. Молекула нуклеиновой кислоты по п. 2, характеризующаяся тем, что молекула нуклеиновой кислоты содержит SEQ ID NO: 5 или комплементарную ей последовательность.

4. Способ детектирования наличия ДНК трансгенного объекта кукурузы DBN9936 в образце, предусматривающий:

- приведение в контакт образца по меньшей мере с двумя праймерами в реакции амплификации нуклеиновой кислоты;

- осуществление реакции амплификации нуклеиновой кислоты; и

- детектирование наличия ампликона, причем наличие ампликона свидетельствует о наличии ДНК трансгенного объекта кукурузы DBN9936 в образце;

причем ампликон содержит - SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарную ей последовательность,

причем трансгенный объект кукурузы DBN9936 содержит SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или SEQ ID NO: 5.

5. Способ по п. 4, отличающийся тем, что праймер содержит по меньшей мере одну последовательность нуклеиновой кислоты по меньшей мере из 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 или 22 последовательных нуклеотидов, выбранных из нуклеотидов, происходящих от молекулы нуклеиновой кислоты по пп. 1-3;

альтернативно, праймер включает первый праймер и второй праймер, причем первый праймер выбран из SEQ ID NO: 8 и SEQ ID NO: 10, а второй праймер выбран из SEQ ID NO: 9 и SEQ ID NO: 11.

6. Способ детектирования наличия ДНК объекта кукурузы DBN9936 в образце, отличающийся тем, что предусматривает:

- приведение в контакт образца с зондом, причем зонд содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарную ей последовательность;

- гибридизацию образца с зондом в жестких условиях гибридизации; и

- детектирование гибридизации зонда с образцом, причем гибридизация зонда с образцом свидетельствует о наличии ДНК трансгенного объекта кукурузы DBN9936 в образце,

причем трансгенный объект кукурузы DBN9936 содержит SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или SEQ ID NO: 5.

7. Способ по п. 6, отличающийся тем, что по меньшей мере один зонд помечен по меньшей мере одним флуорофором.

8. Способ детектирования наличия ДНК объекта кукурузы DBN9936 в образце, отличающийся тем, что предусматривает:

- приведение в контакт образца с маркерной молекулой нуклеиновой кислоты, причем маркерная молекула нуклеиновой кислоты содержит SEQ ID NO: 1 или комплементарную ей последовательность, SEQ ID NO: 2 или комплементарную ей последовательность, SEQ ID NO: 6 или комплементарную ей последовательность или SEQ ID NO: 7 или комплементарную ей последовательность;

- гибридизацию образца с маркерной молекулой нуклеиновой кислоты в жестких условиях гибридизации;

- детектирование гибридизации образца с маркерной молекулой нуклеиновой кислоты, причем гибридизация образца с маркерной молекулой нуклеиновой кислоты свидетельствует о наличии ДНК трансгенного объекта кукурузы DBN9936 в образце;

причем трансгенный объект кукурузы DBN9936 содержит SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или SEQ ID NO: 5

9. Способ по п. 8, дополнительно предусматривающий осуществления аналитического скрещивания с использованием маркера для установления генетической связи устойчивости к насекомым и/или толерантности к гербициду с маркерной молекулой нуклеиновой кислоты.

10. Набор для детектирования ДНК, отличающийся содержанием по меньшей мере одной молекулы ДНК, причем молекула ДНК содержит последовательности, которые гомологичны или комплементарны SEQ ID NO: 1, последовательности, которые гомологичны или комплементарны SEQ ID NO: 2, последовательности, которые гомологичны или комплементарны SEQ ID NO: 6, или последовательности, которые гомологичны или комплементарны SEQ ID NO: 7, и молекула ДНК может выполнять роль ДНК-праймера или зонда, специфичного для трансгенного объекта кукурузы DBN9936 или его потомства, причем трансгенный объект кукурузы DBN9936 содержит SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или SEQ ID NO: 5.

11. Клетка растения для обеспечения устойчивой к насекомым и толерантной к гербициду глифосат клетки растения, отличающаяся тем, что содержит последовательность нуклеиновой кислоты SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5.

12. Часть растения для обеспечения устойчивой к насекомым и толерантной к гербициду глифосат части растения, отличающаяся тем, что содержит последовательность нуклеиновой кислоты SEQ ID NO: 1, последовательность нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5.

13. Способ защиты растения кукурузы от заражение насекомыми, отличающийся тем, что предусматривает внесение по меньшей мере одной клетки или части трансгенного растения кукурузы по п. 11 в рацион целевого насекомого, а употребление в пищу клетки или части трансгенного растения кукурузы подавляет дальнейшее кормление целевого насекомого на указанном трансгенном растении кукурузы.

