Молекулы, связывающиеся с psl pseudomonas, и пути их применения



Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
Молекулы, связывающиеся с psl pseudomonas, и пути их применения
C07K2317/73 - Пептиды (пептиды в пищевых составах A23, например получение белковых композиций для пищевых составов A23J, препараты для медицинских целей A61K; пептиды, содержащие бета-лактамовые кольца, C07D; циклические дипептиды, не содержащие в молекуле любого другого пептидного звена, кроме образующего их кольцо, например пиперазин-2,5-дионы, C07D; алкалоиды спорыньи циклического пептидного типа C07D519/02; высокомолекулярные соединения, содержащие статистически распределенные аминокислотные единицы в молекулах, т.е. при получении предусматривается не специфическая, а случайная последовательность аминокислотных единиц, гомополиамиды и блоксополиамиды, полученные из аминокислот, C08G 69/00; высокомолекулярные продукты, полученные из протеинов, C08H 1/00; получение

Владельцы патента RU 2708977:

МЕДИММЬЮН ЛИМИТЕД (GB)
МЕДИММЬЮН, ЭлЭлСи (US)

Изобретение относится к выделенному антителу или его антигенсвязывающему фрагменту, которое специфически связывается с Psl Pseudomonas, и фармацевтической композиции, содержащей указанное антитело. Антитело содержит вариабельную область тяжелой цепи (VH) и вариабельную область легкой цепи (VL), которые содержат аминокислотные последовательности VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2 и VLCDR3, выбранные из группы, состоящей из: SEQ ID NO: 17, 18, 19, 20, 21 и 22 (Cam-003), SEQ ID NO: 23, 24, 25, 20, 21 и 22 (Cam-004), SEQ ID NO: 26, 27, 28, 20, 21 и 22 (Cam-005), SEQ ID NO: 29, 30, 31, 32, 33 и 34 (WapR-001), SEQ ID NO: 35, 36, 37, 38, 39 и 40 (WapR-002), SEQ ID NO: 41, 42, 43, 44, 45 и 46 (WapR-003), SEQ ID NO: 47, 48, 49, 50, 51 и 52 (WapR-004), SEQ ID NO: 47, 48 75, 50, 51 и 52 (WapR-004RAD) и SEQ ID NO: 59, 60, 61, 62, 63 и 64 (WapR-016). При этом антитело способствует опсонофагоцитарному уничтожению (OPK) P. aeruginosa и, необязательно, может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам. Фармацевтическая композиция, предназначенная для профилактики или лечения инфекции Pseudomonas, содержит эффективное количество указанного антитела или его фрагмента и носитель. Изобретения могут быть использованы для эффективного предупреждения или лечения инфекции Pseudomonas. 2 н. и 10 з.п. ф-лы, 21 ил., 4 табл., 13 пр.

 

ПРЕДПОСЫЛКИ ИЗОБРЕТЕНИЯ

Область техники

[0001] Настоящее раскрытие относится к молекулам, связывающимся с Psl Pseudomonas, и путям их применения, в частности, при предупреждении и лечении инфекции, вызываемой Pseudomonas. Кроме того, настоящее раскрытие обеспечивает композиции и способы для предупреждения и лечения инфекции, вызываемой Pseudomonas.

Предпосылки настоящего изобретения

[0002] Pseudomonas aeruginosa (P. aeruginosa) представляет собой грамотрицательный условно-патогенный микроорганизм, вызывающий как острые, так и хронические инфекции у ослабленных лиц (Ma et al., Journal of Bacteriology 189(22):8353-8356 (2007)). Отчасти это связано с высокой врожденной устойчивостью бактерии к используемым в клинической практике антибиотикам, а отчасти связано с формированием чрезвычайно устойчивых к антибиотикам биопленок (Drenkard E., Microbes Infect 5: 1213-1219 (2003); Hancock & Speert, Drug Resist Update 3:247-255 (2000)).

[0003] P. aeruginosa является частой причиной внутрибольничных инфекций в западном мире. Это частый возбудитель бактериемии у ожоговых больных и лиц с ослабленным иммунитетом (Lyczak et al, Microbes Infect 2:1051-1060 (2000)). Он также является наиболее распространенной причиной госпитальной пневмонии, вызываемой грамотрицательными микроорганизмами (Craven et al, Semin Respir Infect 11:32-53 (1996)), особенно у пациентов, находящихся на искусственной вентиляции легких, и является наиболее распространенным патогеном в легких лиц с муковисцидозом (Pier et al, ASM News 6:339-347 (1998)). Серьезные инфекции, вызываемые P. aeruginosa, могут стать системными, что в результате приводит к сепсису. Сепсис характеризуется тяжелым системным воспалением, часто приводящим в результате к полиорганной недостаточности и смерти.

[0004] Экзополисахарид Psl Pseudomonas, как сообщается, заякорен на поверхности P. aeruginosa и считается важным в облегчении колонизации тканей хозяина и в создании/поддержании формирования биопленки (Jackson, K.D., et al, J Bacteriol 186, 4466-4475 (2004)). Его структура включает богатый маннозой повторяющийся пентасахарид (Byrd, M.S., et al, Mol Microbiol 73, 622-638 (2009)).

[0005] В связи с увеличением устойчивости ко множеству лекарственных средств в данной области техники остается потребность в разработке новых стратегий для идентификации новых профилактических и терапевтических средств, специфичных в отношении Pseudomonas.

КРАТКОЕ ОПИСАНИЕ ИЗОБРЕТЕНИЯ

[0006] Один вариант осуществления направлен на выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, где связывающая молекула (a) может ингибировать прикрепление Pseudomonas aeruginosa к эпителиальным клеткам, (b) может способствовать OPK P. aeruginosa или (c) может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам и может способствовать OPK P. aeruginosa.

[0007] Также раскрывается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с тем же эпитопом Psl Pseudomonas, что и антитело или его антигенсвязывающий фрагмент, содержащие вариабельную область тяжелой цепи (VH) и вариабельную область легкой цепи (VL) WapR-004, Cam-003, Cam-004 или Cam-005.

[0008] Также раскрывается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR-004, Cam-003, Cam-004 или Cam-005.

[0009] Некоторые варианты осуществления в настоящем раскрытии включают связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, описанные выше, где VH и VL WapR-004 содержат SEQ ID NO: 11 и SEQ ID NO: 12, соответственно, VH и VL Cam-003 содержат SEQ ID NO: 1 и SEQ ID NO: 2, соответственно, VH и VL Cam-004 содержат SEQ ID NO: 3 и SEQ ID NO: 2, соответственно, а VH и VL Cam-005 содержат SEQ ID NO: 4 и SEQ ID NO: 2, соответственно.

[0010] Также раскрывается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с тем же эпитопом Psl Pseudomonas, что и антитело или его антигенсвязывающий фрагмент, содержащие VH- и VL-области WapR-001, WapR-002 или WapR-003.

[0011] Дополнительно раскрывается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR-001, WapR-002 или WapR-003.

[0012] Некоторые варианты осуществления включают связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, описанные выше, где VH и VL WapR-001 содержат SEQ ID NO: 5 и SEQ ID NO: 6, соответственно, VH и VL WapR-002 содержат SEQ ID NO: 7 и SEQ ID NO: 8, соответственно, и VH и VL WapR-003 содержат SEQ ID NO: 9 и SEQ ID NO: 10, соответственно.

[0013] Дополнительно обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с тем же эпитопом Psl Pseudomonas, что и антитело или его антигенсвязывающий фрагмент, содержащие VH- и VL-области WapR-016.

[0014] Также обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR-016.

[0015] Некоторые варианты осуществления включают связывающую молекулу, например, антитело или его фрагмент, описанные выше, где VH и VL WapR-016 содержат SEQ ID NO: 15 и SEQ ID NO: 16, соответственно.

[0016] Также обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VH антитела, где VH содержит аминокислотную последовательность, по меньшей мере на 90% идентичную или идентичную по отношению к SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13 или SEQ ID NO: 15.

[0017] Некоторые варианты осуществления включают выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащую VL антитела, где VL содержит аминокислотную последовательность, по меньшей мере на 90% идентичную или идентичную по отношению к SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 и SEQ ID NO: 16.

[0018] Также обеспечивается выделенное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с Psl Pseudomonas, содержащие аминокислотные последовательности VH и VL, по меньшей мере на 90% идентичные или идентичные по отношению к (a) SEQ ID NO: 1 и SEQ ID NO: 2, соответственно, (b) SEQ ID NO: 3 и SEQ ID NO: 2, соответственно, (c) SEQ ID NO: 4 и SEQ ID NO: 2, соответственно, (d) SEQ ID NO: 5 и SEQ ID NO: 6, соответственно, (e) SEQ ID NO: 7 и SEQ ID NO: 8, соответственно, (f) SEQ ID NO: 9 и SEQ ID NO: 10, соответственно, (g) SEQ ID NO: 11 и SEQ ID NO: 12, соответственно, (h) SEQ ID NO: 13 и SEQ ID NO: 14, соответственно; или (i) SEQ ID NO: 15 и SEQ ID NO: 16, соответственно. В конкретных вариантах осуществления вышеописанное антитело или его антигенсвязывающий фрагмент содержат VH с аминокислотной последовательностью SEQ ID NO: 1 и VL с аминокислотной последовательностью SEQ ID NO: 2. В других вариантах осуществления вышеописанное антитело или его антигенсвязывающий фрагмент содержат VH с аминокислотной последовательностью SEQ ID NO: 11 и VL с аминокислотной последовательностью SEQ ID NO: 12.

[0019] Также раскрывается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VH антитела, где VH содержит аминокислотную последовательность гипервариабельного участка 1 VH (VHCDR1), идентичную или идентичную за исключением четырех, трех, двух или одной аминокислотной замены по отношению к SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 35, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 53 или SEQ ID NO: 59.

[0020] Также обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VH антитела, где VH содержит аминокислотную последовательность гипервариабельного участка 2 VH (VHCDR2), идентичную или идентичную за исключением четырех, трех, двух или одной аминокислотной замены по отношению к SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 48, SEQ ID NO: 54 или SEQ ID NO: 60.

[0021] Дополнительно обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VH антитела, где VH содержит аминокислотную последовательность гипервариабельного участка 3 VH (VHCDR3), идентичную или идентичную за исключением четырех, трех, двух или одной аминокислотной замены по отношению к SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 37, SEQ ID NO: 43, SEQ ID NO: 49, SEQ ID NO: 55 или SEQ ID NO: 61.

[0022] Также раскрывается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VL антитела, где VL содержит аминокислотную последовательность гипервариабельного участка 1 VL (VLCDR1), идентичную или идентичную за исключением четырех, трех, двух или одной аминокислотной замены по отношению к SEQ ID NO: 20, SEQ ID NO: 32, SEQ ID NO: 38, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 56 или SEQ ID NO: 62.

[0023] Дополнительно обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VL антитела, где VL содержит аминокислотную последовательность гипервариабельного участка 2 VL (VLCDR2), идентичную или идентичную за исключением четырех, трех, двух или одной аминокислотной замены по отношению к SEQ ID NO: 21, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 51, SEQ ID NO: 57 или SEQ ID NO: 63.

[0024] Некоторые варианты осуществления включают выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащую VL антитела, где VL содержит аминокислотную последовательность гипервариабельного участка 3 VL (VLCDR3), идентичную или идентичную за исключением четырех, трех, двух или одной аминокислотной замены по отношению к SEQ ID NO: 22, SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 46, SEQ ID NO: 52, SEQ ID NO: 58 или SEQ ID NO: 64.

[0025] Также обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VH антитела, где VH содержит аминокислотные последовательности VHCDR1, VHCDR2 и VHCDR3, идентичные или идентичные за исключением четырех, трех, двух или одной аминокислотной замены в одном или нескольких VHCDR по отношению к SEQ ID NO: 17, 18 и 19, SEQ ID NO: 23, 24 и 25, SEQ ID NO: 26, 27 и 28, SEQ ID NO: 29, 30 и 31, SEQ ID NO: 35, 36 и 37, SEQ ID NO: 41, 42 и 43, SEQ ID NO: 47, 48 и 49, SEQ ID NO: 53, 54 и 55 или SEQ ID NO: 59, 60 и 61, соответственно.

[0026] Некоторые варианты осуществления включают выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащую VL антитела, где VL содержит аминокислотные последовательности VLCDR1, VLCDR2 и VLCDR3, идентичные или идентичные за исключением четырех, трех, двух или одной аминокислотной замены в одном или нескольких VHCDR по отношению к SEQ ID NO: 20, 21 и 22, SEQ ID NO: 32, 33 и 34, SEQ ID NO: 38, 39 и 40, SEQ ID NO: 44, 45 и 46, SEQ ID NO: 50, 51 и 52, SEQ ID NO: 56, 57 и 58 или SEQ ID NO: 62, 63 и 64, соответственно.

[0027] Также раскрыта выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VL антитела, где VL содержит аминокислотные последовательности VLCDR1, VLCDR2 и VLCDR3, идентичные или идентичные за исключением четырех, трех, двух или одной аминокислотной замены в одном или нескольких VHCDR по отношению к SEQ ID NO: 20, 21 и 22, SEQ ID NO: 32, 33 и 34, SEQ ID NO: 38, 39 и 40, SEQ ID NO: 44, 45 и 46, SEQ ID NO: 50, 51 и 52, SEQ ID NO: 56, 57 и 58 или SEQ ID NO: 62, 63 и 64, соответственно.

[0028] Некоторые варианты осуществления включают выделенную связывающую молекулу, например, антитело или его фрагмент, описанную выше, которая (a) может ингибировать прикрепление Pseudomonas aeruginosa к эпителиальным клеткам, (b) может способствовать OPK P. aeruginosa или (c) может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам и может способствовать OPK P. aeruginosa.

[0029] Другие варианты осуществления включают выделенную связывающую молекулу, например, антитело или его фрагмент, описанную выше, где максимальное ингибирование прикрепления P. aeruginosa к эпителиальным клеткам достигается при концентрации антитела, составляющей около 50 мкг/мл или менее, 5,0 мкг/мл или менее или около 0,5 мкг/мл или менее, или при концентрации антитела, находящейся в диапазоне от около 30 мкг/мл до около 0,3 мкг/мл, или при концентрации антитела, составляющей около 1 мкг/мл, или при концентрации антитела, составляющей около 0,3 мкг/мл.

[0030] Определенные варианты осуществления включают выделенную связывающую молекулу, например, антитело или его фрагмент, описанную выше, где EC50 OPK составляет менее чем около 0,5 мкг/мл, менее чем около 0,05 мкг/мл или менее чем около 0,005 мкг/мл, или где EC50 OPK находится в диапазоне от около 0,001 мкг/мл до около 0,5 мкг/мл, или где EC50 OPK составляет менее чем около 0,2 мкг/мл, или где EC50 OPK составляет менее чем около 0,02 мкг/мл.

[0031] Также включена выделенная связывающая молекула, например, антитело или его фрагмент, описанная выше, которая специфически связывается с Psl P. aeruginosa с аффинностью, характеризующейся константой диссоциации (KD), не превышающей 5×10-2 M, 10-2 M, 5×10-3 M, 10-3 M, 5×10-4 M, 10-4 M, 5×10-5 M, 10-5 M, 5×10-6 M, 10-6 M, 5×10-7 M, 10-7 M, 5×10-8 M, 10-8 M, 5×10-9 M, 10-9 M, 5×10-10 M, 10-10 M, 5×10-11 M, 10-11 M, 5×10-12 M, 10-12 M, 5×10-13 M, 10-13 M, 5×10-14 M, 10-14 M, 5×10-15 M или 10-15 M, или где KD находится в диапазоне от около 1×10-10 до около 1×10-6 M. В одном варианте осуществления выделенное антитело, описываемое в данном документе, специфически связывается с Psl Pseudomonas при аффинности, характеризующейся KD, составляющей около 1,18×10-7 M, как определено в анализе связывания при помощи OCTET®. В другом варианте осуществления выделенное антитело, описываемое в данном документе, специфически связывается с Psl Pseudomonas при аффинности, характеризующейся KD, составляющей около 1,44×10-7 M, как определено в анализе связывания при помощи OCTET®.

[0032] В различных вариантах осуществления вышеописанные связывающие молекулы являются гуманизированными.

[0033] В различных вариантах осуществления вышеописанные связывающие молекулы являются химерными.

[0034] В различных вариантах осуществления вышеописанные связывающие молекулы являются полностью человеческими.

[0035] В определенных вариантах осуществления вышеописанные связывающие молекулы являются Fab-фрагментами, Fab'-фрагментами, F(ab)2-фрагментами или scFv-фрагментами.

[0036] В определенных вариантах осуществления вышеописанные связывающие молекулы содержат константные области легкой цепи, состоящие из константной области каппа-цепи человека или константной области лямбда-цепи человека.

[0037] В определенных вариантах осуществления вышеописанные связывающие молекулы содержат константную область тяжелой цепи или ее фрагмент. В дополнительных вариантах осуществления константная область тяжелой цепи или ее фрагмент представляет собой IgG1 человека.

[0038] В определенных вариантах осуществления вышеописанные связывающие молекулы являются моноклональными антителами.

[0039] В некоторых вариантах осуществления вышеописанные связывающие молекулы, например, антитела или их фрагменты, конъюгированы со средством, выбранным из группы, состоящей из противомикробного средства, терапевтического средства, пролекарства, пептида, белка, фермента, липида, модификатора биологического ответа, фармацевтического средства, лимфокина, гетерологичного антитела или его фрагмента, детектируемой метки, полиэтиленгликоля (PEG) и комбинации двух или более из любых указанных средств. В дополнительных вариантах осуществления детектируемая метка выбрана из группы, состоящей из фермента, флуоресцентной метки, хемилюминесцентной метки, биолюминесцентной метки, радиоактивной метки или комбинации двух или более из любых указанных детектируемых меток.

[0040] Дополнительные варианты осуществления включают композиции, содержащие вышеописанные связывающие молекулы, например, антитела или их фрагменты, и носитель.

[0041] Определенные варианты осуществления включают выделенный полинуклеотид, содержащий нуклеиновую кислоту, которая кодирует вышеописанную VH. В некоторых вариантах осуществления полинуклеотид дополнительно содержит нуклеиновую кислоту, которая кодирует вышеописанную VL, где связывающая молекула или ее антигенсвязывающий фрагмент, экспрессируемые полинуклеотидом, специфически связываются с Psl Pseudomonas. В некоторых вариантах осуществления полинуклеотид, описываемый в данном документе, содержащий нуклеотидную последовательность SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69 или SEQ ID NO: 70, кодирует молекулу scFv, содержащую VH и VL. В других вариантах осуществления настоящее изобретение включает выделенный полинуклеотид, содержащий нуклеиновую кислоту, которая кодирует вышеописанную VL. В дополнительных вариантах осуществления полинуклеотид дополнительно содержит нуклеиновую кислоту, которая кодирует вышеописанную VH, где связывающая молекула или ее антигенсвязывающий фрагмент, экспрессируемые полинуклеотидом, специфически связываются с Psl Pseudomonas.

[0042] В определенных вариантах осуществления обеспечиваются векторы, содержащие вышеописанные полинуклеотиды. В дополнительных вариантах осуществления полинуклеотиды функционально связаны с промотором. В дополнительных вариантах осуществления настоящее раскрытие обеспечивает клетки-хозяева, содержащие такие векторы. В дополнительных вариантах осуществления настоящее раскрытие обеспечивает векторы, в которых полинуклеотид функционально связан с промотором, где векторы могут экспрессировать связывающую молекулу, например, антитело или его фрагмент, описанную выше, которая специфически связывается с Psl Pseudomonas, в подходящей клетке-хозяине.

[0043] В некоторых вариантах осуществления обеспечивается способ получения связывающей молекулы, например, антитела или его фрагмента, описанной выше, которая специфически связывается с Psl Pseudomonas, включающий культивирование клетки-хозяина, содержащей вектор, содержащий вышеописанные полинуклеотиды, и извлечение указанного антитела или его фрагмента. В дополнительных вариантах осуществления обеспечиваются выделенная связывающая молекула или ее фрагмент, получаемые с помощью вышеописанного способа.

[0044] В некоторых вариантах осуществления вид рода Pseudomonas представляет собой Pseudomonas aeruginosa.

[0045] В дополнительных вариантах осуществления вышеописанные связывающие молекулы или их фрагменты, антитела или их фрагменты или композиции связываются с двумя или более, тремя или более, четырьмя или более или пятью или более различными серотипами P. aeruginosa или с по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90% или по меньшей мере 95% штаммов P. aeruginosa, выделенных от инфицированных пациентов. В дополнительных вариантах осуществления штаммы P. aeruginosa выделены из одного или нескольких из легких, мокроты, глаз, гноя, фекалий, мочи, пазух, раны, кожи, крови, кости или жидкости из коленного сустава. Серотипы P. aeruginosa классифицированы в соответствии с Международной системой серотипирования антигенов (IATS), впервые описанной в Liu, P.V. et al. Int. J. Syst. Bacteriol. 33:256-264 (1983), с дополнениями, например, Liu P.V., Wang S., J. Clin. Microbiol. 28:922-925 (1990).

[0046] Некоторые варианты осуществления направлены на способ предупреждения или лечения инфекции, вызываемой Pseudomonas, у субъекта, нуждающегося в этом, включающий введение субъекту эффективного количества связывающей молекулы или ее фрагмента, антитела или его фрагмента, композиции, полинуклеотида, вектора или клетки-хозяина, описываемых в данном документе. В дополнительных вариантах осуществления инфекция, вызываемая Pseudomonas, представляет собой инфекцию, вызываемую P. aeruginosa. В некоторых вариантах осуществления субъект является человеком. В некоторых вариантах осуществления инфекция является инфекцией глаз, инфекцией легких, ожоговой инфекцией, раневой инфекцией, кожной инфекцией, инфекцией крови, инфекцией костей или комбинацией двух или более из указанных инфекций. В дополнительных вариантах осуществления субъект страдает от острой пневмонии, ожоговой травмы, инфекции роговицы, муковисцидоза или их комбинации.

[0047] Некоторые варианты осуществления направлены на способ блокирования или предупреждения прикрепления P. aeruginosa к эпителиальным клеткам, включающий приведение смеси эпителиальных клеток и P. aeruginosa в контакт со связывающей молекулой или ее фрагментом, антителом или его фрагментом, композицией, полинуклеотидом, вектором или клеткой-хозяином, описываемыми в данном документе.

[0048] Также раскрывается способ стимуляции OPK P. aeruginosa,, включающий приведение смеси фагоцитарных клеток и P. aeruginosa в контакт со связывающей молекулой или ее фрагментом, антителом или его фрагментом, композицией, полинуклеотидом, вектором или клеткой-хозяином, описываемыми в данном документе. В дополнительных вариантах осуществления фагоцитарные клетки являются дифференцированными клетками HL-60 или полиморфноядерными лейкоцитами человека (PMN).

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ/ФИГУР

[0049] Фигура 1 (A-F). В фенотипическом скрининге фаговых библиотек антител человека с использованием целых клеток идентифицировали функционально активные специфические антитела к P. aeruginosa. (A) Обзор стратегии селекции полного антитела. (B) Блок-схема, описывающая способ выделения генов вариабельных областей от пациентов, недавно подвергавшихся воздействию P. aeruginosa. (C) Характеристики фаг-дисплейных библиотек scFv, указывающие размер и разнообразие репертуара клонированных антител. (D) Сравнение эффективности селекции по методу фагового дисплея с применением либо библиотеки антител пациентов, либо библиотеки наивных антител при селекции 3064 Δ WapR P. aeruginosa (l) или PAO1 MexAB OprM Δ WapR P. aeruginosa (2) в суспензии. Столбцы обозначают выходные титры (в CFU) в каждом цикле селекции, а кружки обозначают долю дуплицированных последовательностей CDR3 VH, что указывает на обогащение клонами. (E) ELISA-скрининг scFv из фагового дисплея для исследования связывания с несколькими штаммами P. aeruginosa. Данные ELISA (поглощение при 450 нм) показаны для восьми отдельных гибридов фаг-scFv из этапов селекции и одного нерелевантного гибрида фаг-scFv. (F) FACS-анализ связывания антител специфичных в отношении P. aeruginosa с типичными штаммами уникальных серотипов P. aeruginosa. Для каждого тестируемого антитела антитело IgG человека, представляющее собой отрицательный контроль, показано в виде заштрихованного пика.

[0050] Фигура 2 (A-D). Оценивание специфических mAb, способствующих OPK P. aeruginosa. (A) Анализ опсонофагоцитоза с применением люминесцентного штамма (PAO1.lux) серогруппы O5 P. aeruginosa с разведением очищенных моноклональных антител, полученных из фагового пэннинга. (B) Анализ опсонофагоцитоза с применением люминесцентного штамма (9882-80.lux) серогруппы O11 P. aeruginosa с разведениями очищенных моноклональных антител WapR-004 и Cam-003, полученных из фагового пэннинга. R347, изотипически сходное моноклональное антитело человека, которое не связывается с антигенами P. aeruginosa, применяли в качестве отрицательного контроля, что показано как на A, так и на B. (A, B) Результаты являются репрезентативными данными из трех независимых экспериментов, выполненных для каждого антитела. (C-D) Оценивание Cam-003, способствующего опсонофагоцитарному уничтожению (OPK) P. aeruginosa. (C) Анализ опсонофагоцитоза с типичными немукоидными штаммами клинически значимых серотипов, имеющих O-антиген (6294 (О6 ExoU-), 6077 (O11 ExoU+), 9882-80.lux (O11 ExoU-), 33356 (О9 ExoU-), 2410.lux (О6) и 6206.lux (O11 ExoU+)). (D) Анализ опсонофагоцитоза с типичными мукоидными штаммами, которые были сконструированы люминесцентными (A004.lux, A010.lux и A015.lux). Линии представляют средний процент уничтожения, а планки погрешностей представляют стандартное отклонение. Процент уничтожения рассчитывали относительно результатов, полученных в анализах, проведенных в отсутствие антитела. (C, D) R347-контроль применяли в отдельных анализах для каждого штамма. Для простоты R347-контроль не включили в фигуры. Результаты являются репрезентативными данными из трех независимых экспериментов, выполненных для каждого штамма.

[0051] Фигура 3 (A-K). Идентификация Psl P. aeruginosa, экзополисахаридной мишени для антител, полученных из фенотипического скрининга. Реактивность антител определяли посредством непрямого ELISA на планшетах, покрытых указанными штаммами P. aeruginosa: (A) PAO1 дикого типа, PAO1ΔwbpL, PAO1ΔrmlC и PAO1ΔgalU. (B) PAO1ΔpslA. Антитело Genway является специфичным в отношении белка наружной мембраны P. aeruginosa, и его применяли в качестве положительного контроля. (C) FACS-анализ связывания Cam-003 с PAO1 и PAO1ΔpslA. Cam-003 обозначается сплошной черной линией и четким пиком; сходное по изотипу антитело IgG1 человека, не специфичное в отношении P. aeruginosa, применяли в качестве отрицательного контроля, и оно обозначается серой линией и заштрихованным пиком. (D) LPS, очищенный из PAO1 и PAO1ΔpslA, разделяли с помощью SDS-PAGE и подвергали иммуноблоттингу с антисывороткой, полученной от мышей, вакцинированных PAO1ΔwapRΔalgD, мутантным штаммом с недостаточностью транспорта О-антигена к наружной мембране и выработки альгината. (E) Данные ELISA по связыванию Cam-003 с изогенными мутантами PAO1. Дорожка 1: PAO1ΔwbpLΔalgD; дорожка 2: PAO1ΔwbpLΔalgDΔpslA; дорожка 3: PAO1ΔwbpLΔalgDΔpelA; дорожка 4: PAO1ΔwbpLΔalgDΔpslA+pUCP; дорожка 5: PAO1ΔwbpLΔalgDΔpslA + pPW145. pPW145 представляет собой вектор экспрессии pUCP, содержащий pslA. * означает P<0,005 с использованием U-критерия Манна-Уитни при сравнении связывания Cam-003 и связывания R347. (F и G) Анализы опсонофагоцитоза, указывающие, что Cam-003 только опосредует уничтожение штаммов, способных к выработке Psl (PAO1 дикого типа и PAO1ΔpslA, дополненный в транс-положении геном pslA). (H и I) Данные ELISA, указывающие на реактивность антител WapR-001, WapR-004 и WapR-016 к Psl относительно PAO1 ΔwbpLΔalgD и PAO1 ΔwbpLΔalgDΔpslA. (J) Реактивность антител определяли посредством непрямого ELISA на планшетах, покрытых указанными штаммами P. aeruginosa: PAO1 дикого типа, PAO1ΔwbpL, PAO1ΔwbpLΔalgD, PAO1ΔrmlC и PAO1ΔgalU. R347 применяли в качестве отрицательного контроля во всех экспериментах. (A, B, C, F, G, H, I, J). Каждая панель является набором репрезентативных данных из трех независимых экспериментов.

(K) Захват обогащенного Psl, выделенного из целых клеток P. aeruginosa, антителами к Psl, измеренный при помощи прибора FORTEBIO® OCTET® 384. R347 применяли в качестве отрицательного контроля. Результаты являются репрезентативными данными из трех независимых экспериментов.

[0052] Фигура 4. mAb к Psl ингибируют прикрепление клеток люминесцентного штамма PAOl.lux P. aeruginosa к клеткам A549. PAOl.lux в логарифмической фазе роста добавили к конфлюэнтному монослою клеток A549 при значении MOI, составляющем 10, с последующим анализом RLU после повторного промывания для удаления несвязанных P. aeruginosa. Результаты являются репрезентативными для трех независимых экспериментов, выполненных в двух повторностях для каждой концентрации антител.

[0053] Фигура 5 (A-U). In vivo пассированные штаммы P. aeruginosa поддерживают/повышают экспрессию Psl. Антитело Cam-003 показано сплошной черной линией и четким пиком; антитело IgG человека, представляющее собой отрицательный контроль, показано серой линией и заштрихованным пиком. (A) Что касается положительного контроля, Cam-003 анализировали в отношении связывания со штаммами, выращиваемых до логарифмической фазы роста из суточной культуры (~5×108/мл). (B) Инокуляты каждого штамма получали при 5×108 CFU/мл из суточной культуры в чашках с TSA, выращиваемой до образования газона, и тестировали на реактивность относительно Cam-003 с помощью проточной цитометрии. (C) Через четыре часа после интраперитонеального контрольного заражения бактерии собирали от мышей с помощью перитонеального лаважа и анализировали на наличие Psl с Cam-003 с помощью проточной цитометрии. (D) Через четыре часа и (E) через двадцать четыре часа после интраназального контрольного заражения бактерии собирали от мышей с помощью бронхоальвеолярного лаважа (BAL) и анализировали на наличие Psl с Cam-003 с помощью проточной цитометрии. Каждая панель проточной цитометрии является набором репрезентативных данных из пяти независимых экспериментов. (F-U) Связывание специфических антител к P. aeruginosa (Cam-003, Cam-004 и Cam-005) с типичными штаммами уникальных серотипов P. aeruginosa. (F) PAO1 (O5), (G) 2135 (O1), (H) 2531 (O1), (I) 2410 (O6), (J) 2764 (O11), (K) 2757 (O11), (L) 33356 (O9), (M) 33348 (O1), (N) 3039 (NT), (O) 3061 (NT), (P) 3064 (NT), (Q) 19660 (NT), (R) 9882-80 (O11), (S) 6073 (O11), (T) 6077 (O11) и (U) 6206 (O1l). Антитела Cam-003, Cam-004 и Cam-005 показаны серой линией и четким пиком; антитело IgG человека, представляющее собой отрицательный контроль, показано сплошной черной линией и заштрихованным пиком.

[0054] Фигура 6 (A-G). Показатели выживаемости животных, обработанных моноклональными антителами Cam-003 или WapR-004 к Psl, в модели острой пневмонии с инфицированием P. aeruginosa. (A-D) Животных обрабатывали с помощью Cam-003 при 45, 15 и 5 мг/кг и R347 при 45 мг/кг или PBS за 24 часа до интраназального инфицирования при помощи (A) PAO1 (1,6×107 CFU), (B) 33356 (3×107 CFU), (C) 6294 (7×106 CFU), (D) 6077 (1×106 CFU). (E-F) Животных обрабатывали с помощью WapR-004 при 5 и l мг/кг, как указано, с последующим инфицированием при помощи 6077 при (E) (8×105 CFU) или (F) (6×105 CFU). Тщательно отслеживали выживаемость животных в течение до 72 часов (A-D) или в течение 120 часов (E-F). (G) Животных обрабатывали с помощью Cam-003 при 15 мг/кг или 5 мг/кг или с помощью R347 при 15 мг/кг за 24 часа до интраназального инфицирования при помощи PAO1 (4,4×107 CFU) и с помощью Cam-003 при 15 мг/кг за 24 часа до интраназального инфицирования при помощи PAO1ΔpslA (3×107 CFU). Во всех экспериментах PBS и R347 служили в качестве отрицательных контролей. Результаты представлены в виде кривых выживаемости Каплана-Мейера; различия в выживаемости рассчитали с помощью логарифмического рангового критерия для Cam-003 в сравнении с R347. (A) Cam-003 (45 мг/кг - P<0,0001; 15 мг/кг - P=0,0003; 5 мг/кг - P=0,0033). (B) Cam-003 (45 мг/кг - P=0,0012; 15 мг/кг - P=0,0012; 5 мг/кг - P=0,0373). (C) Cam-003 (45 мг/кг - P=0,0007; 15 мг/кг - P=0,0019; 5 мг/кг - P=0,0212). (D) Cam-003 (45 мг/кг - P<0,0001; 15 мг/кг - P<0,0001; 5 мг/кг - P=0,0001). Результаты являются репрезентативными для по меньшей мере двух независимых экспериментов. (E) [Cam-003 (5 мг/кг) в сравнении с R347 (5 мг/кг): P=0,02; Cam-003 (1 мг/кг) в сравнении с R347 (5 мг/кг): P=0,4848; WapR-004 (5 мг/кг) в сравнении с R347 (5 мг/кг): P<0,0001; WapR-004 (1 мг/кг) в сравнении с R347 (5 мг/кг): P=0,0886; WapR-004 (5 мг/кг) в сравнении с Cam-003 (5 мг/кг): P=0,0017; WapR-004 (1 мг/кг) в сравнении с Cam-003 (1 мг/кг): P=0,2468; R347 (5 мг/кг) в сравнении с PBS: P=0,6676]. (F) [Cam-003 (5 мг/кг) в сравнении с R347 (5 мг/кг): P=0,0004; Cam-003 (1 мг/кг) в сравнении с R347 (5 мг/кг): P<0,0001; WapR-004 (5 мг/кг) в сравнении с R347 (5 мг/кг): P<0,0001; WapR-004 (1 мг/кг) в сравнении с R347 (5 мг/кг): P<0,0001; WapR-004 (5 мг/кг) в сравнении с Cam-003 (5 мг/кг): P=0,0002; WapR-004 (1 мг/кг) в сравнении с Cam-003 (1 мг/кг): P=0,2628; R347 (5 мг/кг) в сравнении с PBS: P=0,6676]. (G) [Cam-003 (15 мг/кг - P=0,0028; 5 мг/кг - P=0,0028)]. Результаты являются репрезентативными для пяти независимых экспериментов.

[0055] Фигура 7 (A-F). Моноклональные антитела к Psl, Cam-003 и WapR-004, уменьшают нагрузку органа после индуцирования острой пневмонии. Мышей обрабатывали антителом Cam-003 за 24 часа до инфицирования при помощи (A) PAO1 (1,1×107 CFU), (B) 33356 (1×107 CFU), (C) 6294 (6,25×106 CFU) (D) 6077 (1×106 CFU), и антителом WapR-004 за 24 часа до инфицирования при помощи (E) 6294 (~1×107 CFU) и (F) 6206 (~1×106 CFU). Через 24 часа после инфицирования животных подвергли эвтаназии с последующим забором органов для идентификации жизнеспособных CFU. Различия в жизнеспособных CFU определяли с использованием U-критерия Манна-Уитни для Cam-003 или WapR-004 в сравнении с R347. (A) Легкое: Cam-003 (45 мг/кг - P=0,0015; 15 мг/кг - P=0,0021; 5 мг/кг - P=0,0015); селезенка: Cam-003 (45 мг/кг - P=0,0120; 15 мг/кг - P=0,0367); почки: Cam-003 (45 мг/кг - P=0,0092; 15 мг/кг - P=0,0056); (B) легкое: Cam-003 (45 мг/кг - P=0,0010; 15мг/кг - P < 0,0001; 5 мг/кг - P=0,0045); (C) легкое: Cam-003 (45 мг/кг - P=0,0003; 15 мг/кг - P=0,0039; 5 мг/кг - P=0,0068); селезенка: Cam-003 (45 мг/кг - P=0,0057; 15 мг/кг - P=0,0230; 5 мг/кг - P=0,0012); (D) легкое: Cam-003 (45 мг/кг - P=0,0005; 15 мг/кг - P=0,0003; 5 мг/кг - P=0,0007); селезенка: Cam-003 (45 мг/кг - P=0,0015; 15 мг/кг - P=0,0089; 5 мг/кг - P=0,0089); почки: Cam-003 (45 мг/кг - P=0,0191; 15 мг/кг - P=0,0355; 5 мг/кг - P=0,0021). (E) Легкое: WapR-004 (15 мг/кг - P=0,0011; 5 мг/кг - P=0,0004; 1 мг/кг - P=0,0002); селезенка: WapR-004 (15 мг/кг - P=0,0001; 5 мг/кг - P=0,0014; 1 мг/кг - P=0,0001); F) легкое: WapR-004 (15 мг/кг - P<0,0001; 5 мг/кг - P=0,0006; 1 мг/кг - P=0,0079); селезенка: WapR-004 (15 мг/кг - P=0,0059; 5 мг/кг - P=0,0261; 1 мг/кг - P=0,0047); почка: WapR-004 (15 мг/кг - P=0,0208; 5 мг/кг - P=0,0268).

[0056] Фигура 8 (A-G). Моноклональные антитела Cam-003 и WapR-004 к Psl активны в модели кератита с инфицированием P. aeruginosa, и модели термического повреждения. Мышей обрабатывали контрольным антителом IgG1 или Cam-003 при 45 мг/кг (A, B) или 15 мг/кг (C, D), или PBS, или контрольным антителом IgG1, или Cam-003 при 45 мг/кг, или WapR-004 при 45 мг/кг, или 15 мг/кг, или 5 мг/кг (F, G) за 24 часа до инфицирования при помощи 6077 (цитотоксичный O11 - 2×106 CFU). Непосредственно перед инфицированием на роговице левого глаза каждого животного были сделаны три царапины на 1 мм с последующим местным нанесением 5 мкл инокулята P. aeruginosa. Через 24 часа после инфицирования были рассчитаны количественные показатели патологии роговицы с последующим удалением глаза для определения жизнеспособных CFU. Различия в количественных показателях патологии и жизнеспособных CFU определяли с помощью U-критерия Манна-Уитни. (A) P=0,0001, (B) P<0,0001, (C) P=0,0003, (D) P=0,0015. (F) и (G) Cam-003 (45 мг/кг) в сравнении с WapR-004 (45 мг/кг): P=0,018; Cam-003 (45 мг/кг) в сравнении с WapR-004 (15 мг/кг): P=0,0025; WapR-004 (45 мг/кг) в сравнении с WapR-004 (15 мг/кг): P=0,1331; WapR-004 (5 мг/кг) в сравнении с контролем: P<0,0001. Результаты являются репрезентативными для пяти независимых экспериментов. (E) Анализ выживаемости мышей CF-1, обработанных с помощью Cam-003 и R347, в модели термического повреждения с инфицированием P. aeruginosa после инфицирования при помощи 6077 (2×105 CFU) (логарифмический ранговый критерий: R347 в сравнении с 15 мг/кг Cam-003, P=0,0094; R347 в сравнении с 5 мг/кг Cam-003, P=0,0017). Результаты являются репрезентативными по меньшей мере для трех независимых экспериментов, (n) относится к числу животных в каждой группе.

[0057] Фигура 9 (A-E). Антитело Cam-003 с мутацией в Fc, Cam-003-TM, обладает уменьшенными OPK и эффективностью in vivo, но сохраняет активность против прикрепления к клеткам. (A) Анализ OPK в отношении PAO1.lux с применением Cam-003 и Cam-003-TM, обладающих мутациями в Fc-домене, которые препятствуют взаимодействиям Fc с рецепторами Fcγ (Oganesyan, V., et al, Acta Crystallogr D Biol Crystallogr 64, 700-704 (2008)). R347 применяли в качестве отрицательного контроля. Результаты являются репрезентативными данными из трех независимых экспериментов. (B) Анализ прикрепления PAO1 к клеткам с применением Cam-003 и Cam-003-TM. Результаты являются репрезентативными данными из двух независимых экспериментов. (C-E) В модели острой пневмонии сравнивается эффективность Cam-003 с таковой Cam-003-TM. В модели острой пневмонии с инфицированием штаммом 6077 P. aeruginosa с применением мышей BALB/c, которым инокулировали (C) 1,22×106 (D) 2,35×105 или (E) 1,07×106, сравнивается эффективность Cam-003 с таковой Cam-003-TM. Мышей обрабатывали антителом за 24 часа до контрольного заражения. (C-E) В каждой группе применяли десять животных. Результаты представляют собой репрезентативные данные из двух независимых экспериментов.

[0058] Фигура 10 (A-B). A. Картирование эпитопов и идентификация относительной аффинности связывания моноклональных антител к Psl. Картирование эпитопов выполняли с помощью конкурентного ELISA и подтверждали при помощи проточной системы OCTET® с Psl, полученным из надосадочной жидкости суточной культуры штамма PAO1 P. aeruginosa. Значения относительной аффинности связывания измеряли при помощи прибора FORTEBIO® OCTET® 384. Также показаны концентрации антитела, при которых прикрепление к клеткам максимально ингибировалось, и значения EC50 OPK для каждого антитела. B. Значения относительной аффинности разнообразных мутантных WapR-004, измеренные при помощи прибора FORTEBIO® OCTET® 384. Также показаны значения EC50 OPK для разнообразных мутантных форм.

[0059] Фигура 11 (A-M). Оценивание мутантных клонов WapR-004 (W4) в анализе OPK в отношении P. aeruginosa. (A-M) Анализ опсонофагоцитоза с применением люминесцентного штамма (PAOl.lux) серогруппы O5 P. aeruginosa с разведениями различных мутантных клонов W4 в формате scFv-Fc. В некоторых случаях IgG1 W4 включали в анализ и обозначали как W4-IgGl. W4-RAD-Cam и W4-RAD-GB представляют одну и ту же последовательность WapR-004RAD, описываемую в данном документе. "W4-RAD" представляет собой краткое название WapR-004RAD, и обозначения W4-RAD-Cam и W4-RAD-GB в панелях D-M представляют два разных препарата WapR-004RAD. Во всех экспериментах R347, моноклональное антитело IgG1 человека, которое не связывается с антигенами P. aeruginosa, применяли в качестве отрицательного контроля.

[0060] Фигура 12. Способ сайт-направленной коньюгации полимиксина B (PMB) с mAb, при котором гетеробифункциональный линкер SM-PEG12 (Pierce) конъюгировали с группой первичного амина PMB в условиях, определенных как благоприятные для коньюгации одинарного линкера. Эффективность коньюгации и уровни свободной формы PMB-линкер в образцах определяли с помощью UPLC и масс-спектрометрии.

[0061] Фигура 13 (A-B). PMB-mAb, полученные в результате сайт-направленной конъюгации. Применяя разработанный способ сайт-направленной коньюгации, PMB конъюгировали с вариантами CAM-003 и A7 (контрольный IgG1 человека) mAb с одним (SM, ND10), двумя (DM, ND10/19) либо тремя (TM, ND4/10/19) цистеиновыми остатками, внедренными в Fc-область с помощью методов генной инженерии. A. Остатки Cam-003 и A7 с мутацией в Fc-области. B. Среднее число PMB в конъюгатах PMB-mAb (одинарный мутант (SM) > двойной мутант 1 (DM1) > двойной мутант 2 (DM2)).

[0062] Фигура 14 (A-B). Оценивание связывания конъюгатов PMB-mAb с клетками PAO1 дикого типа P. aeruginosa с помощью FACS-анализа. A. Cam-003 (Cam-003-SM-PMB, Cam-003-DM1-PMB, Cam-003-DM2-PMB, псевдоконъюгированное Cam-003 дикого типа (Cam-003-Mock-PMB)). B. Контрольные конъюгаты A7 (A7-SM-PMB, A7-DM1-PMB, A7-DM2-PMB, псевдоконъюгированное A7 дикого типа (A7-Mock-PMB)). R347 применяли в качестве отрицательного контроля во всех экспериментах.

[0063] Фигура 15 (A-B). OPK-активность конъюгатов PMB-mAb против A: штамма PAO1 дикого типа P. aeruginosa и B: против штамма ΔpslA P. aeruginosa, не экспрессирующего Psl-мишень.

[0064] Фигура 16 (A-B). Нейтрализация LPS P. aeruginosa с помощью конъюгатов PMB-mAb. A: конъюгаты PMB-Cam-003 и псевдоконъюгированное Cam-003 дикого типа и B: конъюгаты PMB-A7 и псевдоконъюгированное A7 дикого типа.

[0065] Фигура 17. Структура, показывающая полимиксин, циклический антибактериальный липопептид, который нейтрализует провоспалительные эффекты LPS и может применяться для лечения инфекций, вызываемых грамотрицательными микроорганизмами с MDR (колистин/полимиксин E). Полимиксины имеют 5 положительно заряженных групп диаминобутировой кислоты (обведенных кружками), которые опосредуют взаимодействия с отрицательно заряженным липидом A в LPS и нейтрализуют его провоспалительную активность.

[0066] Фигура 18 (A-B). OPK-активность клеток-нейтрофилов линии HL-60 человека в присутствии системы комплемента кролика оценивали с применением штамма PAO1 P. aeruginosa, экспрессирующего бактериальную люциферазу. A: % уничтожения конъюгатами CAM-003-PMB. B: % уничтожения конъюгатами A7-PMB.

[0067] Фигура 19 (A-B). A. Процент выживаемости мышей C57B1/6, которым дозировали 45 мг/кг конъюгатов CAM-TM-PMB. B. Процент выживаемости мышей C57B1/6, которым дозировали 45 мг/кг конъюгатов A7-TM-PMB.

[0068] Фигура 20 (A-B). A. Процент выживаемости мышей C57B1/6, которым дозировали 45 мг/кг, 15 мг/кг и 5 мг/кг конъюгатов CAM-TM-PMB. B. Процент выживаемости мышей C57B1/6, которым дозировали 45 мг/кг, 15 мг/кг и 5 мг/кг конъюгатов A7-TM-PMB.

[0069] Фигура 21 (A-C). Процент выживаемости мышей C57B1/6, которым дозировали mAb или конъюгаты PMB-mAb i.p. A: 10 мг/кг. B: 1 мг/кг. C: 0,1 мг/кг.

ПОДРОБНОЕ ОПИСАНИЕ

I. ОПРЕДЕЛЕНИЯ

[0070] Следует отметить, что формы единственного числа объектов относятся к одному или нескольким из этих объектов, например, выражение "связывающая молекула, которая специфически связывается с Psl Pseudomonas" понимают как представляющее одну или несколько связывающих молекул, которые специфически связываются с Psl Pseudomonas. Таким образом, формы единственного числа, выражения "один или несколько" и "по меньшей мере один" можно применять в данном документе взаимозаменяемо.

[0071] Применяемое в данном документе выражение "полипептид" предназначено охватывать "полипептид" в единственном числе, а также "полипептиды" во множественном числе и относится к молекуле, состоящей из мономеров (аминокислот), линейно соединенных амидными связями (также известными как пептидные связи). Выражение "полипептид" относится к любой цепи или цепям из двух или более аминокислот и не относится к конкретной длине продукта. Таким образом, пептиды, дипептиды, трипептиды, олигопептиды, "белок", "цепь аминокислот" или любое другое выражение, применяемое для обозначения цепи или цепей из двух или более аминокислот, включены в определение "полипептид", и выражение "полипептид" можно применять вместо любого из указанных выражений или взаимозаменяемо с любым из них. Выражение "полипептид" также предназначено для обозначения продуктов постэкспрессионных модификаций полипептида, включая, без ограничений, гликозилирование, ацетилирование, фосфорилирование, амидирование, дериватизацию с помощью известных защитных/блокирующих групп, протеолитическое расщепление или модификацию с помощью не встречающихся в природе аминокислот. Полипептид может быть получен из естественного биологического источника или получен с помощью рекомбинантной технологии, но не обязательно, чтобы он был транслирован из указанной последовательности нуклеиновой кислоты. Он может быть получен любым способом, в том числе путем химического синтеза.

[0072] Полипептид, раскрытый в данном документе, может иметь размер около 3 или более, 5 или более, 10 или более, 20 или более, 25 или более, 50 или более, 75 или более, 100 или более, 200 или более, 500 или более, 1000 или более или 2000 или более аминокислот. Полипептиды могут иметь определенную трехмерную структуру, хотя они не обязательно имеют такую структуру. Полипептиды с определенной трехмерной структурой называются свернутыми, а полипептиды, не обладающие определенной трехмерной структурой, а скорее способные принимать большое число различных конформаций, называются несвернутыми. Применяемое в данном документе выражение "гликопротеин" относится к белку, связанному по меньшей мере с одним углеводным фрагментом, присоединенным к белку посредством кислородсодержащей или азотсодержащей боковой цепи аминокислотного остатка, например, серинового остатка или аспарагинового остатка.

[0073] Под "выделенным" полипептидом или его фрагментом, вариантом или производным подразумевается полипептид, не находящийся в своем естественном окружении. Не требуется конкретный уровень очистки. Например, выделенный полипептид может быть удален из его нативной или естественной окружающей среды. Полученные рекомбинантным путем полипептиды и белки, экспрессирующиеся в клетках-хозяевах, считаются выделенными, как раскрыто в данном документе, поскольку являются нативными или рекомбинантными полипептидами, разделенными, фракционированными или частично или в значительной степени очищенными с помощью любой подходящей методики.

[0074] Другие полипептиды, раскрытые в данном документе, представляют собой фрагменты, производные, аналоги или варианты вышеупомянутых полипептидов и любую их комбинацию. Выражения "фрагмент", "вариант", "производное" и "аналог", обозначающие связывающую молекулу, такую как антитело, которая специфически связывается с Psl Pseudomonas, как раскрыто в данном документе, включают любые полипептиды, которые сохраняют по меньшей мере некоторые свойства связывания с антигеном соответствующего нативного антитела или полипептида. Фрагменты полипептидов включают, например, протеолитические фрагменты, а также делеционные фрагменты, в дополнение к фрагментам специфических антител, рассматриваемым где-либо в данном документе. Варианты связывающей молекулы, например, антитела, которое специфически связывается с Psl Pseudomonas, как раскрыто в данном документе, включают фрагменты, описанные выше, а также полипептиды с аминокислотными последовательностями, измененными в связи с аминокислотными заменами, делециями или вставками. Варианты могут встречаться в природе или являться не встречающимися в природе. Не встречающиеся в природе варианты можно получить при помощи методик мутагенеза, известных в данной области техники. Варианты полипептидов могут включать консервативные или неконсервативные аминокислотные замены, делеции или добавления. Производные связывающей молекулы, например, антитела, которое специфически связывается с Psl Pseudomonas, как раскрыто в данном документе, являются полипептидами, измененными таким образом, чтобы они проявляли дополнительные признаки, не обнаруживаемые в нативном полипептиде. Примеры включают белки слияния. Варианты полипептидов также могут называться в данном документе "аналогами полипептидов". Применяемое в данном документе выражение "производное" связывающей молекулы, например, антитела, которое специфически связывается с Psl Pseudomonas, относится к объекту-полипептиду, имеющему один или несколько остатков, химически дериватизированных с помощью реакции функциональной боковой группы. Также в качестве "производных" включены те пептиды, которые содержат одну или несколько встречающихся в природе аминокислотных производных двадцати стандартных аминокислот. Например, 4-гидроксипролин может быть замещен на пролин; 5-гидроксилизин может быть замещен на лизин; 3-метилгистидин может быть замещен на гистидин; гомосерин может быть замещен на серин; и орнитин может быть замещен на лизин.

[0075] Выражение "полинуклеотид" предназначено охватывать нуклеиновую кислоту в единственном числе, а также нуклеиновых кислот во множественном числе и относится к молекуле или конструкту выделенной нуклеиновой кислоты, например, матричной РНК (мРНК) или плазмидной ДНК (пДНК). Полинуклеотид может содержать традиционную фосфодиэфирную связь или нетрадиционную связь (например, амидную связь, такую как обнаруживаемую в пептидных нуклеиновых кислотах (PNA)). Выражение "нуклеиновая кислота" относится к какому-либо одному или нескольким сегментам нуклеиновой кислоты, например, фрагментам ДНК или РНК, имеющимся в полинуклеотиде. Под "выделенными" нуклеиновой кислотой или полинуклеотидом подразумевается молекула нуклеиновой кислоты, ДНК или РНК, которая была удалена из ее нативной окружающей среды. Например, рекомбинантный полинуклеотид, кодирующий связывающую молекулу, например, антитело, которое специфически связывается с Psl Pseudomonas, содержащийся в векторе, считается выделенным, как раскрыто в данном документе. Дополнительные примеры выделенного полинуклеотида включают рекомбинантные полинуклеотиды, содержащиеся в гетерологичных клетках-хозяевах, или очищенные (частично или в значительной степени) полинуклеотиды в растворе. Выделенные молекулы РНК включают in vivo или in vitro РНК-транскрипты полинуклеотидов. Выделенные полинуклеотиды или нуклеиновые кислоты дополнительно включают такие молекулы, полученные синтетически. В дополнение, полинуклеотид или нуклеиновая кислота могут представлять собой или могут включать регуляторный элемент, такой как промотор, сайт связывания рибосомы или терминатор транскрипции.

[0076] Применяемое в данном документе выражение "кодирующая область" представляет собой часть нуклеиновой кислоты, состоящую из кодонов, транслируемых в аминокислоты. Хотя "стоп-кодон" (TAG, TGA или TAA) не транслируется в аминокислоту, он может считаться частью кодирующей области, однако любые фланкирующие последовательности, например, промоторы, сайты связывания рибосомы, терминаторы транскрипции, интроны и т.п. не являются частью кодирующей области. В одном полинуклеотидном конструкте, например, в одном векторе, или в отдельных полинуклеотидных конструктах, например, в отдельных (различных) векторах, могут иметься две или более кодирующих области. Кроме того, любой вектор может содержать одну кодирующую область или может содержать две или более кодирующие области, например, один вектор может по отдельности кодировать вариабельную область тяжелой цепи иммуноглобулина и вариабельную область легкой цепи иммуноглобулина. В дополнение, вектор, полинуклеотид или нуклеиновая кислота могут кодировать гетерологичные кодирующие области, либо слитые, либо не слитые с нуклеиновой кислотой, кодирующей связывающую молекулу, которая специфически связывается с Psl Pseudomonas, например, антитело или его антигенсвязывающий фрагмент, вариант или производное. Гетерологичные кодирующие области включают, без ограничений, специализированные элементы или мотивы, такие как кодирующие секреторный сигнальный пептид или гетерологичный функциональный домен.

[0077] В определенных вариантах осуществления полинуклеотид или нуклеиновая кислота представляют собой ДНК. В случае ДНК полинуклеотид, содержащий нуклеиновую кислоту, которая кодирует полипептид, обычно может включать промотор и/или другие элементы, осуществляющие контроль транскрипции или трансляции, функционально связанные с одной или несколькими кодирующими областями. Функциональная связь наблюдается тогда, когда кодирующая область для продукта гена, например, полипептида, связана с одной или несколькими регуляторными последовательностями таким образом, чтобы экспрессия продукта гена была помещена под влияние или контроль регуляторной последовательности (регуляторных последовательностей). Два фрагмента ДНК (такие как кодирующая область для полипептида и промотор, связанный с ней) "функционально связаны", если индуцирование функции промотора приводит в результате к транскрипции мРНК, кодирующей желаемый продукт гена, и если природа связи между двумя фрагментами ДНК не препятствует способности регуляторных последовательностей, отвечающих за экспрессию, управлять экспрессией продукта гена или не препятствует способности ДНК-матрицы транскрибироваться. Таким образом, промоторная область может быть функционально связанной с нуклеиновой кислотой, кодирующей полипептид, если промотор способен воздействовать на транскрипцию этой нуклеиновой кислоты. Промотор может быть промотором, специфичным в отношении клеток, управляющим существенной транскрипцией ДНК только в предопределенных клетках. Другие элементы, осуществляющие контроль транскрипции, помимо промотора, например, энхансеры, операторы, репрессоры и сигналы терминации транскрипции, могут быть функционально связанными с полинуклеотидом для управления транскрипцией, специфичной в отношении клеток. Подходящие промоторы и другие области, осуществляющие контроль транскрипции, раскрыты в данном документе.

[0078] Разнообразные области, осуществляющие контроль транскрипции, известны специалистам в данной области. Они включают, без ограничений, области, осуществляющие контроль транскрипции, функционирующие в клетках позвоночных, такие как, без ограничений, промоторные и энхансерные сегменты цитомегаловирусов (немедленно-ранний промотор вместе с интроном-A), вируса обезьян 40 (ранний промотор) и ретровирусов (такой как вирус саркомы Рауса). Другие области, осуществляющие контроль транскрипции, включают таковые, полученные из генов позвоночных, таких как гены актина, белка теплового шока, гормона роста крупного рогатого скота и β-глобина кролика, а также другие последовательности, способные осуществлять контроль экспрессии генов в клетках эукариот. Дополнительные подходящие области, осуществляющие контроль транскрипции, включают тканеспецифичные промоторы и энхансеры, а также лимфокин-индуцируемые промоторы (например, промоторы, индуцируемые интерферонами или интерлейкинами).

[0079] Аналогично, разнообразные элементы, осуществляющие контроль трансляции, известны специалистам в данной области техники. Они включают, без ограничений, сайты связывания рибосомы, кодоны, инициирующие и терминирующие трансляцию, и элементы, полученные из пикорнавирусов (в частности, внутренний сайт связывания рибосомы или IRES, также называемый CITE-последовательностью).

[0080] В других вариантах осуществления полинуклеотид может представлять собой РНК, например, в виде матричной РНК (мРНК).

[0081] Кодирующие области полинуклеотидов и нуклеиновых кислот могут быть связаны с дополнительными кодирующими областями, которые кодируют секреторные или сигнальные пептиды, которые управляют секрецией полипептида, кодируемого полинуклеотидом, раскрытым в данном документе, например, полинуклеотидом, кодирующим связывающую молекулу, которая специфически связывается с Psl Pseudomonas, например, антитело или его антигенсвязывающий фрагмент, вариант или производное. Согласно гипотезе сигнальной последовательности, белки, секретируемые в клетках млекопитающих, имеют сигнальный пептид или секреторную лидерную последовательность, отщепляющуюся от зрелого белка, как только инициируется экспорт растущей белковой цепи через гранулярный эндоплазматический ретикулум. Специалистам в данной области известно, что полипептиды, секретируемые в клетках позвоночных, обычно имеют сигнальный пептид, слитый с N-концом полипептида, который отщепляется от полного полипептида или такового "полной длины" с получением секретированной или "зрелой" формы полипептида. В некоторых вариантах осуществления применяют нативный сигнальный пептид, например, сигнальный пептид тяжелой цепи или легкой цепи иммуноглобулина, или функциональное производное этой последовательности, сохраняющее способность управлять секрецией полипептида, функционально связанного с ним. Альтернативно, можно применять гетерологичный сигнальный пептид млекопитающих или его функциональное производное. Например, лидерная последовательность дикого типа может быть заменена на лидерную последовательность тканевого активатора плазминогена (TPA) человека или β-глюкуронидазы мыши.

[0082] В данном документе раскрыты определенные связывающие молекулы или их антигенсвязывающие фрагменты, варианты или производные. Если конкретно не указана ссылка на полноразмерные антитела, такие как встречающиеся в природе антитела, выражение "связывающая молекула" охватывает полноразмерные антитела, а также антигенсвязывающие фрагменты, варианты, аналоги или производные таких антител, например, молекулы встречающихся в природе антител или иммуноглобулинов или сконструированные молекулы или фрагменты антител, связывающиеся с антигеном подобно молекулам антител.

[0083] Применяемое в данном документе выражение "связывающая молекула" относится в своем самом широком смысле к молекуле, которая специфически связывается с антигенной детерминантой. Неограничивающим примером антигенсвязывающей молекулы является антитело или его фрагмент, сохраняющий антиген-специфическое связывание.

[0084] Выражения "антитело" и "иммуноглобулин" можно применять в данном документе взаимозаменяемо. Антитело (или его фрагмент, вариант или производное, раскрытые в данном документе) содержит по меньшей мере вариабельный домен тяжелой цепи и по меньшей мере вариабельные домены тяжелой цепи и легкой цепи. Основные структуры иммуноглобулинов в системах позвоночных относительно хорошо изучены. См., например, Harlow et al, Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).

[0085] Как будет более подробно рассматриваться ниже, выражение "иммуноглобулин" включает разнообразные широкие классы полипептидов, между которыми можно провести различие с помощью методов биохимии. Специалисты в данной области примут во внимание, что тяжелые цепи классифицируют как гамма, мю, альфа, дельта или эпсилон (γ, μ, α, δ, ε), при этом среди них существует несколько подклассов (например, γ1-γ4). Именно природа этой цепи определяет "класс" антитела как IgG, IgM, IgA, IgG или IgE, соответственно. Подклассы иммуноглобулинов (изотипы), например, IgG1, IgG2, IgG3, IgG4, IgA1 и т.д. хорошо охарактеризованы и, как известно, придают функциональную специализацию. Модифицированные версии каждого из этих классов и изотипов легко различимы для специалиста в данной области ввиду настоящего раскрытия и, соответственно, находятся в пределах объема настоящего раскрытия.

[0086] Легкие цепи классифицируют как каппа либо лямбда (κ, λ). Тяжелая цепь каждого класса может быть связана с легкой цепью либо каппа-, либо лямбда-типа. В большинстве случаев легкие и тяжелые цепи ковалентно связаны друг с другом, а "хвостовые" части двух тяжелых цепей связаны друг с другом с помощью ковалентных дисульфидных связей или нековалентных связей, когда иммуноглобулины образуются гибридомами, B-клетками либо клетками-хозяевами, созданными с помощью методов генной инженерии. В тяжелой цепи аминокислотные последовательности проходят от N-конца на раздвоенных концах Y-конфигурации до C-конца на нижней части каждой цепи.

[0087] Как легкая, так и тяжелая цепи разделены на области структурной и функциональной гомологии. Выражения "константный" и "вариабельный" применяют в функциональном отношении. В связи с этим следует принять во внимание, что вариабельные домены частей как легкой (VL), так и тяжелой (VH) цепи определяют распознавание антигена и специфичность в его отношении. Наоборот, константные домены легкой цепи (CL) и тяжелой цепи (CH1, CH2 или CH3) придают важные биологические свойства, такие как секреция, трансплацентарная подвижность, связывание с Fc-рецепторами, связывание комплемента и т.п. Принято, что нумерация доменов константных областей возрастает по мере того, как они становятся более отдаленными от антигенсвязывающего участка или амино-конца антитела. N-концевая часть представляет собой вариабельную область, а в C-концевой части находится константная область; CH3- и CL-домены фактически включают карбокси-конец тяжелой и легкой цепи, соответственно.

[0088] Как указано выше, вариабельная область позволяет связывающей молекуле избирательно распознавать эпитопы антигенов и специфически связываться с ними. Это значит, что VL-домен и VH-домен или подмножество гипервариабельных участков (CDR) связывающей молекулы, например, антитела, объединяются с образованием вариабельной области, которая определяет трехмерный антигенсвязывающий участок. Эта четвертичная структура связывающей молекулы образует антигенсвязывающий участок, присутствующий на конце каждого плеча Y. Более конкретно, антигенсвязывающий участок определяется тремя CDR на каждой из VH- и VL-цепей.

[0089] Во встречающихся в природе антителах шесть "гипервариабельных участков" или "CDR", имеющихся в каждом антигенсвязывающем домене, являются короткими, несмежными последовательностями аминокислот, которые расположены определенным образом для образования антигенсвязывающего домена, поскольку антитело приобретает свою трехмерную конфигурацию в водной окружающей среде. Остальные аминокислоты антигенсвязывающих доменов, называемые "каркасными" областями, показывают меньшую межмолекулярную изменчивость. Каркасные области по большей части принимают конформацию β-листа, и CDR образуют петли, которые соединяются со структурой β-листа и в некоторых случаях образуют ее часть. Таким образом, каркасные области действуют с формированием остова, который обеспечивает расположение CDR в правильной ориентации с помощью нековалентных взаимодействий между цепями. Антигенсвязывающий домен, образованный расположенными CDR, определяет поверхность, комплементарную эпитопу иммунореактивного антигена. Эта комплементарная поверхность способствует нековалентному связыванию антитела с его когнатным эпитопом. По аминокислотам, включающим CDR и каркасные области, соответственно, специалист в данной области может без труда идентифицировать любую данную вариабельную область тяжелой или легкой цепи, поскольку они были точно определены (см. "Sequences of Proteins of Immunological Interest," Kabat, E., et al, U.S. Department of Health and Human Services, (1983); и Chothia and Lesk, J. Mol Biol., 196:901-917 (1987), которые включены в данный документ посредством ссылки во всей своей полноте).