14. Способ защиты растения кукурузы от повреждения, вызываемого гербицидом, отличающийся тем, что предусматривает внесение эффективного количества гербицида глифосат в поле по меньшей мере с одним трансгенным растением кукурузы, причем трансгенное растение кукурузы содержит в своем геноме SEQ ID NO: 1, нуклеотиды 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно, или трансгенный объект кукурузы содержит в своем геноме SEQ ID NO: 5, и трансгенное растение кукурузы обладает толерантностью к гербициду глифосат.

15. Способ борьбы с сорняками в поле с растением кукурузы, отличающийся тем, что предусматривает внесение эффективного количества гербицида глифосат в поле по меньшей мере одного трансгенного растения кукурузы, причем трансгенное растение кукурузы содержит в своем геноме SEQ ID NO: 1, нуклеотиды 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно, или трансгенный объект кукурузы содержит в своем геноме SEQ ID NO: 5, и трансгенное растение кукурузы обладает толерантностью к гербициду глифосат.

16. Способ культивирования устойчивого к насекомым и толерантного к гербициду глифосат растения кукурузы, отличающийся тем, что предусматривает:

- внесение последовательности нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 в геном растения кукурузы;

- высевание по меньшей мере одного семени кукурузы растения кукурузы, причем семя кукурузы содержит в своем геноме SEQ ID NO: 1, нуклеотиды 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно, или последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5;

- выращивание семени кукурузы в растение кукурузы; и

- опрыскивание растения кукурузы эффективным количеством гербицида глифосат, а затем сбор урожая от растения с уменьшенным повреждением растения по сравнению с другими растениями, которые не содержат SEQ ID NO: 1, нуклеотиды 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно, или последовательность нуклеиновой кислоты, которая изложена в SEQ ID NO: 5, и такое растение с уменьшенным повреждением растения также является устойчивым к повреждению от поедания насекомым.

17. Способ получения трансгенного растения кукурузы, отличающийся тем, что предусматривает введение последовательности нуклеиновой кислоты нуклеотидов 910-8049 последовательности SEQ ID NO: 5 в геном растения кукурузы, и таким образом, что указанный геном растения кукурузы содержит последовательность нуклеиновой кислоты конкретного участка, причем указанная последовательность нуклеиновой кислоты конкретного участка содержит SEQ ID NO: 1, нуклеотиды 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно, или указанная последовательность нуклеиновой кислоты конкретного участка содержит SEQ ID NO: 5; причем указанное трансгенное растение кукурузы является устойчивым к насекомым и толерантным к гербициду глифосат.

18. Способ по п. 17, отличающийся тем, что предусматривает введение последовательности нуклеиновой кислоты, которая изложена в SEQ ID NO: 5, в геном растения кукурузы.

19. Способ по п. 18, отличающийся тем, что предусматривает:

- половое скрещивание первого устойчивого к насекомым и толерантного к гербициду глифосат родительского растения кукурузы, представляющего собой трансгенный объект кукурузы DBN9936, со вторым родительским растением кукурузы, у которого отсутствует признак устойчивости к насекомым и толерантности к гербициду глифосат, тем самым получая множество растений-потомков;

- обработку растений-потомков гербицидом глифосат; и

- отбор толерантных к глифосату растений-потомков, которые также устойчивы к повреждению от поедания насекомым;

причем трансгенный объект кукурузы DBN9936 содержит в своем геноме SEQ ID NO: 5.

20. Сельскохозяйственная композиция, полученная из трансгенного объекта кукурузы DBN9936, причем композиция представляет собой кукурузную муку грубого помола, кукурузную муку, кукурузное масло, кукурузные рыльца или кукурузный крахмал, где трансгенный объект кукурузы DBN9936 характеризуется тем, что содержит SEQ ID NO: 1, нуклеотиды 910-8049 последовательности SEQ ID NO: 5 и SEQ ID NO: 2 последовательно; или SEQ ID NO: 5.

21. Сельскохозяйственный продукт, содержащий полинуклеотиды, изложенные в SEQ ID NO: 1 или SEQ ID NO: 2, отличающийся тем, что сельскохозяйственный продукт представляет собой кукурузную муку грубого помола, кукурузную муку, кукурузное масло, кукурузный крахмал, кукурузный глютен или кукурузные лепешки.

22. Сельскохозяйственный товар, содержащий полинуклеотиды, изложенные в SEQ ID NO: 1 или SEQ ID NO: 2, отличающийся тем, что сельскохозяйственный товар представляет собой кукурузную муку грубого помола, кукурузную муку, кукурузное масло, кукурузный крахмал, кукурузный глютен, кукурузные лепешки, косметическое средство или наполнитель.