[0090] В случае, когда существует два или более определения выражения, применяемого и/или принятого в данной области техники, определение выражения, применяемого в данном документе, предназначено включать все такие значения, если прямо не указано обратное. Конкретным примером является применение выражения "гипервариабельный участок" ("CDR") для описания несмежных антигенсвязывающих участков, обнаруживаемых в вариабельной области как тяжелой, так и легкой цепей полипептидов. Эта конкретная область была описана в Kabat et al, U.S. Dept. of Health and Human Services, "Sequences of Proteins of Immunological Interest" (1983) и в Chothia et al, J. Mol Biol 196:901-917 (1987), которые включены в данный документ посредством ссылки, где определения включают перекрывание или подмножества аминокислотных остатков при сравнении друг с другом. Тем не менее, применение каждого определения для обозначения CDR антитела или его вариантов предназначено находиться в пределах объема выражения, как определяется и применяется в данном документе. Соответствующие аминокислотные остатки, охватываемые CDR, как определено в каждой из вышеупомянутых ссылок, изложены ниже в таблице I для сравнения. Точное число остатков, охватываемых конкретным CDR, будет варьировать в зависимости от последовательности и размера CDR. Специалисты в данной области могут обычным образом определить, какие остатки включаются в конкретный CDR, с учетом аминокислотной последовательности вариабельной области антитела.

ТАБЛИЦА 1
Определения CDR1
Kabat Chothia
VH CDR1 31-35 26-32
VH CDR2 50-65 52-58
VH CDR3 95-102 95-102
VL CDR1 24-34 26-32
VL CDR2 50-56 50-52
VL CDR3 89-97 91-96
1Нумерация всех определений CDR в таблице 1 соответствует правилам нумерации, изложенным Kabat и соавт. (см. ниже)

[0091] Kabat и соавт. также определили систему нумерации последовательностей вариабельных доменов, применимую к любому антителу. Специалист в данной области может однозначно установить данную систему "нумерации по Kabat" для любой последовательности вариабельного домена, не опираясь ни на какие экспериментальные данные за рамками самой последовательности. Применяемое в данном документе выражение "нумерация по Kabat" относится к системе нумерации, изложенной в Kabat et al, U.S. Dept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983). Если не указано иное, ссылки на нумерацию конкретных положений аминокислотных остатков в связывающей молекуле, которая специфически связывается с Psl Pseudomonas, например, в антителе или его антигенсвязывающем фрагменте, варианте или производном, раскрытой в данном документе, соответствуют системе нумерации по Kabat.

[0092] Связывающие молекулы, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, включают, без ограничений, поликлональные, моноклональные, человеческие, гуманизированные или химерные антитела, одноцепочечные антитела, эпитоп-связывающие фрагменты, например, Fab, Fab' и F(ab')2, Fd, Fv, одноцепочечные Fv (scFv), одноцепочечные антитела, Fv, образованные за счет дисульфидных связей (sdFv), фрагменты, содержащие либо VL-, либо VH-домен, фрагменты, получаемые из экспрессионной библиотеки Fab. Молекулы scFv известны в данной области техники и описаны, например, в патенте США № 5892019. Молекулы иммуноглобулинов или антител, охватываемые настоящим раскрытием, могут принадлежать к любому типу (например, IgG, IgE, IgM, IgD, IgA и IgY), классу (например, IgG1, IgG2, IgG3, IgG4, IgA1 и IgA2) или подклассу молекул иммуноглобулинов.

[0093] Под выражением "специфически связывается" обычно подразумевают, что связывающая молекула, например, антитело или его фрагмент, вариант или производное, связывается с эпитопом посредством своего антигенсвязывающего домена, и что связывание предполагает некоторую комплементарность между антигенсвязывающим доменом и эпитопом. Согласно данному определению говорят, что связывающая молекула "специфически связывается" с эпитопом, когда она связывается с этим эпитопом посредством своего антигенсвязывающего домена более легко, чем если бы она связывалась со случайным, неродственным эпитопом. Выражение "специфичность" применяется в данном документе для определения относительной аффинности, с которой определенная связывающая молекула связывается с определенным эпитопом. Например, могут полагать, что связывающая молекула "A" имеет более высокую специфичность в отношении данного эпитопа, чем связывающая молекула "B", или могут говорить, что связывающая молекула "A" связывается с эпитопом "C" с более высокой специфичностью, чем специфичность, которой она характеризуется в отношении родственного эпитопа "D".

[0094] Под выражением "преимущественно связывается" подразумевают, что антитело специфически связывается с эпитопом более легко, чем если бы оно связывалось с родственным, сходным, гомологичным или аналогичным эпитопом. Таким образом, антитело, которое " преимущественно связывается" с данным эпитопом, будет с большей вероятностью связываться с этим эпитопом, чем с родственным эпитопом, несмотря на то, что такое антитело может вступать в перекрестную реакцию с родственным эпитопом.

[0095] В качестве неограничивающего примера связывающая молекула, например, антитело, может считаться преимущественно связывающейся с первым эпитопом, если она связывается с указанным первым эпитопом при константе диссоциации (KD), меньшей, чем KD антитела для второго эпитопа. В другом неограничивающем примере связывающая молекула, такая как антитело, может считаться преимущественно связывающейся с первым антигеном, если она связывается с первым эпитопом c аффинностью, величина которой по меньшей мере на один порядок меньше, чем KD антитела для второго эпитопа. В другом неограничивающем примере связывающая молекула может считаться преимущественно связывающейся с первым эпитопом, если она связывается с первым эпитопом с аффинностью, величина которой по меньшей мере на два порядка меньше, чем KD антитела для второго эпитопа.

[0096] В другом неограничивающем примере связывающая молекула, например, антитело или его фрагмент, вариант или производное, может считаться преимущественно связывающейся с первым эпитопом, если она связывается с первым эпитопом при скорости диссоциации (k(off)), меньшей, чем k(off) антитела для второго эпитопа. В другом неограничивающем примере связывающая молекула может считаться преимущественно связывающейся с первым эпитопом, если она связывается с первым эпитопом с аффинностью, величина которой по меньшей мере на один порядок меньше, чем k(off) антитела для второго эпитопа. В другом неограничивающем примере связывающая молекула может считаться преимущественно связывающейся с первым эпитопом, если она связывается с первым эпитопом с аффинностью, величина которой по меньшей мере на два порядка меньше, чем k(off) антитела для второго эпитопа.

[0097] Можно говорить, что связывающая молекула, например, антитело или его фрагмент, вариант или производное, раскрытая в данном документе, связывается с антигеном-мишенью, например, с полисахаридом, раскрытым в данном документе, или с его фрагментом или вариантом, при скорости диссоциации (k(off)), меньшей или равной 5×10-2 с-1, 10-2 с-1, 5×10-3 с-1 или 10-3 с-1. Можно говорить, что связывающая молекула, раскрытая в данном документе, связывается с антигеном-мишенью, например, с полисахаридом, при скорости диссоциации (k(off)), меньшей или равной 5×10-4 с-1, 10-4 с-1, 5×10-5 с-1 или 10-5 с-1, 5×10-6 с-1, 10-6 с-1, 5×10-7 с-1 или 10-7 с-1.

[0100] Можно говорить, что связывающая молекула, например, антитело или антигенсвязывающий фрагмент, вариант или производное, раскрытая в данном документе, связывается с антигеном-мишенью, например, с полисахаридом, при скорости ассоциации (k(on)), большей или равной 103 M-1 с-1, 5×103 M-1 с-1, 104 M-1 с-1 или 5×104 M-1с-1. Можно говорить, что связывающая молекула, раскрытая в данном документе, связывается с антигеном-мишенью, например, с полисахаридом, при скорости ассоциации (k(on)), большей или равной 105 M-1 с-1, 5×105 M-1 с-1, 106 M-1 с-1, или 5×106 M-1 с-1, или 107 M-1 с-1.

[0101] Говорят, что связывающая молекула, например, антитело или его фрагмент, вариант или производное, осуществляет конкурентное ингибирование связывания эталонного антитела или антигенсвязывающего фрагмента с данным эпитопом, если она преимущественно связывается с этим эпитопом до такой степени, что в какой-то мере блокирует связывание эталонного антитела или антигенсвязывающего фрагмента с эпитопом. Конкурентное ингибирование можно определить с помощью любого способа, известного в данной области техники, например, с помощью конкурентных ELISA-анализов. Можно говорить, что связывающая молекула осуществляет конкурентное ингибирование связывания эталонного антитела или антигенсвязывающего фрагмента с данным эпитопом по меньшей мере на 90%, по меньшей мере на 80%, по меньшей мере на 70%, по меньшей мере на 60% или по меньшей мере на 50%.

[0102] Применяемое в данном документе выражение "аффинность" относится к мере силы связывания отдельного эпитопа с CDR молекулы иммуноглобулина. См., например, Harlow et al, Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988), страницы 27-28. Применяемое в данном документе выражение "авидность" относится к общей стабильности комплекса между популяцией иммуноглобулинов и антигеном, то есть к функциональной прочности связывания смеси иммуноглобулинов с антигеном. См., например, Harlow, страницы 29-34. Авидность относится как к аффинности отдельных молекул иммуноглобулинов в популяции в отношении конкретных эпитопов, так и также к валентностям иммуноглобулинов и антигена. Например, взаимодействие между бивалентным моноклональным антителом и антигеном с высокоповторяющейся структурой эпитопа, такой как полимер, может характеризоваться высокой авидностью.

[0103] Связывающие молекулы или их антигенсвязывающие фрагменты, варианты или производные, раскрытые в данном документе, также могут быть описаны или определены относительно их перекрестной реактивности. Применяемое в данном документе выражение "перекрестная реактивность" относится к способности связывающей молекулы, например, антитела или его фрагмента, варианта или производного, специфичной в отношении одного антигена, реагировать со вторым антигеном; к мере родства между двумя различными антигенными веществами. Таким образом, связывающая молекула является перекрестно-реактивной, если она связывается с эпитопом, отличным от эпитопа, индуцировавшего ее образование. Перекрестно-реактивный эпитоп, как правило, содержит много таких же комплементарных структурных признаков, что и индуцирующий эпитоп, и в некоторых случаях может фактически быть более подходящим, чем исходный.

[0104] Связывающая молекула, например, антитело или его фрагмент, вариант или производное, также может быть описана или определена относительно ее аффинности связывания с антигеном. Например, связывающая молекула может связываться с антигеном при константе диссоциации KD, не превышающей 5×10-2 M, 10-2 M, 5×10-3 M, 10-3 M, 5×10-4 M, 10-4 M, 5×10-5 M, 10-5 M, 5×10-6 M, 10-6 M, 5×10-7 M, 10-7 M, 5×10-8 M, 10-8 M, 5×10-9 M, 10-9 M, 5×10-10 M, 10-10 M, 5×10-11 M, 10-11 M, 5×10-12 M, 10-12 M, 5×10-13 M, 10-13 M, 5×10-14 M, 10-14 M, 5×10-15 M или 10-15 M.

[0105] Фрагменты антител, включая одноцепочечные антитела, могут содержать вариабельную область (вариабельные области) отдельно или в комбинации со всем или частью из следующего: шарнирная область, CH1-, CH2- и CH3-домены. Также включены антигенсвязывающие фрагменты, также содержащие любую комбинацию вариабельной области (вариабельных областей) с шарнирной областью, CH1-, CH2- и CH3-доменами. Связывающие молекулы, например, антитела или их антигенсвязывающие фрагменты, раскрытые в данном документе, могут происходить из любых животных, включая птиц и млекопитающих. Антитела могут быть антителами человека, мыши, осла, кролика, козы, морской свинки, верблюда, ламы, лошади или курицы. В другом варианте осуществления вариабельная область может происходить из хрящевых рыб (например, из акул). Применяемое в данном документе выражение антитела "человека" включает антитела, имеющие аминокислотную последовательность иммуноглобулина человека, и включает антитела, выделенные из библиотек иммуноглобулинов человека или из животных, трансгенных по одному или нескольким иммуноглобулинам человека и не экспрессирующих эндогенные иммуноглобулины, как описано ниже и, например, в патенте США № 5939598 Kucherlapati et al.

[0106] Применяемое в данном документе выражение "часть тяжелой цепи" включает аминокислотные последовательности, полученные из тяжелой цепи иммуноглобулина. Связывающая молекула, например, антитело, содержащая часть тяжелой цепи, содержит по меньшей мере одно из CH1-домена, шарнирного (например, верхняя, средняя и/или нижняя шарнирная область) домена, CH2-домена, CH3-домена или их варианта или фрагмента. Например, связывающая молекула, например, антитело или его фрагмент, вариант или производное, может содержать полипептидную цепь, содержащую CH1-домен; полипептидную цепь, содержащую CH1-домен, по меньшей мере часть шарнирного домена и CH2-домен; полипептидную цепь, содержащую CH1-домен и CH3-домен; полипептидную цепь, содержащую CH1-домен, по меньшей мере часть шарнирного домена и CH3-домен, или полипептидную цепь, содержащую CH1-домен, по меньшей мере часть шарнирного домена, CH2-домен и CH3-домен. В другом варианте осуществления связывающая молекула, например, антитело или его фрагмент, вариант или производное, содержит полипептидную цепь, содержащую CH3-домен. Дополнительно, в связывающей молекуле для применения в настоящем раскрытии может недоставать по меньшей мере части CH2-домена (например, всего или части CH2-домена). Как изложено выше, специалисту в данной области будет понятно, что данные домены (например, части тяжелой цепи) можно модифицировать таким образом, чтобы они отличались по аминокислотной последовательности от встречающейся в природе молекулы иммуноглобулина.

[0107] Части тяжелой цепи связывающей молекулы, например, антитела, раскрытого в данном документе, могут быть получены из различных молекул иммуноглобулинов. Например, часть тяжелой цепи полипептида может содержать CH1-домен, полученный из молекулы IgG1, и шарнирную область, полученную из молекулы IgG3. В другом примере часть тяжелой цепи может содержать шарнирную область, полученную частично из молекулы IgG1 и частично из молекулы IgG3. В другом примере часть тяжелой цепи может содержать химерную шарнирную область, полученную частично из молекулы IgG1 и частично из молекулы IgG4.

[0108] Применяемое в данном документе выражение "часть легкой цепи" включает аминокислотные последовательности, полученные из легкой цепи иммуноглобулина. Часть легкой цепи содержит по меньшей мере одно из VL- или CL-домена.

[0109] Связывающие молекулы, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, раскрытые в данном документе, могут быть описаны или определены относительно эпитопа (эпитопов) или части (частей) антигена, например, полисахарида-мишени, который они распознают или с которым специфически связываются. Часть полисахарида-мишени, которая специфически взаимодействует с антигенсвязывающим доменом антитела, представляет собой "эпитоп" или "антигенную детерминанту". Антиген-мишень, например, полисахарид, может содержать один эпитоп, но обычно содержит по меньшей мере два эпитопа и может включать любое число эпитопов в зависимости от размера, конформации и типа антигена.

[0110] Как указывалось ранее, структуры субъединиц и трехмерная конфигурация константных областей иммуноглобулинов различных классов хорошо известны. Применяемое в данном документе выражение "VH-домен" включает амино-концевой вариабельный домен тяжелой цепи иммуноглобулина, и выражение "CH1-домен" включает первый (наиболее близкий к амино-концу) домен константной области тяжелой цепи иммуноглобулина. CH1-домен прилегает к VH-домену и является амино-концевым по отношению к шарнирной области тяжелой цепи молекулы иммуноглобулина.

[0111] Применяемое в данном документе выражение "CH2-домен" включает часть молекулы тяжелой цепи, продолжающуюся, например, от примерно остатка 244 до остатка 360 антитела согласно традиционным схемам нумерации (остатки 244-360 согласно системе нумерации по Kabat и остатки 231-340 согласно EU-системе нумерации; см. Kabat EA et al. в цитируемой работе). CH2-домен уникален в том, что он не соединен тесно с другим доменом. Наоборот, две разветвленных углеводных цепи с N-связями размещены между двумя CH2-доменами интактной нативной молекулы IgG. Также хорошо подтверждено документально, что CH3-домен продолжается от CH2-домена до C-конца молекулы IgG и содержит приблизительно 108 остатков.

[0112] Применяемое в данном документе выражение "шарнирная область" включает часть тяжелой цепи молекулы, которая присоединяет CH1-домен к CH2-домену. Эта шарнирная область содержит приблизительно 25 остатков и является гибкой, что, таким образом, позволяет двум N-концевым антигенсвязывающим областям перемещаться независимо. Шарнирные области могут быть подразделены на три различных домена: верхний, средний и нижний шарнирные домены (Roux et al, J. Immunol. 161:4083 (1998)).

[0113] Применяемое в данном документе выражение "дисульфидная связь" включает ковалентную связь, образованную между двумя атомами серы. Аминокислота цистеин содержит тиоловую группу, которая может образовывать дисульфидную связь или мостик со второй тиоловой группой. В большинстве встречающихся в природе молекул IgG CH1- и CL-области связаны дисульфидной связью, а две тяжелые цепи связаны двумя дисульфидными связями в положениях, соответствующих 239 и 242 согласно системе нумерации по Kabat (положение 226 или 229 согласно EU-системе нумерации).

[0114] Применяемое в данном документе выражение "химерное антитело" будет означать любое антитело, где иммунореактивная область или участок получены или происходят из одного вида, а константная область (которая может быть интактной, неполной или модифицированной) получена из второго вида. В некоторых вариантах осуществления область или участок, связывающиеся с мишенью, будут происходить из источника, не являющегося человеком (например, из мыши или примата), а константная область - из человека.

[0115] Применяемое в данном документе выражение "сконструированное антитело" относится к антителу, в котором вариабельный домен в тяжелой или в легкой цепи либо в обеих изменен путем по меньшей мере частичного замещения одного или нескольких CDR из антитела с известной специфичностью и, при необходимости, путем частичного замещения каркасной области и изменения последовательностей. Хотя CDR могут быть получены из антитела того же класса или даже подкласса, что и антитело, из которого получены каркасные области, предусматривается, что CDR будут получены из антитела другого класса и предпочтительно из антитела от другого вида. Сконструированное антитело, в котором один или несколько "донорных" CDR из антитела, не являющегося антителом человека, с известной специфичностью пересаживают в каркасную область тяжелой или легкой цепи человека, называется в данном документе "гуманизированным антителом". Для передачи антигенсвязывающей способности одного вариабельного домена другому может не быть необходимым замещение всех CDR полными CDR из донорной вариабельной области. Наоборот, может быть необходимым только перенос тех остатков, которые являются необходимыми для поддерживания активности участка, связывающегося с мишенью. С учетом пояснений, изложенных, например, в патентах США № 5585089, 5693761, 5693762 и 6180370, получение функционального сконструированного или гуманизированного антитела путем проведения стандартных экспериментов либо путем тестирования по методу проб и ошибок будет находиться вполне в пределах компетенции специалиста в данной области техники.

[0116] Применяемое в данном документе выражение "правильно свернутый полипептид" включает полипептиды (например, антитела к Psl Pseudomonas), в которых все функциональные домены, содержащие полипептид, являются явно активными. Применяемое в данном документе выражение "неправильно свернутый полипептид" включает полипептиды, в которых по меньшей мере один из функциональных доменов полипептида не является активным. В одном варианте осуществления правильно свернутый полипептид содержит полипептидные цепи, связанные по меньшей мере одной дисульфидной связью, и напротив, неправильно свернутый полипептид содержит полипептидные цепи, не связанные по меньшей мере одной дисульфидной связью.

[0117] Применяемое в данном документе выражение "сконструированный" включает воздействие на молекулы нуклеиновых кислот или полипептидов с помощью способов синтеза (например, с помощью рекомбинантных методик, синтеза пептидов in vitro, с помощью ферментативного или химического сочетания пептидов или некоторых комбинаций данных методик).

[0118] Применяемые в данном документе выражения "связанный", "слитый" или "слияние" применяют взаимозаменяемо. Эти выражения относятся к соединению двух или более элементов или компонентов с помощью любых способов, включая способы химической коньюгации или рекомбинации. "Внутрирамочное слияние" относится к соединению двух или более открытых рамок считывания полинуклеотидов (ORF) с образованием непрерывной более длинной ORF таким образом, чтобы поддерживать правильную трансляционную рамку считывания исходных ORF. Таким образом, рекомбинантный белок слияния представляет собой один белок, содержащий два или более сегмента, которые соответствуют полипептидам, кодируемым исходными ORF (такие сегменты обычно не соединены таким образом в природе). Хотя рамка считывания делается, таким образом, непрерывной во всех слитых сегментах, сегменты могут быть физически или пространственно разделены с помощью, например, внутрирамочной линкерной последовательности. Например, полинуклеотиды, кодирующие CDR вариабельной области иммуноглобулина, могут быть слитыми, внутрирамочными, но разделенными полинуклеотидом, кодирующим по меньшей мере одну каркасную область иммуноглобулина или дополнительные области CDR, поскольку "слитые" CDR подвергаются котрансляции как часть непрерывного полипептида.

[0119] В отношении полипептидов "линейная последовательность" или "последовательность" представляет собой порядок аминокислот в полипептиде в направлении от амино-конца до карбокси-конца, при котором остатки, являющиеся соседними относительно друг друга в последовательности, являются смежными в первичной структуре полипептида.

[0120] Выражение "экспрессия", применяемое в данном документе, относится к способу, с помощью которого ген вырабатывает биохимическое вещество, например, полипептид. Способ включает любое проявление функционального присутствия гена в клетке, включая, без ограничений, нокдаун гена, а также как транзиентную экспрессию, так и стабильную экспрессию. Он включает, без ограничений, транскрипцию гена в матричную РНК (мРНК) и трансляцию таких мРНК в полипептид (полипептиды). Если конечный желаемый продукт представляет собой биохимическое вещество, экспрессия включает создание таких биохимических веществ и любых предшественников. При экспрессии гена вырабатывается "продукт гена". Как применяется в данном документе, продуктом гена может быть либо нуклеиновая кислота, например, матричная РНК, вырабатываемая путем транскрипции гена, либо полипептид, транслируемый из транскрипта. Продукты генов, описываемые в данном документе, дополнительно включают нуклеиновые кислоты с посттранскрипционными модификациями, например, полиаденилированием, или полипептиды с посттрансляционными модификациями, например, метилированием, гликозилированием, добавлением липидов, ассоциацией с другими белковыми субъединицами, протеолитическим расщеплением и т.п.

[0121] Применяемые в данном документе выражения "лечить" или "лечение" относятся как к терапевтическому лечению, так и к мерам профилактики или предупреждения, где целью является предупреждение или замедление (облегчение) нежелательного физиологического изменения, инфекции или нарушения. Благоприятные или желаемые клинические результаты включают, без ограничений, смягчение симптомов, уменьшение степени тяжести заболевания, стабилизацию (т.е. отсутствие ухудшения) состояния заболевания, устранение или ослабление возбудителя инфекции, такого как P. aeruginosa, у субъекта, задержку или замедление прогрессирования заболевания, улучшение или временное облегчение состояния заболевания и ремиссию (частичную либо полную), поддающиеся или неподдающиеся выявлению. "Лечение" может также означать увеличение выживаемости по сравнению с ожидаемой выживаемостью в том случае, если лечение не получалось. Нуждающиеся в лечении включают таковых, уже имеющих инфекцию, состояние или нарушение, а также таковых, имеющих предрасположенность к состоянию или нарушению, или таковых, у которых состояние или нарушение нужно предупреждать, например, у ожоговых пациентов или пациентов с ослабленным иммунитетом, восприимчивых к инфекции, вызываемой P. aeruginosa.

[0122] Под "субъектом", или "лицом", или "животным", или "пациентом", или "млекопитающим" подразумевается любой субъект, в частности, субъект-млекопитающее, для которого желаемыми являются диагностика, прогнозирование или терапия. Субъекты-млекопитающие включают людей, домашних животных, сельскохозяйственных животных и зоопарковых, используемых в спорте или комнатных животных, таких как собаки, кошки, морские свинки, кролики, крысы, мыши, лошади, крупный рогатый скот, коровы, медведи и т.д.

[0123] Применяемые в данном документе фразы, такие как "субъект, который может получить пользу от введения антитела к Psl Pseudomonas" и "животное, нуждающееся в лечении" включают субъектов, таких как субъекты-млекопитающие, которые могут получить пользу от введения антител к Psl Pseudomonas, применяемых, например, для выявления Psl Pseudomonas (например, для диагностической процедуры), и/или от лечения, т.е. временного облегчения или предупреждения заболевания, с помощью антитела к Psl Pseudomonas. Как более подробно описано в данном документе, антитело к Psl Pseudomonas можно применять в неконъюгированной форме или может быть конъюгированным, например, с лекарственным средством, пролекарством или радиоактивным изотопом.

II. СВЯЗЫВАЮЩИЕ МОЛЕКУЛЫ

[0124] Один вариант осуществления направлен на выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, где связывающая молекула (a) может ингибировать прикрепление Pseudomonas aeruginosa к эпителиальным клеткам, (b) может способствовать, опосредовать или усиливать опсонофагоцитарное уничтожение (OPK) P. aeruginosa или (c) может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам и может способствовать, опосредовать или усиливать OPK P. aeruginosa. В определенных вариантах осуществления связывающая молекула или ее фрагмент, описанные выше, могут представлять собой антитело или его антигенсвязывающий фрагмент, как, например, Cam-003 или WapR-004.

[0125] Применяемое в данном документе выражение "антигенсвязывающий домен" включает участок, который специфически связывается с эпитопом антигена (например, с эпитопом Psl Pseudomonas). Антигенсвязывающий домен антитела обычно включает по меньшей мере часть вариабельной области тяжелой цепи иммуноглобулина и по меньшей мере часть вариабельной области легкой цепи иммуноглобулина. Участок связывания, образованный этими вариабельными областями, определяет специфичность антитела.

[0126] Настоящее изобретение более конкретно направлено на выделенную связывающую молекулу, например, на антитело или его антигенсвязывающий фрагмент, которая специфически связывается с тем же эпитопом Psl Pseudomonas, что и антитело или его антигенсвязывающий фрагмент, содержащий вариабельную область тяжелой цепи (VH) и вариабельную область легкой цепи (VL) WapR-004, Cam-003, Cam-004 или Cam-005.

[0127] Дополнительно включена выделенная связывающая молекула, например, антитело или его фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR-004, Cam-003, Cam-004 или Cam-005.

[0128] Один вариант осуществления направлен на выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с тем же эпитопом Psl Pseudomonas, что и антитело или его антигенсвязывающий фрагмент, содержащий VH- и VL-область WapR-001, WapR-002 или WapR-003.

[0129] Также включена выделенная связывающая молекула, например, антитело или его фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR-001, WapR-002 или WapR-003.

[0130] Дополнительно включена выделенная связывающая молекула, например, антитело или его фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR-016.

[0131] Также включена выделенная связывающая молекула, например, антитело или его фрагмент, которая специфически связывается с Psl Pseudomonas и осуществляет конкурентное ингибирование связывания Psl Pseudomonas с антителом или его антигенсвязывающим фрагментом, содержащими VH и VL WapR16.

[0132] Способы создания антител хорошо известны в данной области техники и описаны в данном документе. Как только получены антитела к различным фрагментам Psl Pseudomonas или к таковому полной длины без сигнальной последовательности, можно определять то, какими именно являются аминокислоты или эпитоп Psl Pseudomonas, с которыми связывается антитело или антигенсвязывающий фрагмент, с помощью протоколов картирования эпитопов, описываемых в данном документе, а также способов, известных в данной области техники (например, сэндвич-ELISA двойных антител, описанный в "Chapter 11 - Immunology," Current Protocols in Molecular Biology, Ed. Ausubel et al., v.2, John Wiley & Sons, Inc. (1996)). Дополнительные протоколы картирования эпитопов можно найти в Morris, G. Epitope Mapping Protocols, New Jersey: Humana Press (1996), оба из которых включены в данный документ посредством ссылки во всей своей полноте. Картирование эпитопов можно также выполнять с помощью коммерчески доступных средств (т.е. ProtoPROBE, Inc. (Милуоки, Висконсин)).

[0133] В определенных аспектах настоящее раскрытие направлено на связывающую молекулу, например, антитело или его фрагмент, вариант или производное, которая специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся константой диссоциации (KD) меньшей, чем KD для указанного эталонного моноклонального антитела.

[0134] В определенных вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его антигенсвязывающий фрагмент, вариант или производное, раскрытая в данном документе, специфически связывается по меньшей мере с одним эпитопом Psl, т.е. связывается с таким эпитопом более легко, чем если бы она связывалась с неродственным или случайным эпитопом; преимущественно связывается по меньшей мере с одним эпитопом Psl, т.е. связывается с таким эпитопом более легко, чем если бы она связывалась с родственным, сходным, гомологичным или аналогичным эпитопом; осуществляет конкурентное ингибирование связывания эталонного антитела, которое само специфически или преимущественно связывается с определенным эпитопом Psl; или связывается по меньшей мере с одним эпитопом Psl с аффинностью, характеризующейся константой диссоциации KD меньшей чем около 5×10-2 M, около 10-2 M, около 5×10-3 M, около 10-3 M, около 5×10-4 M, около 10-4 M, около 5×10-5 M, около 10-5 M, около 5×10-6 M, около 10-6 M, около 5×10-7 M, около 10-7 M, около 5×10-8 M, около 10-8 M, около 5×10-9 M, около 10-9 M, около 5×10-10 M, около 10-10 M, около 5×10-11 M, около 10-11 M, около 5×10-12 M, около 10-12 M, около 5×10-13 M, около 10-13 M, около 5×10-14 M, около 10-14 M, около 5×10-15 M или около 10-15 M.

[0135] Применяемое в отношении констант диссоциации, характеризующих связывание, выражение "около" предусматривает степень изменчивости, характерную для способов, используемых для измерения аффинности антител. Например, в зависимости от уровня точности применяемых измерительных приборов, среднеквадратической ошибки на основе числа измеренных образцов и ошибки округления выражение "около 10-2 M" может включать, например, от 0,05 M до 0,005 M.

[0136] В конкретных вариантах осуществления связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, вариант или производное, связывается с Psl Pseudomonas при скорости диссоциации (k(off)), меньшей или равной 5×10-2 с-1, 10-2 с-1, 5×10-3 с-1 или 10-3 с-1 . Альтернативно, антитело или его антигенсвязывающий фрагмент, вариант или производное связываются с Psl Pseudomonas при скорости диссоциации (k(off)), меньшей или равной 5×10-4 с-1, 10-4 с-1, 5×10-5 с-1 или 10-5 с-1, 5×10-6с-1, 10-6 с-1, 5×10-7 с-1 или 10-7 с-1.

[0137] В других вариантах осуществления связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, вариант или производное, раскрытые в данном документе, связывается с Psl Pseudomonas при скорости ассоциации (k(on)), большей или равной 103 M-1 с-1, 5×103 M-1 с-1, 104 M-1 с-1 или 5×104 M-1 с-1. Альтернативно, связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, вариант или производное, раскрытые в данном документе, связывается с Psl Pseudomonas при скорости ассоциации (k(on)), большей или равной 105 M-1 с-1, 5×105 M-1 с-1, 106 M-1 с-1, или 5×106 M-1 с-1, или 107 M-1 с-1.

[0138] В различных вариантах осуществления молекула, связывающаяcя с Psl Pseudomonas, например, антитело или его антигенсвязывающий фрагмент, вариант или производное, описываемые в данном документе, способствует опсонофагоцитарному уничтожению Pseudomonas или ингибирует связывание Pseudomonas с эпителиальными клетками. В определенных вариантах осуществления, описываемых в данном документе, Psl-мишень Pseudomonas представляет собой Psl Pseudomonas aeruginosa. В других вариантах осуществления определенные связывающие молекулы, описываемые в данном документе, могут связываться с молекулами родственных по структуре полисахаридов независимо от их источника. Такие Psl-подобные молекулы, как следует ожидать, являются идентичными или обладают достаточным структурным родством по отношению к Psl P. aeruginosa, что позволяет осуществлять специфическое распознавание одной или несколькими раскрытыми связывающими молекулами. Например, определенные связывающие молекулы, описываемые в данном документе, могут связываться с Psl-подобными молекулами, вырабатываемыми другим видом бактерий, например, с Psl-подобными молекулами, вырабатываемыми другим видом Pseudomonas, например, Pseudomonas fluorescens, Pseudomonas putida или Pseudomonas alcaligenes. Альтернативно, определенные связывающие молекулы, описываемые в данном документе, могут связываться с Psl-подобными молекулами, вырабатываемыми синтетически или клетками-хозяевами, генетически модифицированными с целью получения Psl-подобных молекул.

[0139] Если конкретно не отмечено, применяемое в данном документе выражение "его фрагмент" в отношении связывающей молекулы, например, антитела, относится к антигенсвязывающему фрагменту, т.е. части антитела, которая специфически связывается с антигеном.

[0140] Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, могут содержать константную область, опосредующую одну или несколько эффекторных функций. Например, связывание C1-компонента системы комплемента с константной областью антитела может активировать систему комплемента. Активация комплемента важна в опсонизации и лизисе патогенов. Активация комплемента также стимулирует воспалительный ответ и может также быть вовлечена в аутоиммунные реакции гиперчувствительности. Дополнительно, антитела связываются с рецепторами различных клеток посредством Fc-области, при этом участок связывания Fc-рецептора Fc-области антитела связывается с Fc-рецептором (FcR) клетки. Существует ряд Fc-рецепторов, являющихся специфичными в отношении антител различных классов, включая IgG (гамма-рецепторы), IgE (эпсилон-рецепторы), IgA (альфа-рецепторы) и IgM (мю-рецепторы). Связывание антитела с Fc-рецепторами на поверхностях клеток запускает ряд важных и разнообразных биологических ответов, включая поглощение и разрушение нагруженных антителами частиц, клиренс иммунных комплексов, лизис нагруженных антителами клеток-мишеней клетками-киллерами (называемый антителозависимой клеточно-опосредованной цитотоксичностью или ADCC), высвобождение медиаторов воспаления, плацентарный перенос и регуляцию выработки иммуноглобулинов.

[0141] Соответственно, определенные варианты осуществления, раскрытые в данном документе, включают молекулу, связывающуюся с Psl Pseudomonas, например, антитело или его антигенсвязывающий фрагмент, вариант или производное, в которой по меньшей мере доля одного или нескольких доменов константной области была удалена или иным образом изменена так, чтобы обеспечивать желаемые биохимические характеристики, такие как сниженные эффекторные функции, способность к димеризации за счет нековалентных связей, повышенная способность к локализации в месте опухоли, сниженный период полувыведения из сыворотки или повышенный период полувыведения из сыворотки по сравнению с полным, неизмененным антителом, обладающим приблизительно такой же иммуногенностью. Например, определенные связывающие молекулы, описываемые в данном документе, являются антителами с удаленными доменами, которые содержат полипептидную цепь, подобную тяжелой цепи иммуноглобулина, но в которых недостает по меньшей мере части одного или нескольких доменов тяжелой цепи. Например, в определенных антителах будет удален один целый домен константной области модифицированного антитела, например, будет удален весь CH2-домен или его часть.

[0142] Модифицированные формы молекул, связывающихся с Psl Pseudomonas, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, могут быть созданы из полных антител-предшественников или родительских антител с применением методик, известных в данной области техники. Иллюстративные методики рассматриваются в другом месте в данном документе.

[0143] В определенных вариантах осуществления как вариабельные, так и константные области молекул, связывающихся с Psl Pseudomonas, например, антител или антигенсвязывающих фрагментов, являются полностью человеческими. Полностью человеческие антитела могут быть созданы с помощью методик, известных в данной области техники и описываемых в данном документе. Например, полностью человеческие антитела к конкретному антигену можно получить путем введения антигена трансгенному животному, модифицированному с целью получения таких антител в ответ на антигенную стимуляцию, но эндогенные локусы которого деактивированы. Иллюстративные методики, которые можно применять для создания таких антител, описаны в патентах США 6150584; 6458592; 6420140. Другие методики известны в данной области техники. Полностью человеческие антитела можно получать подобным образом с помощью различных технологий дисплея, например, фагового дисплея или других систем вирусного дисплея, описываемых более подробно в другом месте в данном документе.

[0144] Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, раскрытые в данном документе, могут быть созданы или произведены с помощью методик, известных в данной области техники. В определенных вариантах осуществления связывающие молекулы или их фрагменты являются "полученными рекомбинантным путем", т.е. получены с помощью технологии рекомбинантных ДНК. Иллюстративные методики создания молекул антител или их фрагментов рассматриваются более подробно в другом месте в данном документе.

[0145] В определенных молекулах, связывающихся с Psl Pseudomonas, например, антителах или их антигенсвязывающих фрагментах, вариантах или производных, описываемых в данном документе, Fc-часть можно подвергнуть мутации для уменьшения эффекторной функции с помощью методик, известных в данной области техники. Например, делеция или инактивация (с помощью точечных мутаций или других средств) домена константной области может уменьшать связывание циркулирующего модифицированного антитела с Fc-рецепторами, таким образом повышая локализацию в опухоли. В других случаях может быть так, что модификации константной области умеряют связывание комплемента и таким образом уменьшают период полувыведения из сыворотки и неспецифическую ассоциацию конъюгированного цитотоксина. Еще несколько модификаций константной области можно применять для модификации дисульфидных связей или олигосахаридных фрагментов, что дает возможность увеличения локализации в связи с повышенной специфичностью по отношению к антигену или гибкостью антитела. Полученные в результате физиологический профиль, биодоступность и другие биохимические эффекты модификаций, такие как локализация, биораспределение и период полувыведения из сыворотки, можно легко измерить и оценить количественно с применением хорошо известных иммунологических методик без ненужных экспериментов.

[0146] В определенных вариантах осуществления молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, не будут вызывать вредный иммунный ответ у животного, подлежащего лечению, например, у человека. В одном варианте осуществления молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, модифицированы с целью уменьшения их иммуногенности с помощью методик, принятых в данной области техники. Например, антитела могут быть гуманизированными, деиммунизированными, или могут быть созданы химерные антитела. Эти типы антител получены из антитела, не являющегося антителом человека, обычно из антитела мыши или примата, которое сохраняет или в значительной степени сохраняет антигенсвязывающие свойства родительского антитела, но которое является менее иммуногенным у людей. Этого можно достичь разными способами, включая (a) пересадку целых вариабельных доменов, полученных не от человека, в константные области, полученные от человека, с образованием химерных антител; (b) пересадку по меньшей мере части одного или нескольких гипервариабельных участков (CDR), полученных не от человека, в каркасные и константные области, полученные от человека, с сохранением критически важных каркасных остатков или без такового или (c) трансплантацию целых вариабельных доменов, полученных не от человека, однако, с "маскировкой" их участком, подобным полученному от человека, путем замещения поверхностных остатков. Такие способы раскрыты в Morrison et al., Proc. Natl. Acad. Sci 81:6851-6855 (1984); Morrison et al, Adv. Immunol. 44:65-92 (1988); Verhoeyen et al, Science 239: 1534-1536 (1988); Padlan, Molec. Immun. 28:489-498 (1991); Padlan, Molec. Immun. 31: 169-217 (1994) и патентах США № 5585089, 5693761, 5693762 и 6190370, все из которых включены в данный документ во всей своей полноте посредством ссылки.

[0147] Деиимунизацию также можно применять для уменьшения иммуногенности антитела. Применяемое в данном документе выражение "деиммунизация" включает изменение антитела с целью модификации T-клеточных эпитопов (см., например, W09852976A1, WO0034317A2). Например, анализируют последовательности VH и VL исходного антитела и составляют "карту" T-клеточных эпитопов человека из каждой V-области, показывающую расположение эпитопов по отношению к гипервариабельным участкам (CDR) и другим ключевым остаткам в последовательности. Отдельные T-клеточные эпитопы из карты T-клеточных эпитопов анализируют в целях идентификации альтернативных аминокислотных замен с низким риском изменения активности конечного антитела. Ряд альтернативных последовательностей VH и VL разработаны таким образом, что они содержат комбинации аминокислотных замен, и эти последовательности впоследствии включают в ряд связывающих полипептидов, например, антител или их антигенсвязывающих фрагментов, специфичных в отношении Psl Pseudomonas, раскрытых в данном документе, которые затем тестируют в отношении функции. Гены полной тяжелой и легкой цепей, содержащие последовательности, кодирующие модифицированную V-область и C-область человека, затем клонируют в векторы экспрессии, и полученные в результате плазмиды вводят в линии клеток для получения полного антитела. Антитела затем сравнивают в соответствующих биохимических и биологических анализах и идентифицируют оптимальный вариант.

[0148] Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их антигенсвязывающие фрагменты, варианты или производные, можно образовать с помощью любого подходящего способа, известного в данной области техники. Поликлональные антитела к антигену, представляющему интерес, можно получить с помощью различных методов, хорошо известных в данной области техники. Например, антитело к Psl Pseudomonas или его антигенсвязывающий фрагмент можно вводить различным животным-хозяевам, включая, без ограничений, кроликов, мышей, крыс, кур, хомяков, коз, ослов и т.д., с индуцированием выработки сыворотки, содержащей поликлональные антитела, специфичные в отношении антигена. Для усиления иммунного ответа можно применять различные адъюванты в зависимости от вида-хозяина, и они включают, без ограничений, адъювант Фрейнда (полный и неполный), минеральные гели, такие как гидроксид алюминия, поверхностно-активные вещества, такие как лизолецитин, полиолы-плюроники, полианионы, пептиды, масляные эмульсии, гемоцианин лимфы улитки, динитрофенол и потенциально применимые адъюванты для человека, такие как BCG (бацилла Кальметта-Герена) и Corynebacterium parvum. Такие адъюванты также хорошо известны в данной области техники.

[0149] Моноклональные антитела можно получать при помощи широкого разнообразия методик, известных в данной области техники, включая применение гибридомной, рекомбинантной технологий и технологии фагового дисплея или их комбинации. Например, моноклональные антитела можно получать при помощи гибридомных методик, включая таковые, известные в данной области техники и изложенные, например, в Harlow et al, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2nd ed. (1988).

[0150] ДНК, кодирующую антитела или фрагменты антител (например, антигенсвязывающие участки), также можно получить из библиотек антител, таких как фаг-дисплейные библиотеки. В частности, такой фаг можно использовать для отображения антигенсвязывающих доменов, экспрессирующихся в репертуаре или комбинаторной библиотеке антител (например, человека или мыши). Фаг, экспрессирующий антигенсвязывающий домен, который связывается с антигеном, представляющим интерес, можно отобрать или идентифицировать при помощи антигена, например, применяя меченый антиген или антиген, связанный с твердой поверхностью или гранулой или захваченный на них. Фаг, применяемый в этих способах, обычно является нитевидным фагом, включающим связывающие домены fd и M13, экспрессируемые фагом, при этом домены scFv, Fab, Fv OE DAB (отдельная Fv-область легкой или тяжелой цепи) или стабилизированные дисульфидными связями Fv-домены антитела слиты рекомбинантным путем с белком, кодируемым либо геном III, либо геном VIII фага. Иллюстративные способы изложены, например, в EP 368 684 B1; патенте США 5969108, Hoogenboom, H.R. and Chames, Immunol. Today 21:371 (2000); Nagy et al. Nat. Med. 8:801 (2002); Huie et al., Proc. Natl. Acad. Sci. USA 98:2682 (2001); Lui et al, J. Mol. Biol. 315:1063 (2002), все из которых включены в данный документ посредством ссылки. В некоторых публикациях (например, Marks et al, Bio/Technology 10:779-783 (1992)) было описано получение высокоаффинных антител человека с помощью шаффлинга цепей, а также комбинаторного инфицирования и in vivo рекомбинации в качестве стратегии конструирования больших фаговых библиотек. В другом варианте осуществления можно применять рибосомный дисплей для замены бактериофага в качестве платформы для дисплея (см., например, Hanes et al., Nat. Biotechnol. 18: 1287 (2000); Wilson et al., Proc. Natl. Acad. Sci. USA 98:3750 (2001); или Irving et al., J. Immunol. Methods 248:31 (2001)). В еще одном варианте осуществления библиотеки на поверхности клеток можно подвергнуть скринингу в отношении антител (Boder et al., Proc. Natl. Acad. Sci. USA 97: 10701 (2000); Daugherty et al., J. Immunol. Methods 243:211 (2000)). Такие методы обеспечивают альтернативы традиционным гибридомным методикам выделения и последующего клонирования моноклональных антител.

[0151] В способах фагового дисплея функциональные домены антител отображены на поверхности фаговых частиц, несущих последовательности полинуклеотидов, кодирующие их. Например, последовательности ДНК, кодирующие VH- и VL-области, амплифицируют из библиотек кДНК животных (например, из библиотек кДНК лимфоидной ткани человека или мыши) или библиотек синтетических кДНК. В некоторых вариантах осуществления ДНК, кодирующие VH- и VL-области, соединяют с помощью scFv-линкера путем ПЦР и клонируют в вектор-фагмиду (например, pCANTAB 6 или pComb 3 HSS). Вектор вводят в E. coli путем электропорации, и E. coli инфицируют фагом-помощником. Фаг, применяемый в этих способах, обычно является нитевидным фагом, в том числе fd и M13, и VH- или VL-области, как правило, слиты рекомбинантным путем либо с геном III, либо с геном VIII фага. Фаг, экспрессирующий антигенсвязывающий домен, который связывается с антигеном, представляющим интерес (т.е. Psl Pseudomonas), можно отобрать или идентифицировать при помощи антигена, например, применяя меченый антиген или антиген, связанный с твердой поверхностью или гранулой или захваченный на них.

[0152] Дополнительные примеры способов фагового дисплея, которые можно применять для создания антител, включают раскрытые в Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187:9-18 (1997); Burton et al, Advances in Immunology 57:191-280 (1994); заявке по PCT № PCT/GB91/01134; публикациях по PCT WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401 и патентах США № 5698426; 5223409; 5403484; 5580717; 5427908; 5750753; 5821047; 5571698; 5427908; 5516637; 5780225; 5658727; 5733743 и 5969108; все из которых включены в данный документ во всей своей полноте посредством ссылки.

[0153] Как описано в вышеприведенных источниках и нижеследующих примерах, после отбора фага можно выделять области, кодирующие антитела, из фага и применять для образования полного антитела, включая антитела человека или любой другой желаемый антигенсвязывающий фрагмент, и экспрессировать в любом желаемом хозяине, включая клетки млекопитающих, клетки насекомых, клетки растений, дрожжи и бактерии. Например, также можно использовать методики рекомбинантного получения Fab-, Fab'- и F(ab')2-фрагментов, применяя способы, известные в данной области техники, такие как раскрытые в публикации по PCT WO 92/22324; Mullinax et al, BioTechniques 12(6):864-869 (1992); и Sawai et al, AJRI 34:26-34 (1995); и Better et al, Science 240:1041-1043 (1988) (указанные источники включены во всей своей полноте посредством ссылки).

[0154] Примеры методик, которые можно применять для получения одноцепочечных Fv и антител, включают методики, описанные в патентах США № 4946778 и 5258498; Huston et al, Methods in Enzymology 203:46-88 (1991); Shu et al, PNAS 90:7995-7999 (1993); и Skerra et al, Science 240:1038-1040 (1988). В определенных вариантах осуществления, таких как терапевтическое введение, можно применять химерные, гуманизированные антитела или антитела человека. Химерное антитело представляет собой молекулу, в которой различные части антитела получены от различных видов животных, как, например, антитела, имеющие вариабельную область, полученную из моноклонального антитела мыши, и константную область из иммуноглобулина человека. Способы получения химерных антител известны в данной области техники. См., например, Morrison, Science 229: 1202 (1985); Oi et al, BioTechniques 4:214 (1986); Gillies et al, J. Immunol. Methods 125:191-202 (1989); патенты США № 5807715; 4816567 и 4816397, которые включены в данный документ во всей своей полноте посредством ссылки. Гуманизированные антитела представляют собой молекулы антител, полученные из антитела от вида, отличного от человека, которое связывается с желаемым антигеном, имеющие один или несколько гипервариабельных участков (CDR) от вида, отличного от человека, и каркасные области из молекулы иммуноглобулина человека. Часто каркасные остатки в каркасных областях от человека замещены соответствующими остатками из антитела, являющегося донором CDR, для изменения, предпочтительно улучшения, связывания с антигеном. Эти замены в каркасных областях идентифицируют с помощью способов, хорошо известных в области техники, например, путем моделирования взаимодействий CDR и каркасных остатков для идентификации каркасных остатков, важных для связывания с антигеном, и сравнения последовательностей для идентификации необычных каркасных остатков в конкретных положениях (см., например, Queen et al, патент США № 5585089; Riechmann et al, Nature 332:323 (1988), которые включены в данный документ во всей своей полноте посредством ссылки). Антитела можно гуманизировать при помощи разнообразных методик, известных в данной области техники, в том числе, например, пересадки CDR (EP 239400; публикация по PCT WO 91/09967; патенты США № 5225539; 5530101 и 5585089), гиперхимеризации или изменения поверхности (EP 592106; EP 519596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al, Protein Engineering 7(6):805-814 (1994); Roguska et al, PNAS 91:969-973 (1994)) и шаффлинга цепей (патент США № 5565332).

[0155] Полностью человеческие антитела являются особенно желательными для терапевтического лечения пациентов-людей. Антитела человека можно создать с помощью разнообразных способов, известных в данной области техники, в том числе способов фагового дисплея, описанных выше, применяя библиотеки антител, полученные из последовательностей иммуноглобулина человека. См. также патенты США № 4444887 и 4716111 и публикации по PCT WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735 и WO 91/10741; все из которых включены в данный документ во всей своей полноте посредством ссылки.

[0156] Антитела человека также можно получать, применяя трансгенных мышей, не способных к экспрессии функциональных эндогенных иммуноглобулинов, но в которых может происходить экспрессия генов иммуноглобулинов человека. Например, генные комплексы тяжелых и легких цепей иммуноглобулинов человека можно вводить случайно или с помощью гомологичной рекомбинации в эмбриональные стволовые клетки мышей. В дополнение, различные компании могут заниматься обеспечением антител человека, получаемых в трансгенных мышах, направленных против выбранного антигена, с применением технологии, подобной описанной выше.

[0157] Полностью человеческие антитела, распознающие выбранный эпитоп, можно образовывать с помощью методики, называемой "управляемой селекцией". В этом подходе выбранное моноклональное антитело, не являющееся антителом человека, например, антитело мыши, применяют для управления селекцией полностью человеческого антитела, распознающего тот же эпитоп (Jespers et al., Bio/Technology 12:899-903 (1988). См. также патент США № 5565332).

[0158] В другом варианте осуществления ДНК, кодирующую желаемые моноклональные антитела, можно без труда выделить и секвенировать с помощью традиционных методов (например, с помощью применения олигонуклеотидных зондов, способных к специфическому связыванию с генами, кодирующими тяжелые и легкие цепи антител мыши). Выделенные и субклонированные клетки гибридомы или выделенный фаг, например, могут служить источником такой ДНК. После выделения ДНК можно поместить в векторы экспрессии, которые затем вводят путем трансфекции в прокариотические или эукариотические клетки-хозяева, такие как клетки E. coli, клетки COS обезьяны, клетки яичников китайского хомячка (CHO) или клетки миеломы, в которых не вырабатываются иммуноглобулины иным путем. Более конкретно, выделенную ДНК (которая может быть синтетической, как описано в данном документе) можно применять для клонирования последовательностей константных и вариабельных областей для производства антител, как описано в патенте США № 5658570 Newman et al., заявка на который была подана 25 января 1995 г., включенном в данный документ посредством ссылки. Трансформированные клетки, экспрессирующие желаемое антитело, можно выращивать в относительно больших количествах, обеспечивая поставки иммуноглобулина для клинических и коммерческих нужд.

[0159] В одном варианте осуществления выделенная связывающая молекула, например, антитело, содержит по меньшей мере один CDR тяжелой или легкой цепи молекулы антитела. В другом варианте осуществления выделенная связывающая молекула содержит по меньшей мере два CDR из одной или нескольких молекул антител. В другом варианте осуществления выделенная связывающая молекула содержит по меньшей мере три CDR из одной или нескольких молекул антител. В другом варианте осуществления выделенная связывающая молекула содержит по меньшей мере четыре CDR из одной или нескольких молекул антител. В другом варианте осуществления выделенная связывающая молекула содержит по меньшей мере пять CDR из одной или нескольких молекул антител. В другом варианте осуществления выделенная связывающая молекула согласно настоящему описанию включает по меньшей мере шесть CDR из одной или нескольких молекул антител.

[0160] В конкретном варианте осуществления аминокислотную последовательность вариабельных доменов тяжелых и/или легких цепей можно изучить с целью идентификации последовательностей гипервариабельных участков (CDR) с помощью способов, хорошо известных в данной области техники, например, с помощью сравнения с известными аминокислотными последовательностями других вариабельных областей тяжелой и легкой цепей для определения областей гипервариабельности последовательностей. Применяя стандартные методики рекомбинантных ДНК, можно вставить один или несколько CDR в каркасные области, например, в каркасные области от человека, для гуманизации антитела, не являющегося антителом человека. Каркасные области могут быть встречающимися в природе или консенсусными каркасными областями и предпочтительно каркасными областями от человека (см., например, Chothia et al., J. Mol Biol. 278:457-479 (1998) в отношении перечня каркасных областей от человека). Полинуклеотид, образованный комбинацией каркасных областей и CDR, кодирует антитело, которое специфически связывается по меньшей мере с одним эпитопом желаемого антигена, например, Psl. В каркасных областях могут быть произведены одна или несколько аминокислотных замен, и аминокислотные замены улучшают связывание антитела с его антигеном. Дополнительно, такие способы можно применять для произведения аминокислотных замен или делеций одного или нескольких цистеиновых остатков в вариабельных областях, принимающих участие в образовании дисульфидной связи внутри цепи, с образованием молекул антител, в которых недостает одной или нескольких дисульфидных связей внутри цепи. Другие изменения полинуклеотида охвачены настоящим раскрытием и находятся в пределах квалификации специалиста в данной области техники.

[0161] Также обеспечиваются связывающие молекулы, содержащие таковые, состоящие главным образом из или состоящие из вариантов (включая производные) молекул антител (например, VH-области и/или VL-области), описываемые в данном документе, и эти связывающие молекулы или их фрагменты специфически связываются с Psl Pseudomonas. Для внедрения мутаций в нуклеотидную последовательность, кодирующую связывающую молекулу или ее фрагмент, которые специфически связываются с Psl Pseudomonas, можно применять стандартные методики, известные специалистам в данной области, включая, без ограничений, сайт-направленный мутагенез и ПЦР-опосредованный мутагенез, который приводит в результате к аминокислотным заменам. Варианты (включая производные) кодируют полипептиды, содержащие менее чем 50 аминокислотных замен, менее чем 40 аминокислотных замен, менее чем 30 аминокислотных замен, менее чем 25 аминокислотных замен, менее чем 20 аминокислотных замен, менее чем 15 аминокислотных замен, менее чем 10 аминокислотных замен, менее чем 5 аминокислотных замен, менее чем 4 аминокислотных замены, менее чем 3 аминокислотных замены или менее чем 2 аминокислотных замены по отношению к эталонной VH-области, VHCDR1, VHCDR2, VHCDR3, VL-области, VLCDR1, VLCDR2 или VLCDR3. "Консервативная аминокислотная замена" представляет собой замену, при которой аминокислотный остаток замещается аминокислотным остатком, имеющим боковую цепь с одноименным зарядом. Семейства аминокислотных остатков, имеющих боковые цепи с одноименными зарядами, определены в данной области техники. Эти семейства включают аминокислоты с основными боковыми цепями (например, лизин, аргинин, гистидин), кислотными боковыми цепями (например, аспарагиновая кислота, глутаминовая кислота), незаряженными полярными боковыми цепями (например, глицин, аспарагин, глутамин, серин, треонин, тирозин, цистеин), неполярными боковыми цепями (например, аланин, валин, лейцин, изолейцин, пролин, фенилаланин, метионин, триптофан), бета-разветвленными боковыми цепями (например, треонин, валин, изолейцин) и ароматическими боковыми цепями (например, тирозин, фенилаланин, триптофан, гистидин). Альтернативно, мутации можно внедрять случайно по всей или в части кодирующей последовательности, как, например, путем насыщающего мутагенеза, и полученные в результате мутанты можно подвергнуть скринингу в отношении биологической активности для идентификации мутантов, сохраняющих активность (например, способность к связыванию с Psl Pseudomonas).

[0162] Например, возможно внедрять мутации только в каркасные области или только в CDR-области молекулы антитела. Внедренные мутации могут быть молчащими или нейтральными миссенс-мутациями, т.е. не оказывающими или оказывающими небольшой эффект на способность антитела к связыванию с антигеном. Эти типы мутаций могут быть применимыми для оптимизации частоты использования кодона или улучшения выработки антител гибридомой. Альтернативно, ненейтральные миссенс-мутации могут изменять способность антитела к связыванию с антигеном. Большинство молчащих и нейтральных миссенс-мутаций, вероятно, локализованы в каркасных областях, тогда как большинство ненейтральных миссенс-мутаций, вероятно, локализованы в CDR, хотя это не является обязательным требованием. Специалист в данной области техники будет способен разработать и протестировать мутантные молекулы с желаемыми свойствами, такими как отсутствие изменения активности связывания с антигеном или изменение активности связывания (например, улучшения активности связывания с антигеном или изменение специфичности антитела). После мутагенеза кодируемый белок может экспрессироваться обычным образом, и функциональную и/или биологическую активность кодируемого белка (например, способность к связыванию по меньшей мере с одним эпитопом Psl Pseudomonas) можно определять при помощи методик, описываемых в данном документе, или при помощи методик стандартных модификаций, известных в данной области техники.

III. ПОЛИПЕПТИДЫ-АНТИТЕЛА

[0163] Настоящее раскрытие дополнительно направлено на выделенные полипептиды, образующие связывающие молекулы, например, антитела или их антигенсвязывающие фрагменты, которые специфически связываются с Psl Pseudomonas, и на полинуклеотиды, кодирующие такие полипептиды. Связывающие молекулы, например, антитела или их фрагменты, раскрытые в данном документе, включают полипептиды, например, аминокислотные последовательности, кодирующие, например, антигенсвязывающие области, специфичные в отношении Psl, полученные из молекул иммуноглобулинов. Полипептид или аминокислотная последовательность, "полученные из" указанного белка, относятся к происхождению полипептида. В определенных случаях полипептид или аминокислотная последовательность, полученные из конкретного исходного полипептида или аминокислотной последовательности, имеют аминокислотную последовательность, главным образом идентичную таковой в исходной последовательности или ее части, где часть состоит по меньшей мере из 10-20 аминокислот, по меньшей мере из 20-30 аминокислот, по меньшей мере из 30-50 аминокислот, или которая может быть иным способом идентифицирована специалистом в данной области техники как происходящая из исходной последовательности.

[0164] Также раскрыта выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая аминокислотную последовательность вариабельной области тяжелой цепи иммуноглобулина (VH), по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичную по отношению к одной или нескольким из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0165] Дополнительно раскрыта выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая аминокислотную последовательность VH, идентичную или идентичную за исключением одной, двух, трех, четырех, пяти или более аминокислотных замен по отношению к одной или нескольким из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0166] Некоторые варианты осуществления включают выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащую VH, где одна или несколько VHCDR1-, VHCDR2- или VHCDR3-областей VH по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичны по отношению к одной или нескольким эталонным аминокислотным последовательностям VHCDR1, VHCDR2 или VHCDR3 тяжелой цепи с одним или несколькими из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0167] Дополнительно раскрыта выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VH, где одна или несколько VHCDR1-, VHCDR2- или VHCDR3-областей VH идентичны или идентичны за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким эталонным аминокислотным последовательностям VHCDR1, VHCDR2 и/или VHCDR3 тяжелой цепи с одним или несколькими из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанными в таблице 2. Таким образом, согласно данному варианту осуществления VH содержит одну или несколько из VHCDR1, VHCDR2 или VHCDR3, идентичных или идентичных за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким аминокислотным последовательностям VHCDR1, VHCDR2 или VHCDR3, показанным в таблице 3.

[0168] Также раскрыта выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая аминокислотную последовательность вариабельной области легкой цепи (VL) иммуноглобулина, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичную по отношению к одной или нескольким из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0169] В некоторых вариантах осуществления раскрыта выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая аминокислотную последовательность VL, идентичную или идентичную за исключением одной, двух, трех, четырех, пяти или более аминокислотных замен по отношению к одной или нескольким из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0170] Также обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VL, где одна или несколько VLCDR1-, VLCDR2- или VLCDR3-областей VL по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичны по отношению к одной или нескольким эталонным аминокислотным последовательностям VLCDR1, VLCDR2 или VLCDR3 легкой цепи с одним или несколькими из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0171] Дополнительно обеспечивается выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащая VL, где одна или несколько VLCDR1-, VLCDR2- или VLCDR3-областей VL идентичны или идентичны за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким эталонным аминокислотным последовательностям VLCDR1, VLCDR2 и/или VLCDR3 тяжелой цепи с одним или несколькими из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2. Таким образом, согласно данному варианту осуществления VL содержит одну или несколько из VLCDR1, VLCDR2 или VLCDR3, идентичных или идентичных за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким аминокислотным последовательностям VLCDR1, VLCDR2 или VLCDR3, показанным в таблице 3.

[0172] В других вариантах осуществления выделенное антитело или его антигенсвязывающий фрагмент, которые специфически связываются с Psl Pseudomonas, содержат таковые, состоят главным образом из или состоят из аминокислотных последовательностей VH и VL, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичных по отношению к (a) SEQ ID NO: 1 и SEQ ID NO: 2, соответственно; (b) SEQ ID NO: 3 и SEQ ID NO: 2, соответственно; (c) SEQ ID NO: 4 и SEQ ID NO: 2, соответственно; (d) SEQ ID NO: 5 и SEQ ID NO: 6, соответственно; (e) SEQ ID NO: 7 и SEQ ID NO: 8, соответственно; (f) SEQ ID NO: 9 и SEQ ID NO: 10, соответственно; (g) SEQ ID NO: 11 и SEQ ID NO: 12, соответственно; (h) SEQ ID NO: 13 и SEQ ID NO: 14, соответственно; (i) SEQ ID NO: 15 и SEQ ID NO: 16, соответственно; или (j) SEQ ID NO: 74 и SEQ ID NO: 12, соответственно. В некоторых вариантах осуществления вышеописанное антитело или его антигенсвязывающий фрагмент содержат VH с аминокислотной последовательностью SEQ ID NO: 11 и VL с аминокислотной последовательностью SEQ ID NO: 12. В некоторых вариантах осуществления вышеописанное антитело или его антигенсвязывающий фрагмент содержат VH с аминокислотной последовательностью SEQ ID NO: 1 и VL с аминокислотной последовательностью SEQ ID NO: 2. В других вариантах осуществления вышеописанное антитело или его антигенсвязывающий фрагмент содержат VH с аминокислотной последовательностью SEQ ID NO: 11 и VL с аминокислотной последовательностью SEQ ID NO: 12.

[0173] В определенных вариантах осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, описываемые в данном документе, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся константой диссоциации (KD), не превышающей 5×10-2 M, 10-2 M, 5×10-3 M, 10-3 M, 5×10-4 M, 10-4 M, 5×10-5 M, 10-5 M, 5×10-6 M, 10-6 M, 5×10-7 M, 10-7 M, 5×10-8 M, 10-8 M, 5×10-9 M, 10-9 M, 5×10-10 M, 10-10 M, 5×10-11 M, 10-11 M, 5×10-12 M, 10-12 M, 5×10-13 M, 10-13 M, 5×10-14 M, 10-14 M, 5×10-15 M или 10-15 M.

[0174] В конкретных вариантах осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, описываемые в данном документе, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся константой диссоциации (KD) в диапазоне от около 1×10-10 до около 1×10-6 M. В одном варианте осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, описываемые в данном документе, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся KD, равной около 1,18×10-7 M, как определено в анализе связывания при помощи OCTET®, описываемом в данном документе. В другом варианте осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, описываемые в данном документе, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся KD, равной около 1,44×10-7 M, как определено в анализе связывания при помощи OCTET®, описываемом в данном документе.

[0175] Некоторые варианты осуществления включают выделенную связывающую молекулу, например, антитело или его фрагмент, описываемую выше, которая (a) может ингибировать прикрепление Pseudomonas aeruginosa к эпителиальным клеткам, (b) может способствовать OPK P. aeruginosa или (c) может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам и может способствовать OPK P. aeruginosa.

[0176] В некоторых вариантах осуществления включена выделенная связывающая молекула, например, антитело или его фрагмент, описываемые выше, где максимальное ингибирование прикрепления P. aeruginosa к эпителиальным клеткам достигается при концентрации антитела, равной около 50 мкг/мл или менее, 5,0 мкг/мл или менее или около 0,5 мкг/мл или менее, или при концентрации антитела, находящейся в диапазоне от около 30 мкг/мл до около 0,3 мкг/мл, или при концентрации антитела, равной около 1 мкг/мл, или при концентрации антитела, равной около 0,3 мкг/мл.