 

Похожие патенты:
Изобретение относится к области медицины, в частности к онкологии. Предложен способ комбинированного лечения немелкоклеточного рака легкого (НМРЛ) IB - III стадии.

Изобретение относится к областям биотехнологии, молекулярной биологии и медицинской микробиологии. Описан набор олигонуклеотидных праймеров для реакции петлевой изотермической амплификации (LAMP), который позволяет амплифицировать специфические для бактерий вида Francisella tularensis фрагменты ДНК из целевого гена, имеющего нуклеотидную последовательность SEQ ID №1.

Изобретение относится к областям биотехнологии, молекулярной биологии и медицинской микробиологии. Описан набор олигонуклеотидных праймеров для реакции петлевой изотермической амплификации (LAMP), который позволяет амплифицировать специфические для бактерий вида Francisella tularensis фрагменты ДНК из целевого гена, имеющего нуклеотидную последовательность SEQ ID NO: 1.
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для диагностики контроля бронхиальной астмы (БА) у детей с атопическим дерматитом. Проводят обследование ребенка, определение его возраста и факторов наследственности.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен способ генотипирования одного или нескольких мультиаллельных маркеров, включающий получение сигналов одного или нескольких мультиаллельных маркеров в одном или нескольких образцах, с последующей кластеризацией сигналов для каждой пары аллелей, регистрацию сигналов одного или нескольких альтернативных аллелей для расчета фонового сигнала для одного или нескольких аллелей, с получением множества фоновых сигналов, каждый из которых представляет соответствующий аллель, присваивание исходного значения проявления генотипа каждого образца для каждой пары аллелей на основании сигналов и фоновых сигналов, расчет многомерного нормального распределения для каждого кластера, для каждого многомерного нормального распределения каждого кластера, расчет логарифмического правдоподобия принадлежности каждого образца, на основании логарифмического правдоподобия принадлежности, расчет, для каждого образца, вероятности принадлежности к каждому кластеру, присваивание конечного значения проявления генотипа каждому образцу на основании вероятности принадлежности.
Изобретение относится к области медицины и предназначено для диагностики активности сочетанной инфекции у детей с острыми респираторными инфекциями. У детей с идиопатической лейкопенией и фебрильными судорогами в крови определяют наличие, активность и серотип вируса герпеса 6 типа, его количественные характеристики, выявляют иммуноглобулины IgM, IgG класса, определяют авидность иммуноглобулинов IgG класса.

Изобретение относится к области медицинской микробиологии и предназначено для идентификации штаммов Yersinia pestis средневекового биовара с последующей дифференциацией по филогенетической принадлежности методом ПЦР в режиме реального времени.

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для скрининга рака молочной железы и предрасположенности к нему. Проводят маммографию и УЗИ.

Изобретение относится к области биотехнологии. Изобретение представляет собой антибактериальную композицию лечебно-профилактического назначения, которая включает комбинацию стерильных, очищенных от токсинов фильтратов фаголизатов с титром каждого из бактериофагов не ниже 1010 БОЕ/мл по Грациа с неперекрывающимся спектром литической активности в отношении возбудителей сальмонеллезной и эшерихиозной инфекций, способных вызывать массовые болезни птиц, сельскохозяйственных животных и человека.

Изобретение относится к биотехнологии и представляет собой способ количественного определения антител, которые связываются с AAV, in vitro, включающий: (a) получение инфекционных частиц рекомбинантного AAV, содержащих рекомбинантный вектор AAV, причем рекомбинантный вектор AAV содержит репортерный трансген, где репортерный трансген содержит (a) одноцепочечный или самокомплементарный геном, (b) является функционально связанным с одним или более регуляторными элементами экспрессии, и (c) является фланкированным одним или более фланкирующими элементами;(b) получение биологического образца от индивидуума; (c) получение клеток, которые можно инфицировать указанными инфекционными частицами рекомбинантного AAV; (d) приведение в контакт или инкубирования инфекционных частиц рекомбинантного AAV (a) с биологическим образцом (b), получая таким образом, получаемую смесь (M); (e) приведение клеток в контакт (c) с получаемой смесью (M) в условиях, в которых инфекционные частицы рекомбинантного AAV (a) могут инфицировать и экспрессировать репортерный трансген в указанных клетках; (f) измерение экспрессии репортерного трансгена и (g) сравнение указанной экспрессии репортерного трансгена (f) с репортерным трансгеном отрицательного (-) контроля, (i) не содержащего антитела, которые связываются с AAV, и (+) контроля, (ii) содержащего предопределенное количество антител, которые связываются с AAV, с количественным определением, таким образом, антител в биологическом образце, которые связываются с AAV.