[0177] Определенные варианты осуществления включают выделенную связывающую молекулу, например, антитело или его фрагмент, описываемые выше, где EC50 OPK составляет менее чем около 0,5 мкг/мл, менее чем около 0,05 мкг/мл, или менее чем около 0,005 мкг/мл, или где EC50 OPK находится в диапазоне от приблизительно 0,001 мкг/мл до около 0,5 мкг/мл, или где EC50 OPK находится в диапазоне от около 0,02 мкг/мл до около 0,08 мкг/мл, или где EC50 OPK находится в диапазоне от около 0,002 мкг/мл до около 0,01 мкг/мл, или где EC50 OPK составляет менее чем около 0,2 мкг/мл, или где EC50 OPK составляет менее чем около 0,02 мкг/мл. В определенных вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, описываемые в данном документе, специфически связывается с тем же эпитопом Psl, что и моноклональное антитело WapR-004, WapR-004RAD, Cam-003, Cam-004 или Cam-005, или будет осуществлять конкурентное ингибирование связывания такого моноклонального антитела с Psl Pseudomonas. WapR-004RAD является идентичным по отношению к WapR-004 за исключением аминокислотной замены G98A в аминокислотной последовательности SEQ ID NO: 11 VH.

[0178] Некоторые варианты осуществления включают мутантные WapR-004 (W4), содержащие аминокислотную последовательность молекулы scFv-Fc, идентичную или идентичную за исключением одной, двух, трех, четырех, пяти или более аминокислотных замен по отношению к одной или нескольким из SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145 или SEQ ID NO: 146.

[0179] Другие варианты осуществления включают мутантные WapR-004 (W4), содержащие аминокислотную последовательность молекулы scFv-Fc, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичную по отношению к одной или нескольким из SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145 или SEQ ID NO: 146.

[0180] В некоторых вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, описываемые в данном документе, специфически связывается с тем же эпитопом, что и моноклональное антитело WapR-001, WapR-002 или WapR-003, или будет осуществлять конкурентное ингибирование связывания такого моноклонального антитела с Psl Pseudomonas.

[0181] В определенных вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, описываемые в данном документе, специфически связывается с тем же эпитопом, что и моноклональное антитело WapR-016, или будет осуществлять конкурентное ингибирование связывания такого моноклонального антитела с Psl Pseudomonas.

[0182] Любые молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, описываемые в данном документе, могут дополнительно включать дополнительные полипептиды, например, сигнальный пептид, для управления секрецией кодируемого полипептида, константные области антител, описываемые в данном документе, или другие гетерологичные полипептиды, описываемые в данном документе. Дополнительно, связывающие молекулы или их фрагменты согласно настоящему описанию включают фрагменты полипептидов, описываемые в другом месте. Дополнительно, молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, описываемые в данном документе, могут представлять собой полипептиды слияния, Fab-фрагменты, scFv или другие производные, описываемые в данном документе.

[0183] Также, как более подробно рассматривается в другом месте в данном документе, настоящее изобретение включает композиции, содержащие молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, описываемые в данном документе.

[0184] Специалисту в данной области также будет понятно, что молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, описываемые в данном документе, можно модифицировать таким образом, чтобы они отличались по аминокислотной последовательности от встречающихся в природе связывающих полипептидов, из которых они были получены. Например, полипептид или аминокислотная последовательность, полученная от указанного белка, может быть подобной, например, обладать определенной процентной идентичностью, по отношению к исходной последовательности, например, она может быть на 60%, 70%, 75%, 80%, 85%, 90% или 95% идентичной по отношению к исходной последовательности.

[0185] Выражение "процентная идентичность последовательностей" между двумя последовательностями полинуклеотида или полипептида относится к числу идентичных совпадающих положений, общих для последовательностей, в окне сравнения с учетом добавлений или делеций (т.е. гэпов), которые должны быть внедрены для оптимального выравнивания двух последовательностей. Совпадающее положение представляет собой любое положение, в котором идентичные нуклеотид или аминокислота представлены как в целевой, так и в эталонной последовательности. Гэпы, представленные в целевой последовательности, не учитываются, поскольку гэпы не являются нуклеотидами или аминокислотами. Аналогично, гэпы, представленные в эталонной последовательности, не учитываются, поскольку учитываются нуклеотиды или аминокислоты целевой последовательности, а не нуклеотиды или аминокислоты эталонной последовательности.

[0186] Процентное значение идентичности последовательностей рассчитывают путем определения числа положений, в которых идентичные аминокислотный остаток или основание нуклеиновой кислоты имеют место в обеих последовательностях, с получением числа совпадающих положений, деления числа совпадающих положений на общее число положений в окне сравнения и умножения результата на 100 с получением процентного значения идентичности последовательностей. Сравнение последовательностей и определение процентной идентичности последовательностей между двумя последовательностями можно осуществить при помощи программного обеспечения, легко доступного как для применения в режиме онлайн, так и для загрузки. Подходящие программы из системы программного обеспечения доступны из различных источников и предназначены для выравнивания как белковых, так и нуклеотидных последовательностей. Одной подходящей программой для определения процентной идентичности последовательностей является bl2seq, часть пакета программ BLAST, доступного на веб-сайте BLAST Национального центра биотехнологической информации правительства США (blast.ncbi.nlm.nih.gov). B12seq выполняет сравнение между двумя последовательностями при помощи алгоритмов BLASTN либо BLASTP. BLASTN применяют для сравнения последовательностей нуклеиновых кислот, тогда как BLASTP применяют для сравнения аминокислотных последовательностей. Другими подходящими программами являются, например, Needle, Stretcher, Water или Matcher, являющиеся частью пакета биоинформатических программ EMBOSS и также доступные от Европейского института биоинформатики (EBI) на www.ebi.ac.uk/Tools/psa.

[0187] Каждая из различных областей в одной целевой последовательности полинуклеотида или полипептида, выравниваемой с эталонной последовательностью полинуклеотида или полипептида, может обладать собственной процентной идентичностью последовательностей. Следует отметить, что значение процентной идентичности последовательностей округляют до ближайших десятых. Например, 80,11, 80,12, 80,13 и 80,14 округляют в меньшую сторону до 80,1, тогда как 80,15, 80,16, 80,17, 80,18 и 80,19 округляют в большую сторону до 80,2. Также следует отметить, что значение длины всегда будет целым числом.

[0188] Специалист в данной области примет во внимание, что построение выравнивания последовательностей для расчета процентной идентичности последовательностей не ограничивается бинарным сравнением двух последовательностей, обусловленным исключительно первичными данными о последовательностях. Выравнивание последовательностей можно получить из множественного выравнивания последовательностей. Одной подходящей программой для построения множественного выравнивания последовательностей является ClustalW2, доступная на www.clustal.org. Другой подходящей программой является MUSCLE, доступной на www.drive5.com/muscle/. ClustalW2 и MUSCLE альтернативно доступны, например, от EBI.

[0189] Также следует принять во внимание, что выравнивание последовательностей можно построить путем интеграции данных о последовательностях с данными из гетерогенных источников, таких как данные о структуре (например, кристаллическая структура белка), данные о функции (например, локализация мутаций) или данные филогенетики. Подходящей программой, в которой интегрируют гетерогенные данные с построением множественного выравнивания последовательностей, является T-Coffee, доступная на www.tcoffee.org и альтернативно доступная, например, от EBI. Также следует принять во внимание, что конечное выравнивание, применяемое для расчета процентной идентичности последовательностей, можно проверять либо автоматически, либо вручную.

[0190] При помощи способов и компьютерных программ/программного обеспечения, известных в данной области техники, таких как, без ограничений, программа BESTFIT (Wisconsin Sequence Analysis Package, версия 8 для Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) можно также определить, является ли любой конкретный полипептид по меньшей мере на около 70%, 75%, 80%, 85%, 90% или 95% идентичным по отношению к другому полипептиду. В BESTFIT применяется алгоритм поиска локальной гомологии Смита-Уотермана, приведенный в Advances in Applied Mathematics 2:482-489 (1981), для поиска наилучшего сегмента гомологии между двумя последовательностями. При применении BESTFIT или любой другой программы для выравнивания последовательностей для определения того, является ли конкретная последовательность, например, на 95% идентичной по отношению к эталонной последовательности, параметры устанавливают, разумеется, таким образом, чтобы процентное значение идентичности рассчитывалось по всей длине эталонной последовательности полипептида, и чтобы допускалось до 5% гэпов в гомологии от общего числа аминокислот в эталонной последовательности.

[0191] Кроме того, можно произвести нуклеотидные или аминокислотные замены, делеции или вставки, приводящие к консервативным заменам или изменениям в областях "заменимых" аминокислот. Например, последовательность полипептида или аминокислотная последовательность, полученные из указанного белка, могут быть идентичными по отношению к исходной последовательности за исключением одной или нескольких отдельных аминокислотных замен, вставок или делеций, например, одной, двух, трех, четырех, пяти, шести, семи, восьми, девяти, десяти, пятнадцати, двадцати или более отдельных аминокислотных замен, вставок или делеций. В некоторых вариантах осуществления в последовательности полипептида или аминокислотной последовательности, полученных из указанного белка, имеется от одной до пяти, от одной до десяти, от одной до пятнадцати или от одной до двадцати отдельных аминокислотных замен, вставок или делеций по отношению к исходной последовательности.

[0192] Молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, описываемые в данном документе, может включать в себя, состоять главным образом из или состоять из белка слияния. Белки слияния являются химерными молекулами, которые содержат, например, антигенсвязывающий домен иммуноглобулина по меньшей мере с одним целевым участком связывания и по меньшей мере с одной гетерологичной частью, т.е. частью, с которой он не связан естественным образом в природе. Аминокислотные последовательности могут обычно существовать в отдельных белках, которые сближены в полипептиде слияния, или они могут обычно существовать в одном и том же белке, но размещаться в полипептиде слияния в новом расположении. Белки слияния можно создать, например, путем химического синтеза или путем создания и трансляции полинуклеотида, в котором пептидные области кодируются в желаемом взаиморасположении.

[0193] Выражение "гетерологичный" применительно к полинуклеотиду, полипептиду или другому фрагменту означает, что полинуклеотид, полипептид или другой фрагмент получены из объекта, отличного от остальной части объекта, с которым их сравнивают. В неограничивающем примере "гетерологичный полипептид", подлежащий слиянию со связывающей молекулой, например, с антителом или его антигенсвязывающим фрагментом, вариантом или производным, получен из полипептида, не являющегося иммуноглобулином, того же вида, или полипептида, являющегося иммуноглобулином или не являющегося иммуноглобулином, другого вида.

IV. БЕЛКИ СЛИЯНИЯ И КОНЪЮГАТЫ АНТИТЕЛ

[0194] В некоторых вариантах осуществления молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно многократно вводить в конъюгированной форме. В еще одном варианте осуществления молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно вводить в неконъюгированной форме, а затем в конъюгированной форме, или наоборот.

[0195] В конкретных вариантах осуществления молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно конъюгировать с одним или несколькими противомикробными средствами, например, с полимиксином B (PMB). PMB представляет собой небольшой липопептидный антибиотик, одобренный для лечения инфекций, вызываемых грамотрицательными микроорганизмами с множественной лекарственной устойчивостью. В дополнение к его бактерицидной активности, PMB связывается с липополисахаридом (LPS) и нейтрализует его провоспалительные эффекты (Dixon, R.A. & Chopra, I. J Antimicrob Chemother 18, 557-563 (1986)). Считается, что LPS в значительной мере содействует воспалению и началу сепсиса, вызываемого грамотрицательными микроорганизмами (Guidet, B., et al, Chest 106, 1194-1201 (1994)). Методы терапии, нейтрализующие и/или устраняющие LPS из кровотока, обладают потенциалом для предупреждения или задержки начала сепсиса и улучшения клинического исхода. Полимиксин B (PMB) представляет собой липопептидный антибиотик, одобренный для лечения инфекций, вызываемых грамотрицательными микроорганизмами с множественной лекарственной устойчивостью. В дополнение к его бактерицидной активности, PMB связывается с LPS и нейтрализует его провоспалительные эффекты. Как было показано, конъюгаты PMB с молекулами носителя нейтрализуют LPS и опосредуют защиту в моделях эндотоксикоза и инфекции на животных (Drabick, J. J., et al. Antimicrob Agents Chemother 42, 583-588 (1998)). Также раскрыт способ присоединения одной или нескольких молекул PMB к цистеиновым остаткам, внедренным в Fc-область моноклональных антител (mAb) согласно настоящему изобретению. Например, конъюгаты Cam-003-PMB сохраняли специфичное mAb-опосредованное связывание с P. aeruginosa и также сохраняли OPK-активность. Кроме того, конъюгаты mAb-PMB связывались с LPS и нейтрализовали его in vitro.

[0196] В некоторых вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, описываемые в данном документе, может содержать гетерологичную аминокислотную последовательность или один или несколько других фрагментов, обычно не связанных с антителом (например, противомикробное средство, терапевтическое средство, пролекарство, пептид, белок, фермент, липид, модификатор биологического ответа, фармацевтическое средство, лимфокин, гетерологичное антитело или его фрагмент, детектируемая метка, полиэтиленгликоль (PEG) и комбинацию любых двух или более из указанных средств). В дополнительных вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, может содержать детектируемую метку, выбранную из группы, состоящей из фермента, флуоресцентной метки, хемилюминесцентной метки, биолюминесцентной метки, радиоактивной метки или комбинации любых двух или более из указанных детектируемых меток.

V. ПОЛИНУКЛЕОТИДЫ, КОДИРУЮЩИЕ СВЯЗЫВАЮЩИЕ МОЛЕКУЛЫ

[0197] В данном документе также обеспечиваются молекулы нуклеиновых кислот, кодирующие молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, описываемые в данном документе.

[0198] В одном варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей аминокислотную последовательность вариабельной области тяжелой цепи (VH) иммуноглобулина, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичную по отношению к одной или нескольким из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0199] В другом варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей аминокислотную последовательность VH, идентичную или идентичную за исключением одной, двух, трех, четырех, пяти или более аминокислотных замен по отношению к одной или нескольким из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0200] В дополнительном варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей VH, где одна или несколько VHCDR1-, VHCDR2- или VHCDR3-областей VH идентичны или идентичны за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким эталонным аминокислотным последовательностям VHCDR1, VHCDR2 и/или VHCDR3 тяжелой цепи с одним или несколькими из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0201] В другом варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащую VH, где одна или несколько VHCDR1-, VHCDR2- или VHCDR3-областей VH идентичны или идентичны за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким эталонным аминокислотным последовательностям VHCDR1, VHCDR2 и/или VHCDR3 тяжелой цепи с одним или несколькими из SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15 или SEQ ID NO: 74, показанным в таблице 2.

[0202] В дополнительном варианте осуществления обеспечивается выделенная связывающая молекула, например, антитело или антигенсвязывающий фрагмент, содержащая VH, кодируемую полинуклеотидом, которая специфически или преимущественно связывается с Psl Pseudomonas.

[0203] В другом варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей аминокислотную последовательность вариабельной области легкой цепи (VL) иммуноглобулина, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичную по отношению к одной или нескольким из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0204] В дополнительном варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей аминокислотную последовательность VL, идентичную или идентичную за исключением одной, двух, трех, четырех, пяти или более аминокислотных замен по отношению к одной или нескольким из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0205] В другом варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей VL, где одна или несколько VLCDR1-, VLCDR2- или VLCDR3-областей VL по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичны по отношению к одной или нескольким эталонным аминокислотным последовательностям VLCDR1, VLCDR2 или VLCDR3 легкой цепи с одним или несколькими из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0206] В дополнительном варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей выделенную связывающую молекулу, например, антитело или его антигенсвязывающий фрагмент, которая специфически связывается с Psl Pseudomonas, содержащую VL, где одна или несколько VLCDR1-, VLCDR2- или VLCDR3-областей VL идентичны или идентичны за исключением четырех, трех, двух или одной аминокислотной замены по отношению к одной или нескольким эталонным аминокислотным последовательностям VLCDR1, VLCDR2 и/или VLCDR3 тяжелой цепи с одним или несколькими из SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 или SEQ ID NO: 16, показанным в таблице 2.

[0207] В другом варианте осуществления выделенная связывающая молекула, например, антитело или антигенсвязывающий фрагмент, содержащая VL, кодируемую полинуклеотидом, специфически или преимущественно связывается с Psl Pseudomonas.

[0208] В одном варианте осуществления обеспечивается выделенный полинуклеотид, содержащий, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей молекулу scFv, содержащую VH и VL, где scFv по меньшей мере на 80%, 85%, 90%, 95% или 100% идентична по отношению к одной или нескольким из SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69 или SEQ ID NO: 70, показанным в таблице 4.

ТАБЛИЦА 4
Эталонные последовательности нуклеиновых кислот, кодирующих scFv
Название антитела Нуклеотидные последовательности, кодирующие scFv
Cam-003 CAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCACCAGTCCTTACTTCTGGAGCTGGCTCCGGCAGCCCCCAGGGAAGGGACTGGAGTGGATTGGTTATATCCATTCCAATGGGGGCACCAACTACAACCCCTCCCTCAAGAGTCGACTCACCATATCAGGAGACACGTCCAAGAACCAATTCTCCCTGAATCTGAGTTTTGTGACCGCTGCGGACACGGCCCTCTATTACTGTGCGAGAACGGACTACGATGTCTACGGCCCCGCTTTTGATATCTGGGGCCAGGGGACAATGGTCACCGTCTCGAGTGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGGCCGCA
SEQ ID NO: 65
Cam-004 CAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGGCCCAGGACGGGTGAAGCCTTCGGAGACGCTGTCCCTCACCTGCACTGTCTCTGGTTACTCCGTCAGTAGTGGTTACTACTGGGGCTGGATCCGGCAGTCCCCAGGGACGGGGCTGGAGTGGATTGGGAGTATCTCTCATAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCACCATATCAGGAGACGCATCCAAGAACCAGTTTTTCCTGAGGCTGACTTCTGTGACCGCCGCGGACACGGCCGTTTATTACTGTGCGAGATCTGAGGCTACCGCCAACTTTGATTCTTGGGGCAGGGGCACCCTGGTCACCGTCTCTTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCCTGCCGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGGCCGCA
SEQ ID NO: 66
Cam-005 CAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCTCTGGTGGCTCCGTCAGCAGTAGTGGTTATTACTGGACCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTATTCTAGTGGGAGCACATATTACAGCCCGTCCCTCAAGAGTCGAGTCACCATATCCGGAGACACGTCCAAGAACCAGTTCTCCCTCAAGCTGAGCTCTGTGACCGCCGCAGACACAGCCGTGTATTACTGTGCGAGACTTAACTGGGGCACTGTGTCTGCCTTTGATATCTGGGGCAGAGGCACCCTGGTCACCGTCTCGAGTGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGGCCGCA
SEQ ID NO: 67
WapR-001 TCTATGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGTTGGAGTCTGGGGGAGGTTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGGTTCACCTTCAGTCGGTATCCTATGCATTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGATATTGGTACTAATGGGGGTAGTACAAACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGGTGTATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATCATTGTGTGGCGGGTATAGCAGCCGCCTATGGTTTTGATGTCTGGGGCCAAGGGACAATGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGGCAGGGCTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACATTGCTACTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGGCACTAAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGTTCCTCATATGCACGTAGTTACACTTATGTCTTCGGAACTGGGACCGAGCTGACCGTCCTAGCGGCCGC
SEQ ID NO: 68
WapR-002 CTATGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTCAGTAGCTATCCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGATTATGTTTCAGACATCAGTCCAAATGGGGGTTCCACAAACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACACTGTTTCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATTATTGTGTGATGGGGTTAGTACCCTATGGTTTTGATATCTGGGGCCAAGGCACCCTGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGACTGTGGTGACCCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCACTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAACCAGCAGCACTTATGTCTTCGGAACTGGGACCAAGGTCACCGTCCTAGCGGCCG
SEQ ID NO: 69
WapR-003 CGGCCCAGCCGGCCATGGCCCAGATGCAGCTGGTGCAGTCGGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTCAGCCTCTGGATTCACCTTCAGTAGCTATCCTATGCACTGGGTCCGCCAGGCTCCAGGGAAGGGACTGGATTATGTTTCAGACATCAGTCCAAATGGGGGTGCCACAAACTACGCAGACTCCGTGAAGGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGGTGTATCTTCAAATGAGCAGTCTGAGAGCTGAAGACACGGCTGTCTATTATTGTGTGATGGGGTTAGTGCCCTATGGTTTTGATAACTGGGGCCAGGGGACAATGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGACTGTGGTGACCCAGCCTGCCTCCGTGTCTGCATCTCCTGGACAGTCGATCACCATCTCCTGCGCTGGAACCAGCGGTGATGTTGGGAATTATAATTTTGTCTCCTGGTACCAACAACACCCAGGCAAAGCCCCCAAACTCCTGATTTATGAGGGCAGTCAGCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAGGTCTGGCAACACGGCCTCCCTGACAATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGTTCCTCATATGCACGTAGTTACACTTATGTCTTCGGAACTGGGACCAAGCTGACCGTCCTAGCGGCCGCA
SEQ ID NO: 70
WapR-004 TATGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGTTGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCAATGTCGCTGGTGGCTCCATCAGTCCTTACTACTGGACCTGGATCCGGCAGCCCCCAGGGAAGGGCCTGGAGTTGATTGGTTATATCCACTCCAGTGGGTACACCGACTACAACCCCTCCCTCAAGAGTCGAGTCACCATATCAGGAGACACGTCCAAGAAGCAGTTCTCCCTGCACGTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTACTTCTGTGCGAGAGGCGATTGGGACCTGCTTCATGCTCTTGATATCTGGGGCCAAGGGACCCTGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACTCGAAATTGTGTTGACACAGTCTCCATCCTCCCTGTCTACATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGGAGCCATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAACTCCTGATCTATGGTGCATCCAATTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATTAGTAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAGTTACAGTTTCCCCCTCACTTTCGGCGGAGGGACCAAGCTGGAGATCAAAGCGGCCGC
SEQ ID NO: 71
WapR-007 GCGGCCCAGCCGGCCATGGCCGAAGTGCAGCTGGTGCAGTCTGGGGCTGACGTAAAGAAGCCTGGGGCCTCAGTGAGGGTCACCTGCAAGGCTTCTGGATACACCTTCACCGGCCACAACATACACTGGGTGCGACAGGCCCCTGGACAAGGGCTTGAATGGATGGGATGGATCAACCCTGACAGTGGTGCCACAAGCTATGCACAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCATCACCACAGCCTACATGGACCTGAGCAGGCTGAGATCTGACGACACGGCCGTATATTACTGTGCGACCGATACATTACTGTCTAATCACTGGGGCCAAGGAACCCTGGTCACCGTCTCGAGTGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACTTGCCAAGGAGACAGTCTCAGAAGCTATTACACAAACTGGTTCCAGCAGAAGCCAGGACAGGCCCCTCTACTTGTCGTCTATGCTAAAAATAAGCGGCCCCCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCTGACTATTACTGTCATTCCCGGGACAGCAGTGGTAACCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGGCCGCA
SEQ ID NO: 72
WapR-016 CAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTG
TGCAGCCTCTGGATACACCTTTAGCAGCTATGCCACGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCG
CAGGTATTAGTGGTAGTGGTGATACCACAGACTACGTAGACTCCGTGAAGGGCCGGTTCACCGTCTCCAGAGACAATTCC
AAGAACACCCTATATCTGCAAATGAACAGCCTGAGAGCCGACGACACGGCCGTGTATTACTGTGCGTCGAGAGGAGGTTT
AGGGGGTTATTACCGGGGCGGCTTTGACTTCTGGGGCCAGGGGACAATGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAG
GCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGTCTGTGCTGACGCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAG
TCGATCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTATGTCTCCTGGTACCAACAGCACCCAGG
CAAAGCCCCCAAACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCGCTTCTCTGGCTCCAAGTCTG
GCAACACGGCCTCCCTGACCATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCATATACAAGCAGC
GGCACTGTGGTATTCGGCGGAGGGACCGAGCTGACCGTCCTAGCGGCCGCA
SEQ ID NO: 73

[0209] В некоторых вариантах осуществления выделенное антитело или его антигенсвязывающий фрагмент, кодируемые одним или несколькими вышеописанными полинуклеотидами, которые специфически связываются с Psl Pseudomonas, содержат, состоят главным образом из или состоят из аминокислотных последовательностей VH и VL, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичных по отношению к (a) SEQ ID NO: 1 и SEQ ID NO: 2, соответственно; (b) SEQ ID NO: 3 и SEQ ID NO: 2, соответственно; (c) SEQ ID NO: 4 и SEQ ID NO: 2, соответственно; (d) SEQ ID NO: 5 и SEQ ID NO: 6, соответственно; (e) SEQ ID NO: 7 и SEQ ID NO: 8, соответственно; (f) SEQ ID NO: 9 и SEQ ID NO: 10, соответственно; (g) SEQ ID NO: 11 и SEQ ID NO: 12, соответственно; (h) SEQ ID NO: 13 и SEQ ID NO: 14, соответственно; (i) SEQ ID NO: 15 и SEQ ID NO: 16, соответственно; или (j) SEQ ID NO: 74 и SEQ ID NO: 12, соответственно.

[0210] В определенных вариантах осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся константой диссоциации (KD), не превышающей 5×10-2 M, 10-2 M, 5×10-3 M, 10-3 M, 5×10-4 M, 10-4 M, 5×10-5 M, 10-5 M, 5×10-6 M, 10-6 M, 5×10-7 M, 10-7 M, 5×10-8 M, 10-8 M, 5×10-9 M, 10-9 M, 5×10-10 M, 10-10 M, 5×10-11 M, 10-11 M, 5×10-12 M, 10-12 M, 5×10-13 M, 10-13 M, 5×10-14 M, 10-14 M, 5×10-15 M или 10-15 M.

[0211] В конкретных вариантах осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся константой диссоциации (KD) в диапазоне от около 1×10-10 до около 1×10-6 M. В одном варианте осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся KD, равной около 1,18×10-7 M, как определено в анализе связывания при помощи OCTET®, описываемом в данном документе. В другом варианте осуществления выделенная связывающая молекула, например, антитело или его антигенсвязывающий фрагмент, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с Psl Pseudomonas с аффинностью, характеризующейся KD, равной около 1,44×10-7 M, как определено в анализе связывания при помощи OCTET®, описываемом в данном документе.

[0212] В определенных вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с тем же эпитопом Psl, что и моноклональное антитело WapR-004, WapR-004RAD, Cam-003, Cam-004 или Cam-005, или будет осуществлять конкурентное ингибирование связывания такого моноклонального антитела с Psl Pseudomonas. WapR-004RAD является идентичным по отношению к WapR-004 за исключением замены нуклеиновой кислоты G293C в последовательности нуклеиновой кислоты, соответствующей VH, кодирующей аминокислотную последовательность VH с SEQ ID NO: 11 (замена нуклеотида в кодирующей VH части SEQ ID NO:71 в положении 317). Последовательность нуклеиновой кислоты, кодирующая VH WapR-004RAD, представлена как SEQ ID NO: 76.

[0213] В некоторых вариантах осуществления обеспечивается выделенный полинуклеотид, содержащий таковую, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей аминокислотную последовательность молекулы W4 с мутацией в scFv-Fc, идентичную или идентичную за исключением одной, двух, трех, четырех, пяти или более аминокислотных замен по отношению к одной или нескольким из SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145 или SEQ ID NO: 146.

[0214] В других вариантах осуществления обеспечивается выделенный полинуклеотид, содержащий таковую, состоящий главным образом из или состоящий из нуклеиновой кислоты, кодирующей аминокислотную последовательность молекулы W4 с мутацией в scFv-Fc, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичную по отношению к одной или нескольким из SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145 или SEQ ID NO: 146.

[0215] В одном варианте осуществления обеспечивается выделенный полинуклеотид, содержащий таковую, состоящий главным образом из или состоящий из нуклеиновой кислоты, которая кодирует молекулу W4 с мутацией в scFv-Fc, где нуклеиновая кислота по меньшей мере на 80%, 85%, 90%, 95% или 100% идентична по отношению к одной или нескольким из SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151 или SEQ ID NO: 152, SEQ IS NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO: 200, SEQ ID NO: 201, SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 208, SEQ ID NO: 209, SEQ ID NO: 210, SEQ ID NO: 211, SEQ ID NO: 212, SEQ ID NO: 213, SEQ ID NO: 214 или SEQ ID NO: 215.

[0216] В других вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с тем же эпитопом, что и моноклональное антитело WapR-001, WapR-002 или WapR-003, или будет осуществлять конкурентное ингибирование связывания такого моноклонального антитела с Psl Pseudomonas.

[0217] В некоторых вариантах осуществления молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, кодируемая одним или несколькими полинуклеотидами, описанными выше, специфически связывается с тем же эпитопом, что и моноклональное антитело WapR-016, или будет осуществлять конкурентное ингибирование связывания такого моноклонального антитела с Psl Pseudomonas.

[0218] Настоящее раскрытие также включает фрагменты полинуклеотидов, описанных в другом месте в данном документе. Дополнительно также обеспечиваются полинуклеотиды, которые кодируют полипептиды слияния, Fab-фрагменты и другие производные, описанные в данном документе.

[0219] Полинуклеотиды можно получать или производить с помощью любого способа, известного в данной области. Например, если известна нуклеотидная последовательность для антитела, полинуклеотид, кодирующий антитело, можно собрать из химически синтезированных олигонуклеотидов (например, как описано в Kutmeier et al., BioTechniques 17:242 (1994)), что, вкратце, включает синтез перекрывающихся олигонуклеотидов, содержащих части последовательности, кодирующей антитело, отжиг и лигирование этих олигонуклеотидов и затем амплификацию лигированных олигонуклеотидов с помощью ПЦР.

[0220] Альтернативно, полинуклеотид, кодирующий молекулу, связывающуюся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, можно создать из нуклеиновой кислоты из подходящего источника. Если клон, содержащий нуклеиновую кислоту, кодирующую конкретное антитело, недоступен, а последовательность, кодирующая молекулу антитела, известна, то нуклеиновую кислоту, кодирующую антитело, можно синтезировать химически или получить из подходящего источника (которым является, например, библиотека кДНК, кодирующих антитела, или библиотека кДНК, образованная из любой ткани или любых клеток, экспрессирующих антитело, или, например, выбранных гибридомных клеток, которые экспрессируют антитело, или нуклеиновая кислота, предпочтительно поли-A+РНК, выделенная из таковых) посредством ПЦР-амплификации с помощью синтетических праймеров, которые гибридизируются с 3'- и 5'-концами последовательности, или посредством клонирования с помощью олигонуклеотидного зонда, специфичного для конкретной последовательности гена, для идентификации, например, кДНК-клона из библиотеки кДНК, который кодирует антитело. Амплифицированные нуклеиновые кислоты, образованные с помощью ПЦР, можно клонировать в реплицируемые клонирующие векторы с помощью любого способа, хорошо известного в данной области техники.

[0221] Когда нуклеотидная последовательность и соответствующая аминокислотная последовательность молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, определена, на эту нуклеотидную последовательность можно воздействовать с помощью хорошо известных в данной области техники способов воздействия на нуклеотидные последовательности, например, методик рекомбинантных ДНК, сайт-направленного мутагенеза, ПЦР и т.д. (см., например, методики, описанные в Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1990) и Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons, NY (1998), которые оба включены в данный документ во всей своей полноте посредством ссылки), чтобы образовать антитела, имеющие другую аминокислотную последовательность, например, чтобы создать аминокислотные замены, делеции и/или вставки.

[0222] Полинуклеотид, кодирующий молекулу, связывающуюся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, можно составить из любого полирибонуклеотида или полидезоксирибонуклеотида, который может представлять собой немодифицированную РНК или ДНК или модифицированную РНК или ДНК. Например, полинуклеотид, кодирующий молекулу, связывающуюся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, можно составить из одно- и двухцепочечной ДНК, ДНК, которая является смесью одно- и двухцепочечных областей, одно- и двухцепочечной РНК и РНК, которая является смесью одно- и двухцепочечных областей, гибридных молекул, содержащих ДНК и РНК, которые могут быть одноцепочечными или, более типично, двухцепочечными, или смесью одно- и двухцепочечных областей. Кроме того, полинуклеотид, кодирующий молекулу, связывающуюся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, можно составить из трехцепочечных областей, содержащих РНК, или ДНК, или как РНК, так и ДНК. Полинуклеотид, кодирующий молекулу, связывающуюся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, может также содержать одно или несколько модифицированных оснований или скелеты ДНК или РНК, модифицированные для стабильности или в других целях. "Модифицированные" основания включают, например, тритилированные основания и нетипичные основания, такие как инозин. Можно осуществлять разнообразные модификации по отношению к ДНК и РНК; таким образом, "полинуклеотид" охватывает химически, ферментативно или метаболически модифицированные формы.

[0223] Выделенный полинуклеотид, кодирующий неприродный вариант полипептида, полученного из иммуноглобулина (например, части тяжелой цепи иммуноглобулина или части легкой цепи), можно создать путем внедрения одной или нескольких нуклеотидных замен, добавлений или делеций в нуклеотидную последовательность, кодирующую иммуноглобулин, таким образом, чтобы одна или несколько аминокислотных замен, добавлений или делеций были внедрены в кодируемый белок. Мутации можно внедрять посредством стандартных методик, таких как сайт-направленный мутагенез и ПЦР-опосредованный мутагенез. Консервативные аминокислотные замены осуществляют по одному или нескольким остаткам заменимых аминокислот.

VI. ЭКСПРЕССИЯ ПОЛИПЕПТИДОВ-АНТИТЕЛ

[0224] Как хорошо известно, РНК можно выделять из клеток исходной гибридомы или из других трансформированных клеток посредством стандартных методик, таких как извлечение с помощью гуанидинизотиоцианата и осаждение с последующим центрифугированием или хроматографией. Если необходимо, мРНК можно выделять из общей РНК посредством стандартных методик, таких как хроматография на олиго-dT-целлюлозе. Подходящие методики известны в данной области.

[0225] В одном варианте осуществления кДНК, которые кодируют легкую и тяжелую цепи молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, можно создать либо одновременно, либо по отдельности с помощью обратной транскриптазы и ДНК-полимеразы в соответствии с хорошо известными способами. ПЦР можно запускать с помощью консенсусных праймеров для константной области или с помощью более специфичных праймеров на основе опубликованных последовательностей ДНК и аминокислот, соответствующих тяжелым и легким цепям. Как рассматривалось выше, ПЦР также можно применять для выделения ДНК-клонов, кодирующих легкую и тяжелую цепи антитела. В этом случае можно осуществлять скрининг библиотек с помощью консенсусных праймеров или больших гомологичных зондов, таких как зонды для константных областей мыши.

[0226] ДНК, обычно плазмидную ДНК, можно выделять из клеток посредством методик, известных в данной области техники, подвергать рестрикционному картированию и секвенированию в соответствии со стандартными, хорошо известными методиками, подробно изложенными, например, в вышеприведенных источниках литературы, касающихся методик рекомбинантных ДНК. Разумеется, ДНК может быть синтетической согласно настоящему раскрытию в любой момент времени в ходе способа выделения или последующего анализа.

[0227] После воздействия на выделенный генетический материал с обеспечением молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, по настоящему раскрытию, полинуклеотиды, кодирующие молекулы, связывающиеся с Psl Pseudomonas, обычно вставляют в вектор экспрессии для введения в клетки-хозяева, которые можно применять для получения желаемого количества молекул, связывающихся с Psl Pseudomonas.

[0228] Рекомбинантная экспрессия антитела или его фрагмента, производного или аналога, например, тяжелой или легкой цепи антитела, которое связывается с молекулой-мишенью, описанной в данном документе, например, Psl, требует конструирования вектора экспрессии, содержащего полинуклеотид, который кодирует антитело. Когда полинуклеотид, кодирующий молекулу антитела, или тяжелую или легкую цепь антитела, или его часть (содержащую вариабельный домен тяжелой или легкой цепи) по настоящему раскрытию, получен, можно получить вектор для выработки молекулы антитела посредством технологии рекомбинантных ДНК с помощью методик, хорошо известных в данной области. Таким образом, способы получения белка посредством экспрессии полинуклеотида, содержащего нуклеотидную последовательность, кодирующую антитело, описаны в данном документе. Способы, которые хорошо известны специалистам в данной области, можно применять для конструирования векторов экспрессии, содержащих последовательности, кодирующие антитела, и соответствующие сигналы регуляции транскрипции и трансляции. Эти способы включают, например, in vitro методики рекомбинантных ДНК, методики синтеза и in vivo генетическую рекомбинацию. Настоящее раскрытие, таким образом, обеспечивает реплицируемые векторы, содержащие нуклеотидную последовательность, кодирующую молекулу антитела по настоящему раскрытию, или его тяжелую или легкую цепь, или вариабельный домен тяжелой или легкой цепи, функционально связанный с промотором. Такие векторы могут содержать нуклеотидную последовательность, кодирующую константную область молекулы антитела (см., например, публикацию по PCT WO 86/05807; публикацию по PCT WO 89/01036 и патент США № 5122464), а вариабельный домен антитела можно клонировать в такой вектор для экспрессии всей тяжелой или легкой цепи.

[0229] Выражение "вектор" или "вектор экспрессии" применяется в данном документе для обозначения векторов, применяемых в соответствии с настоящим раскрытием в качестве носителей для введения в клетку и экспрессии желаемого гена в клетке-хозяине. Как известно специалистам в данной области, такие векторы можно без труда выбрать из группы, состоящей из плазмид, фагов, вирусов и ретровирусов. Векторы, совместимые с настоящим раскрытием, как правило, будут содержать селектируемый маркер, соответствующие сайты рестрикции для облегчения клонирования желаемого гена и обладать способностью проникать в эукариотические или прокариотические клетки и/или реплицироваться в них.

[0230] Применительно к целям настоящего раскрытия можно использовать множество векторных систем экспрессии. Например, в одном классе векторов используются элементы ДНК, которые получают из вирусов животных, таких как вирус папилломы крупного рогатого скота, вирус полиомы, аденовирус, вирус коровьей оспы, бакуловирус, ретровирусы (RSV, MMTV или MOMLV) или вирус SV40. Другие включают применение полицистронных систем с внутренними сайтами связывания рибосомы. Дополнительно можно осуществлять селекцию клеток, в хромосомы которых интегрирована ДНК, путем введения одного или нескольких маркеров, которые обеспечивают возможность селекции трансфицированных клеток-хозяев. Маркер может обеспечивать прототрофность ауксотрофного хозяина, устойчивость к биоцидам (например, антибиотикам) или устойчивость к тяжелым металлам, таким как медь. Селектируемый маркерный ген может быть либо непосредственно связанным с последовательностями ДНК, которые необходимо экспрессировать, либо введенным в ту же клетку путем котрансформации. Для оптимального синтеза мРНК могут также быть необходимыми дополнительные элементы. Эти элементы могут включать сигнальные последовательности, сигналы для сплайсинга, а также промоторы, участвующие в транскрипции, энхансеры и сигналы терминации.

[0231] В некоторых вариантах осуществления клонируемые гены вариабельных областей вставляют в вектор экспрессии наряду с синтетическими генами константной области тяжелой и легкой цепи (например, человека), обсуждаемыми выше. Разумеется, любой вектор экспрессии, который может вызывать экспрессию в эукариотических клетках, можно применять в настоящем раскрытии. Примеры подходящих векторов включают, без ограничений, плазмиды pcDNA3, pHCMV/Zeo, pCR3.1, pEF1/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAX1 и pZeoSV2 (доступны от Invitrogen, Сан-Диего, Калифорния) и плазмиду pCI (доступна от Promega, Мэдисон, Висконсин). В целом, скрининг больших количеств трансформированных клеток для выявления тех, которые экспрессируют тяжелые и легкие цепи иммуноглобулина на достаточно высоких уровнях, является стандартной экспериментальной работой, которую можно проводить, например, с помощью роботизированных систем.

[0232] В более общем смысле, когда вектор или последовательность ДНК, кодирующие мономерную субъединицу молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, по настоящему раскрытию получены, вектор экспрессии можно вводить в подходящую клетку-хозяина. Введение плазмиды в клетку-хозяина можно осуществлять с помощью различных методик, хорошо известных специалистам в данной области. Они включают, без ограничений, трансфекцию (включая электрофорез и электропорацию), слияние протопластов, осаждение фосфатом кальция, слияние клеток с ДНК в оболочке, микроинъекцию и инфицирование интактным вирусом. См. Ridgway, A. A. G. "Mammalian Expression Vectors" Vectors, Rodriguez and Denhardt, Eds., Butterworths, Boston, Mass., Chapter 24.2, pp. 470-472 (1988). Как правило, введение плазмиды в хозяина осуществляют посредством электропорации. Клетки-хозяева, содержащие конструкт для экспрессии, выращивают в условиях, подходящих для выработки легких цепей и тяжелых цепей, и анализируют в отношении белкового синтеза тяжелой и/или легкой цепи. Иллюстративные методики анализа включают твердофазный иммуноферментный анализ (ELISA), радиоиммунологический анализ (RIA) или анализ с помощью активированной флуоресценцией сортировки клеток (FACS), иммуногистохимический анализ и т.п.

[0233] Вектор экспрессии переносят в клетку-хозяина с помощью стандартных методик, и трансфицированные клетки затем культивируют с помощью стандартных методик с получением антитела для применения в способах, описываемых в данном документе. Таким образом, настоящее раскрытие включает клетки-хозяева, содержащие полинуклеотид, кодирующий молекулу, связывающуюся с Psl Pseudomonas, например, антитело, или его фрагмент, вариант или производное, или его тяжелую или легкую цепь, функционально связанный с гетерологичным промотором. В некоторых вариантах осуществления для экспрессии двухцепочечных антител векторы, кодирующие как тяжелую, так и легкую цепи, могут коэкспрессироваться в клетке-хозяине для экспрессии целой молекулы иммуноглобулина, как подробно изложено ниже.

[0234] Определенные варианты осуществления включают выделенный полинуклеотид, содержащий нуклеиновую кислоту, которая кодирует вышеописанные VH и VL, где связывающая молекула или ее антигенсвязывающий фрагмент, экспрессируемые полинуклеотидом, специфически связываются с Psl Pseudomonas. В некоторых вариантах осуществления описанный полинуклеотид, кодирующий молекулу scFv, содержащую VH и VL, по меньшей мере на 80%, 85%, 90%, 95% или 100% идентичен по отношению к одной или нескольким из SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69 или SEQ ID NO: 70, показанным в таблице 4.

[0235] Некоторые варианты осуществления включают векторы, содержащие вышеописанные полинуклеотиды. В дополнительных вариантах осуществления полинуклеотиды функционально связаны с промотором. В дополнительных вариантах осуществления настоящее раскрытие обеспечивает клетки-хозяева, содержащие такие векторы. В дополнительных вариантах осуществления настоящее раскрытие обеспечивает векторы, в которых полинуклеотид функционально связан с промотором, где векторы могут экспрессировать связывающую молекулу, которая специфически связывается с Psl Pseudomonas в подходящей клетке-хозяине.

[0236] Также обеспечивается способ получения связывающей молекулы или ее фрагмента, которые специфически связываются с Psl Pseudomonas, включающий культивирование клетки-хозяина, содержащей вектор, содержащий вышеописанные полинуклеотиды, и извлечение указанного антитела или его фрагмента. В дополнительных вариантах осуществления настоящее раскрытие обеспечивает выделенную связывающую молекулу или ее фрагмент, полученные с помощью вышеописанного способа.

[0237] Применяемое в данном документе выражение "клетки-хозяева" относится к клеткам, которые содержат векторы, сконструированные с помощью методик рекомбинантных ДНК и кодирующие по меньшей мере один гетерологичный ген. В описаниях способов выделения антител из рекомбинантных хозяев выражения "клетка" и "культура клеток" применяют взаимозаменяемо для обозначения источника антитела, если явно не указано иное. Другими словами, извлечение полипептида из "клеток" может означать либо таковое из осажденных центрифугированием целых клеток, либо таковое из культуры клеток, содержащей как среду, так и суспендированные клетки.

[0238] Для экспрессии молекул антител для применения в способах, описываемых в данном документе, можно использовать множество векторных систем экспрессии в хозяине. Такие системы экспрессии в хозяине представляют носители, с помощью которых кодирующие последовательности, представляющие интерес, можно получать и впоследствии очищать, но также представляют клетки, которые могут, будучи трансформированными или трансфицированными с помощью подходящих нуклеотидных кодирующих последовательностей, экспрессировать молекулу антитела по настоящему раскрытию in situ. Они включают, без ограничений, микроорганизмы, такие как бактерии (например, E. coli, B. subtilis), трансформированные рекомбинантными векторами экспрессии на основе ДНК бактериофага, плазмидной ДНК или космидной ДНК, содержащими последовательности, кодирующие антитела; дрожжи (например, Saccharomyces, Pichia), трансформированные рекомбинантными векторами экспрессии в дрожжах, содержащими последовательности, кодирующие антитела; системы клеток насекомых, инфицированные рекомбинантными векторами экспрессии на основе вируса (например, бакуловируса), содержащими последовательности, кодирующие антитела; системы растительных клеток, инфицированные рекомбинантными векторами экспрессии на основе вируса (например, вируса мозаики цветной капусты, CaMV; вируса табачной мозаики, TMV) или трансформированные рекомбинантными векторами экспрессии на основе плазмиды (например, Ti-плазмиды), содержащими последовательности, кодирующие антитела; или системы клеток млекопитающих (например, клетки COS, CHO, BLK, 293, 3T3), содержащие рекомбинантные конструкты для экспрессии, содержащие промоторы, полученные из генома клеток млекопитающих (например, промотор гена металлотионеина) или из вирусов млекопитающих (например, поздний промотор аденовируса; промотор вируса коровьей оспы 7.5K). Бактериальные клетки, такие как клетки Escherichia coli, или эукариотические клетки, в частности, для экспрессии полной молекулы рекомбинантного антитела, применяют для экспрессии молекулы рекомбинантного антитела. Например, клетки млекопитающих, такие как клетки яичников китайского хомячка (CHO), совместно с вектором, таким как главный средне-ранний промоторный элемент гена из цитомегаловируса человека, являются эффективной системой экспрессии для антител (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).

[0239] Линия клеток-хозяев, применяемых для экспрессии белка, зачастую происходит из млекопитающих; специалисты в данной области наделены способностью определять конкретные линии клеток-хозяев, которые наилучшим образом подходят для экспрессии в них желаемого продукта гена. Иллюстративные линии клеток-хозяев включают, без ограничений, CHO (яичник китайского хомячка), DG44 и DUXB 11 (линии клеток яичников китайского хомячка, DHFR-отрицательные), HELA (карцинома шейки матки человека), CVI (линия клеток почки обезьяны), COS (производное CVI с T-антигеном SV40), VERY, BHK (почка детеныша хомячка), MDCK, 293, WI38, R1610 (фибробласт китайского хомячка), BALBC/3T3 (фибробласт мыши), HAK (линия клеток почки хомячка), SP2/0 (миелома мыши), P3x63-Ag3.653 (миелома мыши), BFA-lclBPT (эндотелиальные клетки крупного рогатого скота), RAJI (лимфоцит человека) и 293 (почка человека). Линии клеток-хозяев обычно доступны из коммерческих служб, Американской коллекции тканевых культур или из опубликованной литературы.

[0240] Кроме того, можно выбрать такой штамм клеток-хозяев, который модулирует экспрессию вставленных последовательностей или модифицирует и осуществляет процессинг продукта гена определенным желаемым способом. Такие модификации (например, гликозилирование) и процессинг (например, расщепление) белковых продуктов могут быть важными для функции белка. Разные клетки-хозяева имеют характеристики и определенные механизмы для посттрансляционного процессинга и модификации белков и продуктов генов. Можно выбирать подходящие линии клеток или системы экспрессии в хозяине для обеспечения правильной модификации и процессинга экспрессируемого чужеродного белка. В связи с этим можно применять эукариотические клетки-хозяева, которые обладают клеточным аппаратом для надлежащего процессинга первичного транскрипта, гликозилирования и фосфорилирования продукта гена.

[0241] Для длительной выработки рекомбинантных белков с высоким выходом стабильная экспрессия является предпочтительной. Например, можно сконструировать линии клеток, в которых происходит стабильная экспрессия молекул антител. Вместо применения векторов экспрессии, которые содержат вирусные точки начала репликации, клетки-хозяева можно трансформировать с помощью ДНК, регулируемой подходящими элементами регуляции экспрессии (например, промотором, энхансером, последовательностями, терминаторами транскрипции, сайтами полиаденилирования и т.д.), и селектируемого маркера. После введения чужеродной ДНК сконструированным клеткам можно позволить расти в течение 1-2 суток в обогащенной среде, а затем их переносят в селективную среду. Селектируемый маркер в рекомбинантной плазмиде придает устойчивость к селекции и позволяет клеткам стабильно интегрировать плазмиду в их хромосомы и расти с формированием очагов, которые, в свою очередь, можно клонировать, и количество которых можно увеличить до линии клеток. Этот способ можно преимущественно применять для конструирования линий клеток, в которых происходит стабильная экспрессия молекулы антитела.

[0242] Можно применять ряд систем для селекции, в том числе, без ограничений, можно использовать гены тимидинкиназы вируса простого герпеса (Wigler et al., Cell 11:223 (1977)), гипоксантин-гуанинфосфорибозилтрансферазы (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)) и аденинфосфорибозилтрансферазы (Lowy et al., Cell 22:817 1980) в tk-, hgprt- или aprt-клетках, соответственно. Также можно использовать устойчивость к антиметаболитам в качестве основы для селекции по следующим генам: dhfr, который придает устойчивость к метотрексату (Wigler et al, Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); gpt, который придает устойчивость к микофеноловой кислоте (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, который придает устойчивость к аминогликозиду G-418, Clinical Pharmacy 12:488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); и Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); TIB TECH 11(5): 155-215 (May, 1993); и hygro, который придает устойчивость к гигромицину (Santerre et al., Gene 30:147 (1984). Способы, широко известные в области техники, к которой относится технология рекомбинантных ДНК, которые можно применять, описаны в Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); и в Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), которые включены в данный документ посредством ссылки во всей своей полноте.

[0243] Уровни экспрессии молекулы антитела можно повышать посредством амплификации вектора (в отношении обзора см. Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Academic Press, New York, Vol. 3. (1987)). Если маркер в векторной системе, экспрессирующей антитело, является амплифицируемым, то при повышении уровня ингибитора, присутствующего в культуре клеток-хозяев, будет повышаться число копий маркерного гена. Поскольку амплифицируемая область связана с геном антитела, выработка антитела будет также повышаться (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).

[0244] Выработка in vitro позволяет увеличить масштаб с получением больших количеств желаемых полипептидов. Методики культивирования клеток млекопитающих в условиях тканевой культуры известны в данной области техники и включают гомогенную суспензионную культуру, например, в аэролифтном реакторе или в реакторе с непрерывным перемешиванием, или иммобилизованную или фиксированную культуру клеток, например, в полых волокнах, микрокапсулах, на агарoзных микрогранулах или керамических картриджах. Если необходимо и/или желательно, растворы полипептидов можно очищать с помощью общепринятых способов хроматографии, например, гель-фильтрационной, ионнообменной хроматографии, хроматографии на DEAE-целлюлозе или (иммуно-)аффинной хроматографии, например, после предпочтительного биосинтеза синтетической шарнирной области полипептида или перед или вслед за этапом HIC-хроматографии, описанным в данном документе.

[0245] Конструкты, кодирующие молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, раскрытые в данном документе, могут также экспрессироваться клетками, не являющимися клетками млекопитающих, такими как клетки бактерий, или дрожжей, или растений. Бактерии, которые легко принимают нуклеиновые кислоты, включают представителей семейства Enterobacteriaceae, таких как штаммы Escherichia coli или Salmonella; Bacillaceae, таких как Bacillus subtilis; Pneumococcus; Streptococcus и Haemophilus influenzae. Дополнительно следует иметь в виду, что если гетерологичные полипептиды экспрессируются в бактериях, они, как правило, входят в состав телец-включений. Гетерологичные полипептиды нужно выделять, очищать и затем собирать в функциональные молекулы. Если желательны тетравалентные формы антител, субъединицы затем будут самостоятельно собираться в тетравалентные антитела (WO02/096948A2).

[0246] В бактериальных системах количество векторов экспрессии можно преимущественно выбирать в зависимости от предполагаемого применения экспрессируемой молекулы антитела. Например, если необходимо получить большое количество такого белка для создания фармацевтических композиций на основе молекулы антитела, могут быть желательными векторы, которые управляют экспрессией высоких уровней продуктов на основе белка слияния, которые легко очищаются. Такие векторы включают, без ограничений, вектор экспрессии pUR278 в E. coli (Ruther et al., EMBO J. 2:1791 (1983)), в котором последовательность, кодирующая антитело, может быть отдельно лигирована в вектор внутрирамочно с областью, кодирующей lacZ, таким образом, что вырабатывается белок слияния; векторы pIN (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989)) и т.п. Также можно применять векторы pGEX для экспрессии чужеродных полипептидов в виде белков слияния с глутатион-S-трансферазой (GST). В целом, такие белки слияния являются растворимыми, и их можно легко очищать из лизированных клеток посредством адсорбции и связывания с матрицей на основе глутатион-агарoзных гранул с последующим элюированием в присутствии свободного глутатиона. Векторы pGEX разработаны таким образом, что они включают сайты расщепления протеазами тромбином или фактором Xa, так что клонируемый целевой продукт гена можно высвобождать из GST-фрагмента.

[0247] В дополнение к прокариотам можно применять эукариотические микробы. Saccharomyces cerevisiae, или обыкновенные пекарские дрожжи, являются наиболее часто применяемыми среди эукариотических микроорганизмов, хотя широко доступен ряд других штаммов, например, Pichia pastoris.

[0248] Для экспрессии в Saccharomyces, например, широко применяется плазмида YRp7 (Stinchcomb et al., Nature 282:39 (1979); Kingsman et al., Gene 7:141 (1979); Tschemper et al., Gene 10:157 (1980)). Эта плазмида уже содержит ген TRP1, который обеспечивает селектируемый маркер для мутантного штамма дрожжей, у которого отсутствует способность расти в присутствии триптофана, например, № 44076 в ATCC или PEP4-1 (Jones, Genetics 85:12 (1977)). Наличие повреждения trpI в качестве характеристики генома дрожжевых клеток-хозяев в этом случае обеспечивает эффективную среду для выявления трансформации с помощью роста в отсутствии триптофана.

[0249] В системе на основе клеток насекомых, как правило, в качестве вектора для экспрессии чужеродных генов применяют вирус ядерного полиэдроза Autographa californica (AcNPV). Вирус растет в клетках Spodoptera frugiperda. Последовательность, кодирующую антитело, можно отдельно клонировать в несущественные области вируса (например, ген полиэдрина) и помещать под контроль промотора AcNPV (например, промотора гена полиэдрина).

[0250] Когда молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, раскрытые в данном документе, экспрессирована рекомбинантным путем, ее можно очищать с помощью любого известного в области техники способа очистки молекулы иммуноглобулина, например, с помощью хроматографии (например, ионнообменной, аффинной хроматографии, в частности, с аффинностью в отношении специфического антигена после добавления белка A, и колоночной хроматографии с разделением по размеру), центрифугирования, дифференциальной растворимости или с помощью любой другой стандартной методики очистки белков. Другой способ повышения аффинности антител по настоящему раскрытию раскрыт в US 2002 0123057 A1.

VII. ИДЕНТИФИКАЦИЯ СВЯЗЫВАЮЩИХ МОЛЕКУЛ, ИНДИФФЕРЕНТНЫХ В ОТНОШЕНИИ СЕРОТИПА

[0251] Настоящее раскрытие охватывает индифферентный в отношении мишени подход с использованием целых клеток для идентификации серотип-независимых терапевтических связывающих молекул, например, антител или их фрагментов, с превосходными или желаемыми видами терапевтической активности. Способ можно использовать для идентификации связывающих молекул, которые могут противодействовать нежелательной активности возбудителя инфекции, например, бактериального патогена, нейтрализовать, устранять или блокировать ее. Как известно в данной области техники, у многих возбудителей инфекции проявляется значительное разнообразие их преобладающих поверхностных антигенов, что позволяет им избегать иммунологического надзора. С помощью способа идентификации, описанного в данном документе, можно идентифицировать связывающие молекулы, которые нацеливаются на антигены, являющиеся общими для многих различных видов Pseudomonas или других грамотрицательных патогенов, таким образом обеспечивая терапевтическое средство, которое может нацеливаться на многочисленные патогены из многочисленных видов. Например, способ был использован для идентификации группы связывающих молекул, которые связываются с поверхностью P. aeruginosa серотип-независимым образом и, будучи связанными с бактериальными патогенами, опосредуют опсонофагоцитарную активность (OPK), способствуют таковой или усиливают таковую в отношении бактериальных клеток, таких как бактериальные патогены, например, условно-патогенные виды Pseudomonas (например, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas putida и Pseudomonas alcaligenes), и/или ингибируют прикрепление таких бактериальных клеток к эпителиальным клеткам.

[0252] В определенных вариантах осуществления раскрывается способ идентификации индифферентных в отношении серотипа связывающих молекул, включающий (a) получение библиотек наивных антител и/или антител фазы выздоровления в фаге, (b) удаление серотип-специфических антител из библиотеки посредством элиминирующего пэннинга, (c) скрининг библиотеки в отношении антител, которые специфически связываются с целыми клетками независимо от серотипа, и (d) скрининг оставшихся антител в отношении желаемых функциональных свойств.

[0253] В некоторых вариантах осуществления обеспечивается подход по методу фенотипического скрининга с использованием целых клеток, раскрытый в данном документе, с фаговыми библиотеками антител, полученных либо от "наивных", либо от выздоравливающих пациентов, инфицированных P. aeruginosa. С помощью метода пэннинга, при котором изначально осуществлялась селекция против серотип-специфической реактивности, были выделены различные клоны, которые связываются с целыми клетками P. aeruginosa. Выбранные клоны были преобразованы в антитела IgG1 человека, и было подтверждено, что они реагируют с клиническими изолятами P. aeruginosa вне зависимости от группы серотипической классификации или участка изъятия ткани (см. примеры). Этапы скрининга в отношении функциональной активности, описанные в данном документе, указывали, что антитела были эффективными при предупреждении прикрепления P. aeruginosa к клеткам млекопитающих и опосредовали опсонофагоцитарное (OPK) уничтожение зависимым от концентрации и не зависимым от серотипа способом.

[0254] В дополнительных вариантах осуществления вышеописанные связывающие молекулы или их фрагменты, антитела или их фрагменты или композиции связываются с двумя или более, тремя или более, четырьмя или более или пятью или более различными серотипами P. aeruginosa или по меньшей мере с 80%, по меньшей мере 85%, по меньшей мере 90% или по меньшей мере 95% штаммов P. aeruginosa, выделенных от инфицированных пациентов. В дополнительных вариантах осуществления штаммы P. aeruginosa выделены из одного или более из легких, мокроты, глаз, гноя, фекалий, мочи, пазух, раны, кожи, крови, кости или жидкости из коленного сустава.

VIII. ФАРМАЦЕВТИЧЕСКИЕ КОМПОЗИЦИИ, СОДЕРЖАЩИЕ МОЛЕКУЛЫ, СВЯЗЫВАЮЩИЕСЯ С PSL PSEUDOMONAS

[0255] Фармацевтические композиции, применяемые в настоящем раскрытии, содержат фармацевтически приемлемые носители, хорошо известные специалистам в данной области. Препараты для парентерального введения включают стерильные водные или неводные растворы, суспензии и эмульсии. Определенные фармацевтические композиции, раскрытые в данном документе, можно вводить перорально в виде приемлемой лекарственной формы, включая, например, капсулы, таблетки, водные суспензии или растворы. Определенные фармацевтические композиции можно вводить посредством назального аэрозоля или путем ингаляции. Могут также присутствовать консерванты и другие добавки, такие как, например, противомикробные средства, антиоксиданты, хелатирующие средства и инертные газы и т.п. Подходящие составы для применения в терапевтических способах, раскрытых в данном документе, описаны в Remington's Pharmaceutical Sciences, Mack Publishing Co., 16th ed. (1980).

[0256] Количество молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, которую можно объединять с материалами-носителями с получением единичной лекарственной формы, будет варьировать в зависимости от обрабатываемого хозяина и конкретного способа введения. Схему дозирования также можно установить таким образом, чтобы обеспечивать оптимальный желаемый эффект (например, терапевтический или профилактический эффект). Композиции могут также содержать молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, диспергированные в биологически совместимом материале-носителе, который выполняет функцию подходящей системы доставки или скрепления соединений.

IX. СПОСОБЫ ЛЕЧЕНИЯ С ПОМОЩЬЮ ТЕРАПЕВТИЧЕСКИХ СВЯЗЫВАЮЩИХ МОЛЕКУЛ

[0257] Способы получения и введения молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, раскрытых в данном документе, субъекту, нуждающемуся в этом, хорошо известны специалистам в данной области или могут быть без труда определены ими. Путь введения молекулы, связывающейся с Psl Pseudomonas, например, антитела или его фрагмента, варианта или производного, может быть, например, пероральным, парентеральным, ингаляционным или местным. Выражение "парентеральное", применяемое в данном документе, включает, например, внутривенное, внутриартериальное, интраперитонеальное, внутримышечное или подкожное введение. Подходящей формой для введения будет раствор для инъекций, в частности, для внутривенных или внутриартериальных инъекций или капельного введения. Однако в других способах, совместимых с идеями, изложенными в данном документе, молекула, связывающаяся с Psl Pseudomonas, например, антитело или его фрагмент, вариант или производное, раскрытые в данном документе, может быть доставлена непосредственно к участку с нежелательной клеточной популяцией, например, к очагу инфекции, таким образом увеличивая воздействие терапевтического средства на пораженную ткань. Например, молекулу, связывающуюся с Psl Pseudomonas, можно непосредственно вводить в ткань глаза, область ожоговой травмы или ткань легких.

[0258] Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, раскрытые в данном документе, можно вводить в фармацевтически эффективном количестве для лечения in vivo инфекции, вызываемой Pseudomonas. В этом отношении следует иметь в виду, что раскрытые связывающие молекулы будут составлять таким образом, чтобы облегчать введение и способствовать стабильности активного средства. Для целей настоящей заявки фармацевтически эффективное количество будет означать количество, достаточное для достижения эффективного связывания с мишенью и получения пользы, например, лечения, улучшения, облегчения, устранения или предупреждения инфекции, вызываемой Pseudomonas.

[0259] Некоторые варианты осуществления направлены на способ предупреждения или лечения инфекции, вызываемой Pseudomonas, у субъекта, нуждающегося в этом, включающий введение данному субъекту эффективного количества связывающей молекулы или ее фрагмента, антитела или его фрагмента, композиции, полинуклеотида, вектора или клетки-хозяина, описываемых в данном документе. В дополнительных вариантах осуществления инфекция, вызываемая Pseudomonas, представляет собой инфекцию, вызываемую P. aeruginosa. В некоторых вариантах осуществления субъект является человеком. В некоторых вариантах осуществления инфекция является инфекцией глаз, инфекцией легких, ожоговой инфекцией, раневой инфекцией, кожной инфекцией, инфекцией крови, инфекцией костей или комбинацией двух или более из указанных инфекций. В дополнительных вариантах осуществления субъект страдает от острой пневмонии, ожоговой травмы, инфекции роговицы, муковисцидоза или их комбинации.

[0260] Некоторые варианты осуществления направлены на способ блокирования или предупреждения прикрепления P. aeruginosa к эпителиальным клеткам, включающий приведение смеси эпителиальных клеток и P. aeruginosa в контакт со связывающей молекулой или ее фрагментом, антителом или его фрагментом, композицией, полинуклеотидом, вектором или клеткой-хозяином, описываемыми в данном документе.

[0261] Также раскрывается способ усиления OPK P. aeruginosa, включающий приведение смеси фагоцитарных клеток и P. aeruginosa в контакт со связывающей молекулой или ее фрагментом, антителом или его фрагментом, композицией, полинуклеотидом, вектором или клеткой-хозяином, описываемыми в данном документе. В дополнительных вариантах осуществления фагоцитарные клетки являются дифференцированными клетками HL-60 или полиморфноядерными лейкоцитами (PMN).

[0262] В соответствии с объемом настоящего раскрытия молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно вводить человеку или другому животному в соответствии с вышеуказанными способами лечения в количестве, достаточном для получения терапевтического эффекта. Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, раскрытые в данном документе, можно вводить такому человеку или другому животному в традиционной лекарственной форме, полученной путем объединения антитела по настоящему раскрытию с традиционным фармацевтически приемлемым носителем или разбавителем в соответствии с известными методиками.

[0263] Эффективные дозы композиций по настоящему раскрытию для лечения инфекции, вызываемой Pseudomonas, варьируют в зависимости от множества различных факторов, включая способ введения, участок-мишень, физиологическое состояние пациента, того, является ли пациент человеком или животным, других вводимых лекарственных препаратов и того, является ли лечение профилактическим или терапевтическим. Как правило, пациент является человеком, но также можно лечить млекопитающих, отличных от человека, включая трансгенных млекопитающих. Дозировки для лечения можно титровать с помощью обычных способов, известных специалистам в данной области, для получения оптимальных безопасности и эффективности.