Настоящее изобретение относится к области иммунологии. Предложены выделенное антитело к RGMa и его антигенсвязывающий фрагмент.

Изобретение относится к области биохимии, в частности к генетически модифицированной клетке-хозяину млекопитающего, которая содержит первую нуклеиновую кислоту, кодирующую экзогенную фукозидазу, и вторую нуклеиновую кислоту, кодирующую эндогликозидазу, а также способ ее получения.

Изобретение относится к иммунологии. Предложено неконкурентное в отношении нейрегулина (NRG) аллостерическое антитело против человеческого HER3 и его фрагмент, а также кодирующая нуклеиновая кислота, вектор, клетка-хозяин, фармацевтическая композиция и способ лечения рака.

Изобретение относится к области биотехнологии, конкретно к иммуногенным эпитопам URLC10, и может быть использовано в медицине для лечения пациента, страдающего раком.

Изобретение относится к области биотехнологии. Представлена нуклеиновая кислота, кодирующая химерный рецептор, специфично связывающийся с CD19.

Изобретение относится к области биохимии. Описана группа изобретений, включающая гуманизированное моноклональное антитело или его антиген-связывающий фрагмент, которое связывается со специфичностью с антигеном Томсена-Фриденрайха (TF-Ag), конъюгат, связывающийся с раковыми клетками, которые экспрессируют TF-Ag, способ профилактики или лечения рака у индивидуума, при этом рак содержит раковые клетки, экспрессирующие TF-Ag, фармацевтическая композиция для лечения TF+ видов рака, содержащая вышеуказанное антитело или его антиген-связывающий фрагмент в терапевтически эффективном количестве, клетку-хозяин млекопитающего, предназначенную для экспрессии вышеуказанного антитела или его антиген-связывающего фрагмента.

Изобретение относится к эпитопным пептидам, полученным из CDCA1, со способностью индуцировать цитотоксические T-клетки. Настоящее изобретение дополнительно относится к полинуклеотидам, кодирующим пептиды, антигенпрезентирующим клеткам, презентирующим пептиды, и цитотоксическим T-клеткам, нацеленным на пептиды, а также к способам индуцирования антигенпрезентирующих клеток или ЦТЛ.

Изобретение относится к эпитопным пептидам, полученным из KOC1, со способностью индуцировать цитотоксические T-клетки. Настоящее изобретение дополнительно относится к полинуклеотидам, кодирующим пептиды, антигенпрезентирующим клеткам, презентирующим пептиды, и цитотоксическим T-клеткам, нацеленным на пептиды, а также к способам индуцирования антигенпрезентирующих клеток или ЦТЛ.

Изобретение относится к области биотехнологии и может быть использовано в терапии онкологических заболеваний. Описан универсальный вспомогательный плазмидный экспрессионный лентивирусный вектор для получения высоких титров вирусных частиц, содержащих ген Vpx, включающий в качестве базовых элементов, обеспечивающих функционирование вектора, последовательность вирион-ассоциированного белка Vpx, содержащую С-концевой HIV-1 gag/pol мотив и FLAG последовательность и объединенную с последовательностью гена трансактиваторного белка Rev через специфическую последовательность Т2А, обеспечивающую расщепление слитых белков во время процесса трансляции мРНК трансгена; в качестве регуляторных элементов- RSVпромотор/энхансер [rous sarcoma virus) и NES (nuclear export signal)- сигнал экспорта из ядра в цитоплазму.

Изобретение относится к химерному пептиду, который способен снижать уровни глюкозы у субъекта, а также к фармацевтической композиции, содержащей такой пептид и фармацевтически приемлемый носитель.

Изобретение относится к области биотехнологии. Описана композиция для экспрессии полипептида в клетке млекопитающего, содержащая эффективное количество множества липидных наночастиц, содержащих полинуклеотид, кодирующий указанный полипептид.

Изобретение относится к области биохимии, в частности к молекуле нуклеиновой кислоты для детектирования объекта кукурузы DBN9936 с SEQ ID NO: 1. Также раскрыты набор для детектирования, клетка растения и часть растения, содержащие указанную последовательность; сельскохозяйственная композиция, сельскохозяйственный продукт и сельскохозяйственный товар. Раскрыты способы детектирования указанного объекта, способы защиты растения кукурузы, способ борьбы с сорняками, способ культивирования и способ получения трансгенного растения, содержащего указанный объект. Изобретение позволяет получить трансгенное растение кукурузы, устойчивое к гербициду глифосат. 15 н. и 7 з.п. ф-лы, 7 ил., 23 табл., 6 пр.

Наверх