[0264] Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно вводить многократно с различной частотой, зависящей от различных факторов, известных специалистам в данной области. Альтернативно, молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно вводить в виде состава с замедленным высвобождением, в этом случае требуется менее частое введение. Дозировка и частота варьируют в зависимости от периода полувыведения антитела из организма пациента.

[0265] Композиции по настоящему раскрытию можно вводить любым подходящим способом, например, парентерально, интравентрикулярно, перорально, посредством ингаляционного спрея, местно, ректально, назально, трансбуккально, вагинально или через имплантируемый резервуар. Выражение "парентеральное", используемое в данном документе, включает методики подкожных, внутривенных, внутримышечных, внутрисуставных, интрасиновиальных, интрастернальных, интратекальных, внутрипеченочных, внутриочаговых и интракраниальных инъекции или инфузии.

X. ИММУНОЛОГИЧЕСКИЕ АНАЛИЗЫ

[0266] Молекулы, связывающиеся с Psl Pseudomonas, например, антитела или их фрагменты, варианты или производные, можно анализировать в отношении иммуноспецифического связывания любым способом, известным в данной области техники. Иммунологические анализы, которые можно применять, включают, без ограничений, системы конкурентного и неконкурентного анализа с использованием методик, таких как вестерн-блоттинг, радиоиммунологические анализы, ELISA (иммуноферментный анализ), иммунологические "сэндвич"-анализы, анализы на основе иммунопреципитации, реакции преципитации, реакции диффузионной преципитации в геле, анализы на основе иммунодиффузии, анализы на основе агглютинации, анализы на основе фиксации комплемента, иммунорадиометрические анализы, флуоресцентные иммунологические анализы, иммунологические анализы с белком A, и это лишь некоторые из них. Такие анализы являются стандартными и хорошо известны в данной области техники (см., например, Ausubel et al., eds, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, Vol. 1 (1994), который включен в настоящий документ посредством ссылки во всей своей полноте). Иллюстративные иммунологические анализы вкратце описаны ниже (но не подразумеваются как ограничивающие).

[0267] Существуют разнообразные способы, доступные для измерения аффинности взаимодействия антитело-антиген, но относительно немного для определения констант скорости. Большинство способов основаны на мечении антитела либо антигена, что неизбежно усложняет стандартные измерения и вносит неточности в измеряемые значения количества. Аффинность антитела можно измерять с помощью ряда способов, включая OCTET®, BIACORE®, ELISA и FACS.

В системе OCTET® используются биосенсоры в формате 96-луночного планшета для представления результатов кинетического анализа. Факты связывания белка и диссоциации можно отслеживать путем измерения связывания одного белка в растворе со вторым белком, иммобилизованным на биосенсоре FortéBio. В случае измерения связывания антитела к Psl с Psl Psl иммобилизуют на головках OCTET® с последующим анализом связывания антитела, которое находится в растворе. Ассоциацию и диссоциацию антитела с иммобилизованным Psl затем выявляют с помощью сенсорного прибора. Данные затем собирают и экспортируют в GraphPad Prism для построения кривой аффинности.

[0268] Поверхностный плазмонный резонанс (SPR), осуществляемый на BIACORE®, дает ряд преимуществ над традиционными способами измерения аффинности взаимодействий антитело-антиген: (i) нет необходимости в мечении антитела либо антигена; (ii) антитела не нужно предварительно очищать, можно непосредственно применять надосадочную жидкость культуры клеток; (iii) обеспечивается возможность измерений в реальном времени, дающих возможность осуществления быстрого полуколичественного сравнения различных взаимодействий с моноклональным антителом, и эти измерения являются достаточными для многих целей оценивания; (iv) биоспецифическую поверхность можно регенерировать таким образом, что группу различных моноклональных антител можно легко сравнивать в идентичных условиях; (v) аналитические методы полностью автоматизированы, и можно осуществлять обширные серии измерений без вмешательства пользователя. BIAapplications Handbook, версия AB (переиздание 1998 г.), BIACORE®, кодовый № BR-1001-86; BIAtechnology Handbook, версия AB (переиздание 1998 г.), BIACORE®, кодовый № BR-1001-84.

[0269] Изучения связывания на основе SPR требуют, чтобы один участник пары связывания был иммобилизован на поверхности сенсора. Иммобилизованный партнер связывания называют лигандом. Партнер связывания в растворе называют аналитом. В некоторых случаях лиганд прикреплен к поверхности опосредованно через связывание с другой иммобилизованной молекулой, которую называют молекулой захвата. Отклик SPR отражает изменение массовой концентрации на поверхности детектора по мере того, как происходит связывание аналитов или диссоциация.

[0270] На основе SPR с помощью измерений в реальном времени на BIACORE® отслеживают взаимодействия, как только они происходят. Методика подходит для определения кинетических параметров. Чрезвычайно просто осуществлять сравнительное ранжирование значений аффинности, и из данных сенсограммы можно получить как кинетические константы, так и константы аффинности.

[0271] Когда аналит вносят дискретно пульсовым методом на всю поверхность с лигандом, полученную сенсограмму можно разделить на три основные фазы: (i) ассоциация аналита с лигандом во время внесения образца; (ii) состояние равновесия или стационарное состояние во время внесения образца, при котором скорость связывания аналита уравновешена диссоциацией из комплекса; (iii) диссоциация аналита из поверхности во время протекания буфера.

[0272] Фазы ассоциации и диссоциации обеспечивают информацию о кинетике взаимодействия аналита с лигандом (ka и kd, скорости образования комплексов и диссоциации, kd/ka=KD). Фаза равновесия обеспечивает информацию об аффинности взаимодействия аналита с лигандом (KD).

[0273] Программное обеспечение BIAevaluation обеспечивает обширные возможности для построения кривых при помощи как численного интегрирования, так и глобальных алгоритмов подбора. При помощи подходящего анализа данных можно получить отдельные константы скорости и аффинности взаимодействия на основании простых исследований с помощью BIACORE®. Значения аффинности, которые могут быть измерены с помощью этой методики, находятся в очень широком диапазоне, варьируя в диапазоне от мМ до пМ.

[0274] Специфичность в отношении эпитопа является важной характеристикой моноклонального антитела. Картирование эпитопов с помощью BIACORE®, в отличие от традиционных методик с применением радиоиммунологического анализа, ELISA или других способов на основе адсорбции на поверхности, не требует мечения или очищения антител и позволяет осуществлять тесты на специфичность в отношении нескольких сайтов с применением последовательности нескольких моноклональных антител. Дополнительно, большое число анализов можно производить автоматически.

[0275] В парных экспериментах по связыванию тестируется способность двух MAb к одновременному связыванию с одним и тем же антигеном. MAb, направленные против отдельных эпитопов, будут связываться независимо, тогда как MAb, направленные против идентичных или близкородственных эпитопов, будут препятствовать друг другу в связывании. Эти эксперименты по связыванию, осуществляемые с помощью BIACORE®, не вызывают затруднений при проведении.

[0276] Например, можно применять молекулу захвата для связывания с первым MAb с последующим последовательным добавлением антигена и второго MAb. На сенсограммах будет выявлено: 1) какое количество антигена связывается с первым MAb, 2) до какой степени второе MAb связывается с антигеном, прикрепленным к поверхности, 3) если второе MAb не связывается, изменяет ли результаты изменение порядка проведения парного теста на обратный.

[0277] Пептидное ингибирование является методикой, применяемой для картирования эпитопов. Этот способ может дополнять парные исследования связывания антител и может соотносить функциональные эпитопы со структурными признаками, когда известна первичная последовательность антигена. Пептиды или фрагменты антигена тестируют в отношении ингибирования связывания различных MAb с иммобилизованным антигеном. Полагают, что пептиды, препятствующие связыванию данного MAb, являются родственными по структуре эпитопу, определенному с помощью этого MAb.

[0278] В практических аспектах настоящего раскрытия будут использоваться, если не указано иное, традиционные методики клеточной биологии, культивирования клеток, молекулярной биологии, биологии трансгенных организмов, микробиологии, рекомбинантных ДНК и иммунологии, которые находятся в пределах компетентности в данной области техники. Такие методики в полной мере пояснены в литературе. См., например, Molecular Cloning A Laboratory Manual, 2nd Ed., Sambrook et al., ed., Cold Spring Harbor Laboratory Press: (1989); Molecular Cloning: A Laboratory Manual, Sambrook et al., ed., Cold Springs Harbor Laboratory, New York (1992), DNA Cloning, D. N. Glover ed., Volumes I and II (1985); Oligonucleotide Synthesis, M. J. Gait ed., (1984); патент США № 4683195 Mullis et al.; Nucleic Acid Hybridization, B. D. Hames & S. J. Higgins eds. (1984); Transcription And Translation, B. D. Hames & S. J. Higgins eds. (1984); Culture Of Animal Cells, R. I. Freshney, Alan R. Liss, Inc., (1987); Immobilized Cells And Enzymes, IRL Press, (1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); научный труд Methods In Enzymology, Academic Press, Inc., N.Y.; Gene Transfer Vectors For Mammalian Cells, J. H. Miller and M. P. Calos eds., Cold Spring Harbor Laboratory (1987); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.); Immunochemical Methods In Cell And Molecular Biology, Mayer and Walker, eds., Academic Press, London (1987); Handbook Of Experimental Immunology, Volumes I-IV, D. M. Weir and C. C. Blackwell, eds., (1986); Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); и в Ausubel et al, Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989).

[0279] Авторитетные справочные издания, в которых изложены общие принципы иммунологии, включают Current Protocols in Immunology, John Wiley & Sons, New York; Klein, J., Immunology: The Science of Self-Nonself Discrimination, John Wiley & Sons, New York (1982); Roitt, I., Brostoff, J. and Male D., Immunology, 6th ed. London: Mosby (2001); Abbas A., Abul, A. and Lichtman, A., Cellular and Molecular Immunology, Ed. 5, Elsevier Health Sciences Division (2005); и Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1988).

[0280] Теперь при наличии подробного описания настоящего раскрытия таковое будет более ясно понято с помощью ссылки на следующие примеры, которые включены в данный документ только в целях иллюстрации и не предназначены для ограничения настоящего раскрытия. Все патенты и публикации, упоминаемые в данном документе, включены в явной форме посредством ссылки во всей своей полноте.

ПРИМЕРЫ

Пример 1. Конструирование и скрининг фаг-дисплейных библиотек антител человека

[0281] В этом примере описывается подход по методу пэннинга, индифферентного в отношении мишени, с помощью целых клеток, в котором применяют фаговые библиотеки антител человека, полученные как от "наивных", так и от выздоравливающих пациентов, инфицированных P. aeruginosa, для идентификации новых антигенов, защищающих от инфекции, вызываемой Pseudomonas (фигура 1A). Анализы, включенные в этапы функционального скрининга in vitro, включают анализы опсонофагоцитарного (OPK) уничтожения и анализы прикрепления к клеткам с применением эпителиальных клеток линии A549. Кандидатов-лидеров, определенных на основе превосходящей активности in vitro, тестировали в моделях острой пневмонии, вызываемой P. aeruginosa, кератита и ожоговой инфекции.

[0282] На фигуре 1B показано конструирование фаг-дисплейной библиотеки антител пациента. Через 7-10 дней после постановки диагноза смешивали цельную кровь от 6 выздоравливающих пациентов с последующей экстракцией РНК и конструированием фаговых библиотек согласно описанному ранее (Vaughan, T.J., et al., Nat Biotechnol 14, 309-314 (1996); Wrammert, J., et al, Nature 453, 667-671 (2008)). На фигуре 1C показано, что конечная библиотека клонированных scFv содержит 5,4×108 трансформантов, и секвенирование выявило, что 79% генов scFv были полной длины и внутрирамочными. Петли CDR3 VH, зачастую важные для определения специфичности в отношении эпитопа, перед селекцией в библиотеке различались на 84% на аминокислотном уровне.

[0283] В дополнение к библиотеке от пациента, для выделения антител применяли фаг-дисплейную библиотеку наивных scFv человека, содержащую до 1×1011 участников связывания (Lloyd, C., et al, Protein Eng Des Sel 22, 159-168 (2009)) (Vaughan, T.J., et al, Nat Biotechnol 14, 309-314 (1996)). Убитую нагреванием P. aeruginosa (1×109) иммобилизировали в пробирках IMMUNO™ (Nunc; MAXISORP™) с последующими циклами селекции по методу фагового дисплея согласно описанному (Vaughan, T.J., et al, Nat Biotechnol 14, 309-314 (1996)), за исключением того, что в качестве элюирующего буфера применяли триэтаноламин (100 нΜ). Для селекции P. aeruginosa в суспензии убитые нагреванием клетки блокировали с последующим добавлением блокированного фага к клеткам. После промывания применяли элюированный фаг для инфицирования клеток E. coli согласно описанному (Vaughan, 1996). Освобождение фага из E. coli и связывание с убитой нагреванием P. aeruginosa выполняли с помощью ELISA согласно описанному (Vaughan, 1996).

[0284] После разработки и валидации методики селекции в отношении аффинности с использованием целых клеток как новую библиотеку от выздоравливающего пациента, так и ранее сконструированную наивную библиотеку (Vaughan, T.J., et al, Nat Biotechnol 14, 309-314 (1996)) подвергали селекции в отношении аффинности в суспензиях штамма 3064 P. aeruginosa, имеющего полный O-антиген, а также изогенного мутантного штамма wapR, у которого отсутствует поверхностная экспрессия O-антигена. На фигуре 1D показано, что выходные титры в последовательных циклах селекции в библиотеках от пациентов, как было обнаружено, увеличиваются с большей скоростью применительно к библиотеке от пациента, чем применительно к наивной библиотеке (1×107 в сравнении с 3×105 в цикле 3, соответственно). В дополнение, также было обнаружено, что уровень дупликации последовательностей петель CDR3 VH в библиотеках (мера обогащения клонами в ходе селекции) является более высоким в библиотеке от пациента, достигая 88-92% по сравнению с 15-25% в наивной библиотеке в цикле 3 (фигура 1D). Отдельный scFv-фаг из циклов селекции в отношении аффинности затем подвергали скринингу с помощью ELISA на реактивность в отношении штаммов гетерологичных серотипов P. aeruginosa (фигура 1E). Планшеты для ELISA (Nunc; MAXISORP™) покрывали штаммами P. aeruginosa из суточных культур согласно описанному (DiGiandomenico, A., et al., Infect Immun 72, 7012-7021 (2004)). Разведенные антитела добавляли в блокированные планшеты на 1 час, промывали и обрабатывали вторичными антителами к иммуноглобулинам человека, конъюгированными с HRP, в течение 1 часа с последующими проявлением и анализом согласно описанному (Ulbrandt, N.D., et al, J Virol 80, 7799-7806 (2006)). Преобладающий вид фага, полученный из циклов селекции с использованием целых клеток в обоих библиотеках, давал серотип-специфическую реактивность (данные не показаны). Клоны, проявляющие связывание, независимое от серотипа, в отсутствие неспецифического связывания с E. coli или бычьим сывороточным альбумином, отбирали для дополнительного оценивания.

[0285] Что касается экспрессии IgG, VH- и VL-цепи выбранных антител клонировали в векторы экспрессии IgG1 человека, подвергали коэкспрессии в клетках HEK293 и очищали с помощью аффинной хроматографии с белком A согласно описанному (Persic, L., et al., Gene 187, 9-18 (1997)). Для антител IgG1 человека, созданных с вариабельными областями от этих выбранных фагов, независимых от серотипа, была подтверждена специфичность в отношении P. aeruginosa, и им отдавали предпочтение при последующем анализе путем связывания с использованием целых клеток с преобладающими клинически значимыми серотипами с помощью FACS-анализа (фигура 1F), поскольку этот способ является более строгим, чем ELISA. Что касается анализов связывания на основе проточной цитометрии, штаммы P. aeruginosa в середине логарифмического роста концентрировали в PBS до OD650, составляющей 2,0. После инкубирования антитела (10 мкг/мл) и бактерий (~1×107 клеток) в течение 1 часа при 4°C со встряхиванием промытые клетки инкубировали с антителом козы к IgG человека, конъюгированным с ALEXA FLUOR 647® (Invitrogen, Карлсбад, Калифорния), в течение 0,5 часа при 4°C. Промытые клетки окрашивали зеленым красителем для бактерий BACLIGHT™ согласно рекомендациям (Invitrogen, Карлсбад, Калифорния). Образцы прогоняли на проточном цитометре LSR II (BD Biosciences) и анализировали при помощи BD FacsDiva (версия 6.1.3) и Flow Jo (версия 9.2; TreeStar). Антителам, проявляющим связывание, выявляемое при помощи FACS, дополнительно отдавали предпочтение при тестировании функциональной активности в анализе опсонофагоцитарного уничтожения (OPK).

Пример 2. Оценивание mAb, способствующих OPK P. aeruginosa

[0286] В этом примере описывается оценивание антител IgG1 человека, которым отдали предпочтение, в отношении способствования OPK P. aeruginosa. На фигуре 2A показано, что за исключением WapR-007 и антитела R347, представляющего собой отрицательный контроль, все антитела опосредовали уничтожение люминесцентного штамма (PAO1.lux) серогруппы O5 P. aeruginosa, зависимое от концентрации. WapR-004 и Cam-003 проявляли превосходящую OPK-активность. Анализы OPK выполняли согласно описанному в (DiGiandomenico, A., et al., Infect Immun 72, 7012-7021 (2004)), с модификациями. Вкратце, анализы выполняли в 96-луночных планшетах с применением по 0,025 мл каждого из компонентов OPK: штаммов P. aeruginosa; разведенной сыворотки крольчонка; дифференцированных клеток HL-60 и моноклонального антитела. В некоторых анализах OPK применяли люминесцентные штаммы P. aeruginosa, сконструированные согласно описанному (Choi, K.H., et al., Nat Methods 2, 443-448 (2005)). Люминесцентные анализы OPK выполняли согласно описанному выше, но с определением относительных единиц активности люциферазы (RLU) при помощи многометочного планшет-ридера Perkin Elmer ENVISION (Perkin Elmer).

[0287] Оценивали способность антител WapR-004 и Cam-003 опосредовать OPK-активности против другого штамма клинически значимого серотипа, имеющего O-антиген, 9882-80.lux. На фигуре 2B показано, что усиленная активность WapR-004 и Cam-003 OPK распространяется на штамм 9882-80 (O11).

[0288] Оценивали способность Cam-003 опосредовать OPK-активность против типичных немукоидных штаммов клинически значимых серотипов, имеющих O-антиген, и против мукоидных штаммов P. aeruginosa, полученных от пациентов с муковисцидозом. Cam-003 опосредовало эффективное OPK всех тестируемых немукоидных клинических изолятов (фигура 2C). В дополнение, Cam-003 опосредовало эффективное уничтожение всех мукоидных изолятов P. aeruginosa, которые тестировали (фигура 2D).

[0289] В дополнение, в этом примере описывается оценивание мутантных WapR-004 (W4) в формате scFv-Fc в отношении способствования OPK P. aeruginosa. Один мутант, Wap-004RAD (W4-RAD), был особым образом создан посредством сайт-направленного мутагенеза с удалением RGD-мотива в VH. Другие мутантные W4 получали, как указано ниже. Гнездовую ПЦР выполняли согласно описанному (Roux, K.H., PCR Methods Appl 4, S185-194 (1995)) с амплификацией W4-вариантов (полученных в результате соматической гипермутации) из библиотеки scFv, полученной от выздоравливающих пациентов, инфицированных P. aeruginosa, для анализа. Именно из этой библиотеки получали WapR-004. Фрагменты W4-вариантов субклонировали и секвенировали при помощи стандартных методов, известных в данной области техники. Мутантные легкие цепи (LC) W4 рекомбинировали с тяжелой цепью (HC) WapR-004 с получением мутантных W4 в формате scFv-Fc. В дополнение, мутантные тяжелые цепи (HC) WapR-004 RAD рекомбинировали с родительскими LC M7 и M8 в формате scFv-Fc. Конструкты получали при помощи стандартных методов, известных в данной области техники. На фигуре 11 (A-M) показано, что, за исключением антитела R347, представляющего собой отрицательный контроль, все мутантные WapR-004 (W4) опосредовали зависимое от концентрации уничтожение люминесцентного штамма (PAO1.lux) серогруппы O5 P. aeruginosa.

Пример 3. Антитела к P. aeruginosa, независимые от серотипа, нацеливаются на экзополисахарид Psl

[0290] В этом примере описывается идентификация мишени для антител к P. aeruginosa, полученных из фенотипического скрининга. Анализ мишени проводили для тестирования того, нацеливались ли антитела, независимые от серотипа, на белковые или углеводные антигены. В ELISA в отношении экстрактов из целых клеток PAO1, подвергнутых полному расщеплению с помощью протеиназы K, не наблюдали снижения связывания, что позволяет предположить, что реактивность была нацелена на доступные поверхностные углеводные остатки (данные не показаны). Конструировали изогенные мутаны по генам, отвечающим за биосинтез O-антигена, альгината и центрального олигосахарида LPS: wbpL (без O-антигена); wbpL/algD (без O-антигена и альгината); rmlC (без O-антигена и с усеченной внешней частью центрального олигосахарида) и galU (без O-антигена и с усеченной внутренней частью центрального олигосахарида). Мутантных P. aeruginosa конструировали на основе стратегии замещения аллелей, описанной Schweizer (Schweizer, H.P., Mol Microbiol 6, 1195-1204 (1992); Schweizer, H.D., Biotechniques 15, 831-834 (1993)). Векторы мобилизовали из штамма S17.1 E. coli в штамм PAO1 P. aeruginosa; рекомбинанты выделяли согласно описанному (Hoang, T.T., et al., Gene 212, 77-86 (1998)). Делецию в генах подтверждали с помощью ПЦР. Мутантных P. aeruginosa дополняли конструктами на основе pUCP30T, имеющими гены дикого типа. Реактивность антител определяли посредством непрямого ELISA на планшетах, покрытых вышеуказанными штаммами P. aeruginosa: на фигурах 3A и 3J показано, что связывание Cam-003 с мутантом по wbpL или двойным мутантом по wbpL/algD не подвергалось воздействию, однако связывание с мутантами по rmlC и galU прекращалось. Несмотря на то, что эти результаты согласовывались со связыванием с центральным олигосахаридом LPS, реактивность в отношении LPS, очищенного из PAO1, не наблюдалась. Недавно было показано, что гены rmlC и galU требуются для биосинтеза экзополисахарида Psl, повторяющегося пентасахаридного полимера, состоящего из D-маннозы, L-рамнозы и D-глюкозы. Тестировали связывание Cam-003 с изогенным PAO1ΔpslA, нокаутным по pslA, поскольку pslA требуется для биосинтеза Psl (Byrd, M.S., et al., Mol Microbiol 73, 622-638 (2009)). Связывание Cam-003 c PAO1ΔpslA прекращалось при тестировании с помощью ELISA (фигура 3B) и FACS (фигура 3C), несмотря на то, что молекула LPS этого мутанта не подвергалась воздействию (фигура 3D). Связывание Cam-003 восстанавливалось у тройного мутанта PAO1ΔwbpL/algD/pslA, дополненного pslA (фигура 3E), как и способность Cam-003 опосредовать опсоническое уничтожение дополненного PAO1ΔpslA, в отличие от мутанта (фигуры 3F и 3G). Связывание антитела Cam-003 с экзополисахаридом Pel мутантного штамма также не подвергалось воздействию, что дополнительно подтверждает, что Psl является мишенью для антитела (фигура 3E). Анализы связывания подтверждали, что остальные антитела также связываются с Psl (фигуры 3H и 3I).

[0291] Для подтверждения того, что все антитела связываются с одним и тем же антигеном, выполняли анализ связывания с захватом Psl при помощи прибора FORTEBIO® OCTET®384, как описано выше. Антиген представлял собой обработанный протеиназой K обогащенный углевод, очищенный из PAO1ΔwbpL/algD/pelA (без O-антигена, альгината и экзополисахарида Pel). Отдельные антитела связывались с биосенсорами на основе аминопропилсилана с последующим блокированием и добавлением обогащенного углеводного антигена. После промывания с удалением несвязанного антигена давали оценку связывания немеченых mAb с захваченным антигеном. Все связанные антитела (Cam-003, Cam-004, Cam-005, WapR-001, WapR-002, WapR-003, WapR-007 и WapR-016), за исключением контрольного mAb R347, были способны к захвату антигена, реагировавшего с каждым из Cam-003, WapR-001, WapR-002, WapR-003 и WapR-016 (фигура 3K). У Cam-004, Cam-005 и WapR-007 наблюдали минимальную реактивность в отношении захваченного Psl, даже несмотря на то, что все три этих антитела захватывали Psl в количестве, достаточном для эффективной реакции с Cam-003, WapR-001, WapR-002, WapR-003 и WapR-016 (фигура 3K). Эти результаты позволяют предположить, что все mAb, полученные с помощью фенотипического скрининга, которые связываются с P. aeruginosa независимо от серотипа, нацеливаются на эпитопы, связанные с экзополисахаридом Psl.

Пример 4. MAb к Psl блокируют прикрепление P. aeruginosa к культивируемым эпителиальным клеткам

[0292] В этом примере показано, что антитела к Psl блокируют присоединение P. aeruginosa к эпителиальным клеткам. Антитела к Psl добавляли к конфлюэнтному монослою клеток A549 (линии клеток аденокарциномы из базального эпителия альвеол человека), выращиваемых в непрозрачных 96-луночных планшетах (Nunc Nunclon Delta). Люминесцентный штамм PAO1 P. aeruginosa (PAO1.lux) в логарифмической фазе роста добавляли при значении MOI, составляющем 10. После инкубирования PAO1.lux с клетками A549 при 37°C в течение 1 часа клетки A549 промывали с последующим добавлением LB+0,5% глюкозы. Бактерии оценивали количественно после непродолжительного инкубирования при 37°C, как выполнялось в анализе OPK, описанном в примере 2. Измерения от лунок без клеток A549 применяли для введения поправки на неспецифическое связывание. На фигуре 4 показано, что за исключением Cam-005 и WapR-007, все антитела уменьшали присоединение PAO1.lux к клеткам A549 в зависимости от дозы. MAb, показавшие наилучшие результаты в анализах OPK, WapR-004 и Cam-003 (см. фигуры 2A-B и пример 2), были также наиболее активными в ингибировании прикрепления клеток P. aeruginosa к клеткам легочного эпителия A549, обеспечивая уменьшение на до ~80% по сравнению с отрицательным контролем. WapR-016 было третьим наиболее активным антителом, показывающим ингибирующую активность, сходную с таковой WapR-004 и Cam-003, но при концентрации антитела, в 10 раз более высокой.

Пример 5. Пассированные in vivo штаммы P. aeruginosa поддерживают/повышают экспрессию Psl

[0293] Для тестирования того, поддерживается ли экспрессия Psl in vivo, мышам интраперитонеально вводили изоляты P. aeruginosa с последующим сбором бактерий с помощью перитонеального лаважа через четыре часа после инфицирования. Наличие Psl анализировали с контрольным антителом и Cam-003 с помощью проточной цитометрии, поскольку условия для связывания антител являются более жесткими и позволяют проводить количественную оценку клеток с наличием или отсутствием экспрессии Psl. Что касается связывания ex vivo, бактериальный инокулят (0,1 мл) получали из суточной культуры в чашке с TSA и доставляли интраперитонеально мышам BALB/c. Через 4 часа после контрольного заражения бактерии собирали, RBC лизировали, подвергали действию ультразвука и ресуспендировали в PBS с добавлением 0,1% Tween-20 и 1% BSA. Образцы окрашивали и анализировали согласно описанному ранее в примере 1. На фигуре 5 показано, что бактерии, собранные после перитонеального лаважа с тремя штаммами P. aeruginosa дикого типа, показывали сильное окрашивание с помощью Cam-003, которое было сравнимым с таковым у культивируемых бактерий в логарифмической фазе роста (сравни фигуры 5A и 5C). Пассированные in vivo бактерии дикого типа проявляли усиленное окрашивание по сравнению с инокулятом (сравни фигуры 5B и 5C). Psl не был выявлен для штамма 6077 и был выявлен на минимальном уровне для штаммов PAO1 (O5) и 6206 (O11, цитотоксичный) в инокуляте. Применительно к инокуляту связывание Cam-003 с бактериями увеличивалось, что указывает на то, что экспрессия Psl поддерживается или повышается in vivo. Штаммы 6077, PAO1 и 6206 дикого типа экспрессируют Psl после пассирования in vivo, однако штамм PAO1, имеющий делецию в pslA (PAO1ΔpslA), не способен реагировать с Cam-003. По этим результатам дополнительно делается акцент на Psl в качестве мишени для моноклональных антител.

[0294] Также оценивали уровень экспрессии/доступности Psl на поверхности штаммов PAO1 и 6206 P. aeruginosa в модели острой пневмонии. Бактерии, полученные из инкубируемых на протяжении ночи чашек с конфлюэнтным монослоем согласно описанному выше, вводили интраназально мышам BALB/c. Через 4 и 24 часа после инфицирования бактерии извлекали из легких с помощью бронхоальвеолярного лаважа. Образцы окрашивали и анализировали согласно описанному ранее в примере 1. Для PAO1 наблюдали сильное окрашивание с помощью Cam-003 через 4 часа после инфицирования, но оно было минимальным для 6206 в этот момент времени (фигура 5D). Однако, как для штамма PAO1, так и для штамма 6206 наблюдали сильное окрашивание с помощью Cam-003 через 24 часа после инфицирования (фигура 5E).

[0295] Связывание антител, специфичных в отношении P. aeruginosa (Cam-003, Cam-004 и Cam-005), с типичными штаммами уникальных серотипов P. aeruginosa (PAO1 (O5) (фигура 5F), 2135 (O1) (фигура 5G), 2531 (O1) (фигура 5H), 2410 (O6) (фигура 5I), 2764 (O11) (фигура 5J), 2757 (O11) (фигура 5K), 33356 (O9) (фигура 5L), 33348 (O1) (фигура 5M), 3039 (NT) (фигура 5N), 3061 (NT) (фигура 5O), 3064 (NT) (фигура 5P), 19660 (NT) (фигура 5Q), 9882-80 (O11) (фигура 5R), 6073 (O11) (фигура 5S), 6077 (O11) (фигура 5T) и 6206 (O11) (фигура 5U)) оценивали с помощью проточной цитометрии, в общих чертах описанной выше.

Пример 6. Уровни выживаемости животных, обработанных моноклональными антителами Cam-003 и WapR-004 к Psl, в модели острой пневмонии, вызываемой P. aeruginosa

[0296] Антитела или PBS вводили за 24 часа до инфицирования в каждой модели. Модели острой пневмонии, вызываемой P. aeruginosa, кератита и термического повреждения функционировали согласно описанному (DiGiandomenico, A., et al., Proc Natl Acad Sci U S A 104, 4624-4629 (2007)) с модификациями. В модели острой пневмонии мышей BALB/c (The Jackson Laboratory) инфицировали штаммами P. aeruginosa, суспендированными в 0,05 мл инокулята. В модели термического повреждения мыши CF-1 (Charles River) получали ожог 10% общей площади поверхности тела с помощью металлического клейма, нагретого до 92°C, в течение 10 секунд. Животных инфицировали подкожно штаммом 6077 P. aeruginosa в указанной дозе. Что касается экспериментов, связанных с нагрузкой органа, у мышей индуцировали острую пневмонию с последующим сбором легких, селезенок и почек через 24 часа после инфицирования для определения CFU.

[0297] В модели острой смертельной пневмонии оценивали моноклональные антитела Cam-003 и WapR-004 к штаммам P. aeruginosa, представляющим наиболее часто встречающиеся серотипы, ассоциированные с заболеванием с клиническими проявлениями. На фигурах 6A и 6C показана значительная зависимая от концентрации выживаемость обработанных с помощью Cam-003 мышей, инфицированных штаммами PAO1 и 6294, по сравнению с представителями контрольной группы. На фигурах 6B и 6D показано, что полную защиту от контрольного заражения 33356 и цитотоксичным штаммом 6077 предоставляло Cam-003 при 45 и 15 мг/кг, тогда как при 5 мг/кг наблюдали 80 и 90% выживаемость в отношении 33356 и 6077, соответственно. На фигурах 6E и 6F показана значительная зависимая от концентрации выживаемость мышей, обработанных с помощью WapR-004, в модели острой пневмонии со штаммом 6077 (O11) (8×105 CFU) (фигура 6E) или 6077 (O11) (6×105 CFU) (фигура 6F). На фигуре 6G показано, что Cam-003 обеспечивало 100% выживаемость через 120 часов после инфицирования штаммом PAO1. Не наблюдали увеличения выживаемости в отношении штамма, мутантного по гену Psl, PAO1ΔpslA, который применяли в качестве отрицательного контроля при изучении острой пневмонии, вызываемой PAO1 (фигура 6G), что подтверждает отсутствие активности Cam-003 против штаммов с дефицитом экспрессии Psl.

[0298] Cam-003 и WapR-004 затем изучали в отношении их способности снижать нагрузку органа, вызываемую P. aeruginosa, в легких и распространение в отдаленные органы, и позже животных обрабатывали с помощью WapR-004, Cam-003 в различных концентрациях или контрольными антителами в нескольких различных концентрациях. Cam-003 было эффективным при снижении нагрузки на легкие, вызываемой P. aeruginosa, в отношении всех четырех тестируемых штаммов. Cam-003 было наиболее эффективным против высокопатогенного цитотоксичного штамма 6077, где низкая доза была такой же эффективной, как и более высокая доза (фигура 7D). Cam-003 также обладало выраженным эффектом в отношении снижения диссеминации в селезенку и почки у мышей, инфицированных PAO1 (фигура 7A), 6294 (фигура 7C) и 6077 (фигура 7D), тогда как у мышей, инфицированных 33356, не наблюдалась диссеминация в эти органы (фигура 7B). На фигурах 7E и 7F показано, что, аналогично, WapR-004 снижало нагрузку органа после индуцирования острой пневмонии с помощью 6294 (O6) и 6206 (O11). В частности, WapR-004 было эффективным при снижении диссеминации P. aeruginosa в селезенку и почки у инфицированных мышей.

Пример 7. Уровни выживаемости животных, обработанных моноклональными антителами Cam-003 и WapR-004 к Psl, в модели инфекции роговицы, вызываемой P. aeruginosa

[0299] Эффективность Cam-003 и WapR-004 затем оценивали в модели инфекции роговицы, вызываемой P. aeruginosa, в которой делается акцент на способность патогенов прикрепляться к поврежденной ткани и колонизировать ее. На фигурах 8 A-D и 8 F-G показано, что у мышей, получавших Cam-003 и WapR-004, была в значительно меньшей степени выражена патология, и они имели уменьшенное количество бактерий в общем гомогенате глаза, чем таковые, наблюдаемые у животных, обработанных отрицательным контролем. На фигуре 8E показано, что Cam-003 было также эффективным при тестировании в модели термического повреждения, обеспечивая значительную защиту при 15 и 5 мг/кг по сравнению с обработкой контрольным антителом.

Пример 8. Антитело Cam-003 с мутацией в Fc, Cam-003-TM, обладает уменьшенными OPK и эффективностью in vivo, но сохраняет активность против прикрепления к клеткам

[0300] С учетом возможного двойного механизма действия было создано Cam-003 с мутацией в Fc, Cam-003-TM, которое имеет мутации в Fc-домене, ослабляющие его взаимодействие с рецепторами Fcγ (Oganesyan, V., et al., Acta Crystallogr D Biol Crystallogr 64, 700-704 (2008)), для идентификации того, коррелирует ли защита в большей степени с активностью против прикрепления к клеткам или с OPK-активностью. Мутантных P. aeruginosa конструировали на основе стратегии замещения аллелей, описанной Schweizer (Schweizer, H.P., Mol Microbiol 6, 1195-1204 (1992); Schweizer, H.D., Biotechniques 15, 831-834 (1993)). Векторы мобилизовали из штамма S17.1 E. coli в штамм PAO1 P. aeruginosa; рекомбинантов выделяли согласно описанному (Hoang, T.T., et al., Gene 212, 77-86 (1998)). Делецию в генах подтверждали с помощью ПЦР. Мутантных P. aeruginosa дополняли конструктами на основе pUCP30T, имеющими гены дикого типа. На фигуре 9A показано, что Cam-003-TM проявляло 4-кратное снижение OPK-активности по сравнению с Cam-003 (значение EC50 составляло 0,24 и 0,06, соответственно), но было таким же эффективным в анализе прикрепления к клеткам (фигура 9B). На фигуре 9C показано, что Cam-003-TM также было менее эффективным против пневмонии, что позволяет предположить, что для оптимальной защиты необходима оптимальная OPK-активность. Анализы OPK и прикрепления к клеткам выполняли согласно описанному ранее в примерах 2 и 4, соответственно. При тестировании в модели острой пневмонии на мышах Cam-003-TM по действенности было сходным с Cam-003 в случае инокулята 6077 низкой инфекционности (2,4×105 CFU) (фигура 9D). Однако, дополнительное титрование дозы антитела с последующим контрольным заражением инокулятом более высокой инфекционности (1,07×106) выявило, что активность Cam-003 превосходила таковую Cam-003-TM, что позволяет предположить, что OPK-активность в значительной мере содействует оптимальной защите in vivo (фигура 9E).

Пример 9. Картирование эпитопов и сравнительная аффинность антител к Psl

[0301] Картирование эпитопов выполняли с помощью конкурентного ELISA и подтверждали при помощи проточной системы OCTET® с Psl, полученным из надосадочной жидкости суточной культуры штамма PAO1 P. aeruginosa. Для конкурентного ELISA антитела биотинилировали при помощи сульфо-NHS-биотина EZ-Link и набора для биотинилирования (Thermo Scientific). Планшеты, покрытые антигеном, обрабатывали биотинилированными антителами при EC50, совместно инкубированными с немечеными антителами. После инкубирования со стрептавидином, конъюгированным с HRP (Thermo Scientific), в планшетах производили проявление согласно описанному выше. В конкурентных экспериментах с mAb к Psl определили, что антитела нацеливаются по меньшей мере на три уникальных эпитопа, и их назвали антителами к эпитопам класса 1, 2 и 3 (фигура 10A). Антитела к эпитопам класса 1 и 2 не конкурируют за связывание, однако антитело к эпитопу класса 3, WapR-016, частично ингибирует связывание антител к эпитопам классов 1 и 2.

[0302] Аффинность антител определяли в анализах связывания при помощи OCTET®, применяя Psl, полученный из надосадочной жидкости суточных культур PAO1. KD антител определяли путем усреднения данных о кинетике связывания каждого антитела в семи концентрациях. Измерения аффинности производили при помощи прибора FORTEBIO® OCTET® 384, применяя планшеты на 384 лунки со скошенным дном. Надосадочную жидкость суточных культур PAOl ± ген pslA применяли в качестве источника Psl. Образцы загружали на сенсоры на основе аминопропилсилана OCTET® (гидратированного в PBS) и блокировали с последующими измерением связывания mAb к Psl при нескольких концентрациях и диссоциацией в PBS + 1% BSA. Все методы выполняли согласно описанному (Wang, X., et al., J Immunol Methods 362, 151-160). На основании необработанных данных об ассоциации и диссоциации в виде ΔнΜ построили кривую с помощью GraphPad Prism. На фигуре 10A показаны значения относительной аффинности связывания антител к Psl, охарактеризованных выше. Антитела к эпитопам класса 2 обладали наиболее высокой аффинностью среди всех антител к Psl. На фигуре 10A также показан перечень данных из экспериментов в отношении прикрепления к клеткам и OPK. На фигуре 10B показаны значения относительной аффинности связывания и значения EC50 OPK мутантного Wap-004RAD (W4RAD), а также других мутантных W4, полученных согласно описанному в примере 1.

Пример 10. Связывание конъюгатов полимиксин B (PMB)-mAb с клетками PAO1 P. aeruginosa оценивали с помощью FACS

[0303] В этом примере оценивали PMB, конъюгированный с опсонизирующим моноклональным антителом (mAb), способным опосредовать устранение бактерий, для определения, будет ли конъюгат улучшать и/или расширять функциональные характеристики mAb, в то же время уменьшая токсичность PMB. Для оценивания конъюгата выбрали Cam-003, mAb, нацеливающееся на поверхностный экзополисахарид Psl P. aeruginosa, которое опосредует действенную активность, направленную на опсонофагоцитарное уничтожение (OPK), и защиту in vivo.

[0304] В этом примере оценивается связывание различных конъюгатов полимиксин B (PMB)-mAb с клетками PAO1 P. aeruginosa. Применяя двухэтапный способ сайт-направленной коньюгации (фигура 12), полимиксин B (PMB) конъюгировали с вариантами mAb Cam-003 и A7 (контрольный hIgG1 человека) с одним или двумя цистеиновыми остатками, внедренными в Fc-область с помощью методов генной инженерии. Варианты Cam-003 и A7 mAb с мутацией в Fc получали при помощи стандартных протоколов согласно описанному в (Dimasi, N. et al., J Mol Biol. 393(3):672-92 (2009)). Гетеробифункциональный линкер SM(PEG)12 (Pierce) первоначально конъюгировали с одной из групп первичного амина PMB посредством NHS-группы линкера в условиях, определенных как благоприятные для коньюгации одинарного линкера. Сульфат полимиксина B (Sigma) растворяли в PBS при pH 7,2 при 2 мг/мл и вводили в реакцию с линкером SM(PEG)12 в соотношении PMB:линкер, составляющем 4:1. Реакцию проводили при комнатной температуре в течение 30 минут и останавливали с помощью 50 мM глицина. Эффективность коньюгации линкера SM(PEG)12 с PMB составляла приблизительно 25%. Неочищенные препараты PMB-PEG12 затем вводили в реакцию с вариантами mAb, имеющими в Fc цистеин без защитных групп, и конъюгировали посредством малеимидной группы PEG12-линкера (см., например, WO 2011/005481 и WO 2009/092011). Конъюгаты PMB-mAb очищали путем обширного диализа. Конъюгаты первоначально подвергали диализу в 3,3X PBS при pH 7,2 с 0,7% CHAPS с четырьмя заменами буфера с последующим диализом в 1X PBS при pH 7,2 c дополнительными четырьмя заменами буфера. Эффективность коньюгации и уровни свободной формы PMB-линкер в образцах определяли с помощью UPLC и масс-спектрометрии.

[0305] Cam-003 является специфичным в отношении поверхностного экзополисахарида Psl P. aeruginosa и опосредует действенную OPK-активность и защиту в нескольких моделях in vivo. На фигуре 13A показаны остатки Cam-003 и A7 с мутацией в Fc-области. SM (A339C), DM1 (T289C/A339C), DM2 (A339C/S442C). Эффективность коньюгации PMB с вариантами mAb определяли с помощью анализа тяжелых цепей очищенных конъюгатов по методу масс-спектрометрии (см., например, WO 2011/005481 и WO 2009/092011). Общая эффективность коньюгации составляла 75-85%. В отношении сравнения конъюгированной и свободной формы PMB-линкер чистота конструктов составляла >95%. На фигуре 13B показано среднее число PMB в конъюгатах PMB-Cam-003 и PMB-A7 (двойной мутант 2 (DM2) > двойной мутант 1 (DM1) > одинарный мутант (SM)). Конъюгаты A7 проявляли более высокую эффективность коньюгации по сравнению с конъюгатами Cam-003. Определили, что загрязнение очищенных препаратов свободными PMB было пренебережимо малым. Связывание конъюгатов PMB-Cam-003 и PMB-A7 с клетками PAO1 P. aeruginosa оценивали с помощью FACS. R347 применяли в качестве отрицательного контроля во всех экспериментах. Образцы окрашивали и анализировали согласно описанному ранее в примере 1. Не наблюдали значительного различия в связывании конъюгатов Cam-003 по сравнению с неконъюгированными или псевдоконъюгированными Cam-003 (фигура 14A). Связывание контрольных конъюгатов A7 было пропорциональным числу молекул PMB на конъюгат (фигура 14B). Этот анализ указывает на то, что коньюгация PMB с Cam-003 не оказывает значительного влияния на связывание с целыми клетками, и что конъюгированный PMB может опосредовать прямое связывание с клетками, предположительно путем связывания LPS.

Пример 11. Оценивание конъюгатов PMB-mAb, способствующих OPK P. aeruginosa

[0306] В этом примере описываются две серии экспериментов, в которых оценивается способность конъюгатов PMB-mAb способствовать OPK P. aeruginosa. В первой серии экспериментов (фигуры 15A-B) оценивали OPK-активность клеток-нейтрофилов человека линии HL-60, опосредуемую конъюгатами, в присутствии системы комплемента кролика при помощи штаммов P. aeruginosa, экспрессирующих бактериальную люциферазу, согласно описанному в примере 2. В этих экспериментах в качестве отрицательного контроля применяли R347. Конъюгаты Cam-003 сохраняли действенную OPK-активность, хотя она уменьшалась с повышением числа PMB на конъюгат (SM>DM1>DM2) (фигура 15A). Конъюгаты Cam-003 не проявляли OPK-активность против штамма ΔpslA P. aeruginosa, который не экспрессирует Psl-мишень, что указывает на то, что для уничтожения требовалось mAb-опосредованное связывание (фигура 15B). Во второй серии экспериментов для определения % уничтожения применяли уменьшение люминесценции после 2-часового инкубирования по сравнению с контрольным образцом без mAb. На фигуре 18A показано, что конъюгаты Cam-003 сохраняли OPK-активность, хотя она уменьшалась с повышением числа PMB на конъюгат, в особенности в DM- и TM-конструктах (WT>SM>DM>TM). Конъюгаты Cam-003 не проявляли OPK-активность против штамма PAO1ΔpslA, который не экспрессирует Psl-мишень (не показано). На фигуре 18B показано, что конъюгаты A7-PMB не опосредуют OPK, что указывает на то, что для уничтожения требовалось mAb-опосредованное связывание.

Пример 12. Нейтрализация LPS P. aeruginosa конъюгатами PMB-mAb

[0307] Активность, направленную на нейтрализацию LPS O10 P. aeruginosa, оценивали с помощью предварительного инкубирования конъюгатов PMB-mAb или PMB в отдельности с LPS в течение 1 часа с последующей стимуляцией макрофагов RAW 264.7 мышей и количественной оценкой секреции TNF. Конечная концентрация LPS составляла 2 нг/мл. TNF оценивали количественно с помощью способа цитометрии с использованием иммобилизованных на гранулах антител BD™ (CBA) на основе FACS (BD Biosciences) после 6-часовой стимуляции. Нейтрализацию LPS измеряли по уменьшению выработки TNF по сравнению с максимальным ответом на LPS. Конъюгаты PMB-Cam-003, но не псевдоконъюгированное Cam-003 дикого типа, проявляли нейтрализацию LPS. Эффективность нейтрализации была прямо пропорциональной среднему числу PMB в конъюгате (DM2>DM1>SM) (фигура 16A). Конъюгаты PMB-A7, но не псевдоконъюгированное A7 дикого типа, проявляли нейтрализацию LPS (фигура 16B). Конъюгаты A7 проявляли лучшую нейтрализацию, чем конъюгаты Cam-003. Конъюгаты A7 проявляли лучшую нейтрализацию, чем конъюгаты Cam-003, вероятно, в связи с большей эффективностью коньюгации, достигаемой при применении этих молекул. Для нейтрализации количества LPS, нейтрализуемого свободной молекулой PMB, требуются приблизительно 2 конъюгированные молекулы PMB/mAb.

Пример 13. Оценивание Cam-003-PMB, полученных в результате сайт-направленной конъюгации, в моделях на мышах

[0308] Эффективность конъюгатов Cam-003-PMB оценивали в моделях на мышах двух типов: 1) в модели эндотоксемии с контрольным заражением (LPS) для определения способности конъюгатов нейтрализовать и/или детоксифицировать LPS in vivo и 2) в модели сепсиса, вызываемого P. aeruginosa, для оценивания того, осуществляют ли конъюгаты Cam-003-PMB улучшенную защиту от контрольного заражения бактериями по сравнению с антителом в отдельности посредством PMB-опосредованной нейтрализации и/или устранения LPS в дополнение к антитело-опосредованному устранению бактерий. Другие модели с контрольным заражением P. aeruginosa также можно применять для тестирования эффективности конъюгатов Cam-003-PMB (см. ниже).

A. Модель эндотоксемии

[0309] Хорошо известно, что PMB может связываться и нейтрализовать LPS in vivo и опосредовать защиту от контрольного заражения с участием LPS (Morrison, DC. et al. J. Immunochemistry 13(10):813-818 (1976), Drabick, JJ. et al., Antimicrob Agents Chemother. 42(3):583-588 (1998)). В модели эндотоксемии конъюгаты Cam-003-PMB будут оцениваться в отношении их способности защищать животных при контрольном заражении с участием LPS. Очищенный LPS из грамотрицательных бактерий, включая P. aeruginosa и E. coli, будут применять для контрольного заражения мышей в установленных минимальных смертельных дозах (LD100). Поскольку мыши относительно устойчивы к LPS, можно также совместно вводить D-галактозамин, поскольку он значительно повышает чувствительность мышей к LPS примерно до такой же степени, как у людей (Galanos, C. et al., Proc Natl Acad Sci U S A. 76(11):5939-5943 (1979)). Такие модели широко применялись в доклиническом оценивании эффективности молекул, нейтрализующих LPS, включая антитела и конъюгаты полимиксин-белок (Bailat, S. et al., Infect Immun. 65(2):811-814 (1997), Birkenmeier, G. et al., J Pharmacol Exp Ther. 318(2):762-771 (2006), Drabick, JJ. et al., Antimicrob Agents Chemother. 42(3):583-588 (1998)). Конъюгаты Cam-003-PMB, контрольные конъюгаты и неконъюгированные Cam-003 можно вводить либо с целью терапии, либо с целью профилактики и можно оценить их способность защищать животных при контрольном заражении с участием LPS. Степень защиты, опосредуемой конъюгатами PMB, может коррелировать с уровнями провоспалительных цитокинов и хемокинов, измеренными в сыворотке или плазме, включая TNF, KC и IL-6.

B. Модели контрольного заражения P. aeruginosa

[0310] Несколько моделей инфекции P. aeruginosa на мышах можно применять для оценивания способности конъюгатов Cam-003-PMB опосредовать защиту. P. aeruginosa можно вводить мышам интраперитонеально (модель сепсиса), внутривенно (модель бактериемии) или интраназально (модель пневмонии) в определенных дозах LD100. Эти модели ранее применяли в доклинических исследованиях эффективности вакцин для пассивной или активной иммунизации (Frank, DW. et al., J Infect Dis. 186(1):64-73 (2002), Secher, T. et al., J Antimicrob Chemother. 66(5): 1100-1109 (2011), Miyazaki, S. et al., J Med Microbiol. 43(3):169-175 (1995), Dunn, DL. et al., Surgery 96(2):440-446 (1984)).

[0311] Как и в модели эндотоксемии, также может быть необходимым повышение чувствительности мышей с помощью D-галактозамина перед контрольным заражением бактериями, чтобы преодолеть их врожденную устойчивость к токсическому действию LPS и чтобы иметь возможность оценить вклад нейтрализации и/или устранения LPS в эффективность конъюгатов PMB in vivo. Было продемонстрировано, что D-галактозамин снижает LD100 грамотрицательных бактерий, вероятно, путем повышения чувствительности к LPS, выделяемому во время инфицирования (Bucklin, SE. et al., J Infect Dis. 172(6): 1519-27 (1995)).

[0312] Конъюгаты Cam-003-PMB, контрольные конъюгаты и неконъюгированные Cam-003 можно вводить либо с целью терапии, либо с целью профилактики. Способность конъюгатов Cam-003 осуществлять усиленную защиту по сравнению с Cam-003 в отдельности путем нейтрализации и/или устранения бактериального LPS посредством конъюгированного фрагмента PMB можно определить в исследованиях выживаемости. Эффективность конъюгатов Cam-003-PMB при опосредованном устранении бактерий также можно оценить путем проведения количественной оценки бактерий P. aeruginosa в сыворотке и органах, включая селезенку, почки и легкие, после инфицирования. Уровни LPS в сыворотке или плазме можно также оценить количественно для оценивания степени устранения бактерий и устранения и/или нейтрализации LPS конъюгатами Cam-003-PMB и сравнения ее с таковой для неконъюгированных Cam-003 и контрольных конъюгатов антитело-PMB.

C. Данные из модели эндотоксемии

[0313] Конкретно, мышам C57B1/6 (10 на группу) дозировали i.p. mAb или конъюгат PMB-mAb за 6 часов до контрольного заражения с участием LPS PAO10 P. aeruginosa (Sigma) и D-галактозамина. Контрольный PMB дозировали i.p. за 2 часа до контрольного заражения при 0,2 мг/кг, и это, как правило, обеспечивает 80-100% защиту. Все мыши из контрольной группы, которым дозировали неконъюгированные Cam-003, умерли не позднее чем через 18 часов. На фигурах 19A и B показано, что при 45 мг/кг DM- и TM-конъюгаты Cam-003 и A7 обеспечивали 90-100% защиту, тогда как SM-конъюгаты не осуществляли защиту.

[0314] TM-конъюгаты дозировали при 45, 15 и 5 мг/кг. Как показано на фигурах 20A и B, потеря защитной активности была более быстрой у Cam-003-TM-PMB, чем у A7-TM-PMB, который сохранял 80% защиту при 5 мг/кг. Эти различия позволяют предположить, что уникальные структурные признаки mAb могут влиять на активность конъюгированных PMB, направленную на нейтрализацию LPS, как видели ранее in vitro.

D. Данные из модели сепсиса

[0315] Мышам C57B1/6 (10 на группу) дозировали i.p. mAb или конъюгаты PMB-mAb (10, 1 и 0,1 мг/кг) за 6 часов до i.p. контрольного заражения штаммом 6294 P. aeruginosa в дозе LD80-100 (CFU 4E7). В этом анализе объединяли данные двух исследований. Выживаемость отслеживали в течение 72 часов. Объединенные результаты двух исследований показаны на фигурах 21A-C. Большинство мышей из контрольной группы, которым дозировали A7 или буфер, умерли через 24 часа. Неконъюгированные Cam-003 показали 50-90% защиту. Защитная активность, по-видимому, обратно коррелирует с дозой. Конъюгаты Cam-003-PMB придавали лучшую защиту, чем неконъюгированные mAb, при высокой дозе 10 мг/кг, что позволяет предположить, что нейтрализация LPS, выделяемого во время инфицирования, способствовала выживаемости. Контрольный конъюгат A7-DM-PMB проявлял 50% защитную активность при 10 мг/кг, что позволяет предположить, что нейтрализация LPS может обеспечивать преимущество выживаемости. Наоборот, конъюгаты играли меньшую защитную роль, чем Cam-003 при низкой дозе 0,1 мг/кг, и защитная активность коррелировала с OPK-активностью конъюгатов in vitro (WT>SM>DM>TM). Взятые вместе, результаты указывают на то, что конъюгированные PMB могут придавать дополнительную защитную активность опсонизирующему антителу, опосредуя нейтрализацию LPS и дополняя его функцию устранения бактерий.

[0316] Высокой эффективности коньюгации PMB с цистеиновыми остатками, внедренными в Fc с помощью методов генной инженерии, достигали при помощи гетеробифункционального линкера SM-PEG12. Ряд молекул, полученных в результате сайт-направленной конъюгации PMB с Cam-003, действенных опсонизирующих и защитных mAb, нацеливающихся на экзополисахарид Psl P. aeruginosa, оценивали in vitro и in vivo. Конъюгаты Cam-003-PMB сохраняли OPK-активность in vitro. Однако повышение среднего числа PMB на mAb влияло на OPK-активность. DM- и TM-конъюгаты PMB-mAb придавали защиту в модели эндотоксемии, вызываемой P. aeruginosa, на мышах, что демонстрирует, что функция PMB, заключающаяся в нейтрализации LPS, была придана mAb. Конъюгаты Cam-003-PMB показывали большую защитную активность, чем неконъюгированные mAb Cam-003, в модели сепсиса, вызываемого P. aeruginosa, при высоких дозах (10 мг/кг), и пониженную активность при низкой дозе (0,1 мг/кг). Эти данные позволяют предположить, что конъюгированный PMB могут дополнять устранение бактерий, опосредуемое опсонизирующим mAb Cam-003, и улучшать защиту путем нейтрализации LPS. Улучшение защитной активности конъюгатами Cam-003-PMB в модели сепсиса утрачивается при более низких дозах, когда уровни конъюгированного PMB являются слишком низкими для нейтрализации LPS, и основным способом защиты, вероятно, является mAb-опосредованное устранение бактерий. Потеря защитной активности конъюгатов Cam-003-PMB при более низких дозах согласуется с понижением OPK-активности in vitro в результате коньюгации с PMB. В этих исследованиях показано, что PMB, конъюгированный с опсонизирующим mAb, может придавать активность, направленную на нейтрализацию LPS, и давать в результате повышенную защитную активность в модели системной инфекции, вызываемой P. aeruginosa. Оптимизация сайтов коньюгации с уменьшением отрицательного влияния на OPK-активность может дополнительно улучшать защитную активность конъюгатов PMB по сравнению с неконъюгированным опсонизирующим mAb.

[0317] Настоящее раскрытие не подлежит ограничению по объему конкретными описанными вариантами осуществления, которые, как предполагается, являются единичными иллюстрациями отдельных аспектов настоящего раскрытия, и любые композиции или способы, являющиеся функционально эквивалентными, находятся в пределах объема настоящего раскрытия. В действительности, различные модификации настоящего раскрытия, в дополнение к показанным и описанным в данном документе, станут очевидными специалистам в данной области техники из предшествующего описания и сопроводительных графических материалов. Предполагается, что такие модификации находятся в пределах объема прилагаемой формулы изобретения.

[0318] Все публикации и заявки на патенты, упоминаемые в настоящем описании, включены в данный документ посредством ссылки в такой же степени, как если бы каждая отдельная публикация или заявка на патент была конкретно и отдельно указана как включенная посредством ссылки.

1. Выделенное антитело или его антигенсвязывающий фрагмент, который специфически связывается с Psl Pseudomonas, где антитело или его антигенсвязывающий фрагмент способствует опсонофагоцитарному уничтожению (OPK) P. aeruginosa и, необязательно, может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам, содержащий вариабельную область тяжелой цепи (VH) и вариабельную область легкой цепи (VL), которые содержат аминокислотные последовательности VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2 и VLCDR3, выбранные из группы, состоящей из:

SEQ ID NO: 17, 18, 19, 20, 21 и 22 (Cam-003),

SEQ ID NO: 23, 24, 25, 20, 21 и 22 (Cam-004),

SEQ ID NO: 26, 27, 28, 20, 21 и 22 (Cam-005),

SEQ ID NO: 29, 30, 31, 32, 33 и 34 (WapR-001),

SEQ ID NO: 35, 36, 37, 38, 39 и 40 (WapR-002),

SEQ ID NO: 41, 42, 43, 44, 45 и 46 (WapR-003),

SEQ ID NO: 47, 48, 49, 50, 51 и 52 (WapR-004),

SEQ ID NO: 47, 48, 75, 50, 51 и 52 (WapR-004RAD) и

SEQ ID NO: 59, 60, 61, 62, 63 и 64 (WapR-016).

2. Антитело или его фрагмент по п. 1, который является гуманизированным.

3. Антитело или его фрагмент по п. 1, который является химерным.

4. Антитело или его фрагмент по п. 1, который является полностью человеческим.

5. Антитело или его фрагмент по п. 1, который представляет собой Fab-фрагмент.

6. Антитело или его фрагмент по п. 1, который представляет собой Fab'-фрагмент.

7. Антитело или его фрагмент по п. 1, который представляет собой F(ab)2-фрагмент.

8. Антитело или его фрагмент по п. 1, который представляет собой одноцепочечный Fv- (scFv-) фрагмент.

9. Антитело или его фрагмент по п. 1, который является моноклональным.

10. Антитело или его антигенсвязывающий фрагмент по любому из предшествующих пунктов, где аминокислотные последовательности вариабельной области тяжелой цепи (VH) и вариабельной области легкой цепи (VL) изложены в:

(a) SEQ ID NO: 1 и SEQ ID NO: 2 (Cam-003);

(b) SEQ ID NO: 3 и SEQ ID NO: 2 (Cam-004);

(c) SEQ ID NO: 4 и SEQ ID NO: 2 (Cam-005);

(d) SEQ ID NO: 5 и SEQ ID NO: 6 (WapR-001);

(e) SEQ ID NO: 7 и SEQ ID NO: 8 (WapR-002);

(f) SEQ ID NO: 9 и SEQ ID NO: 10 (WapR-003);

(g) SEQ ID NO: 11 и SEQ ID NO: 12 (WapR-004);

(h) SEQ ID NO: 15 и SEQ ID NO: 16 (WapR-016) или

(i) SEQ ID NO: 74 и SEQ ID NO: 12 (WapR-004RAD).

11. Фармацевтическая композиция, содержащая эффективное количество антитела или его фрагмента по п. 1 или 10 и носитель для профилактики или лечения инфекции Pseudomonas.

12. Композиция по п. 11, где инфекция Pseudomonas представляет собой инфекцию P. Aeruginosa.



 

Похожие патенты:

Группа изобретений относится к способу получения раствора иммуноглобулинов. Способ получения раствора иммуноглобулинов из исходного раствора иммуноглобулинов со степенью чистоты не менее 96%, концентрацией от 1 до 10 мг/мл, содержащего от 2 до 6% (мас./об.) полиэтиленгликоля (PEG) или полипропиленгликоля (PPG), включает стадии а) добавления каприловой кислоты или ее солей к исходному раствору до достижения концентрации от 9 до 15 мМ; б) подведения pH раствора, полученного на стадии а), до рН 5,0-5,2; в) инкубирования раствора, полученного на стадии б), в течение периода времени и при температуре, необходимых для инактивации оболочечных вирусов; и г) выполнения стадии ультрафильтрации/диафильтрации раствора, полученного на стадии в).

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая антитело или антигенсвязывающий фрагмент, специфически связывающееся с ИЛ-21, конъюгат для ингибирования функциональной активности ИЛ-21, содержащий вышеуказанное антитело, фармацевтическую композицию для лечения или профилактики аутоиммунного заболевания или расстройства или реакции «трансплантат против хозяина» (GVHD), ассоциированной с ИЛ-21, способ лечения или профилактики аутоиммунного заболевания или расстройства у субъекта, способ определения уровней экспрессии ИЛ-21 и способ лечения или профилактики реакции «трансплантат против хозяина», ассоциированной с ИЛ-21.

Настоящее изобретение относится к иммунологии. Предложен связывающий домен против EGFRvIII, содержащий его химерный антигенный рецептор, кодирующие нуклеиновые кислоты, вектор, клетка, а также применения указанных изобретений в производстве лекарственного средства, способы создания клетки и получения популяции клеток, способ обеспечения иммунитета, способ лечения.

Изобретение относится к медицине и касается инактивации вируса в потоке исходных материалов продукта в процессе производства терапевтического полипептида. Способ включает этап обработки потока исходных материалов детергентом, при этом детергент является экологически безопасным.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению в клетках Escherichia coli гибридного белка, и может быть использовано для очистки биотехнологических субстанций от бактериальных липополисахаридов.

Изобретение относится к области биотехнологии, конкретно к способу получения препаратов рекомбинантной нуклеазы семейства Cas системы CRISPR/Cas в клетках штамма Escherichia coli Rosetta-gami B (DE3) и их дальнейшей очистке.

Изобретение относится к области биотехнологии, конкретно к получению лентивирусного вектора для экспрессии химерного антигенного рецептора (CAR) на основе VHH-антитела к CD47 в Т-клетках человека, и может быть использовано в медицине.

Изобретение относится к биотехнологии. Способ получения ботулотоксина, включает: (а) обработку культуры продуцирующего ботулотоксин штамма кислотой с образованием осадка, содержащего ботулотоксин с последующей нейтрализацией рН осадка, (b) получение раствора для анионообменной хроматографии, содержащего буфер с использованием методов мембранной фильтрации и мембранной хроматографии и (c) очистку ботулотоксина с помощью анионообменной хроматографии, при этом ДНКазу и РНКазу не используют в указанном способе.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению мутантных белков человека, и может быть использовано для получения мутеинов липокалина 2 человека (hLcn2, hNGAL) по положению 100 аминокислотной последовательности hLcn2, связывающихся с определенными мишенями.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, которое специфически связывается с ErbB3, а также фармацевтическая композиция для профилактики или лечения заболевания, связанного с активацией или сверхэкспрессией белка ErbB3.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая антитело или антигенсвязывающий фрагмент, специфически связывающееся с ИЛ-21, конъюгат для ингибирования функциональной активности ИЛ-21, содержащий вышеуказанное антитело, фармацевтическую композицию для лечения или профилактики аутоиммунного заболевания или расстройства или реакции «трансплантат против хозяина» (GVHD), ассоциированной с ИЛ-21, способ лечения или профилактики аутоиммунного заболевания или расстройства у субъекта, способ определения уровней экспрессии ИЛ-21 и способ лечения или профилактики реакции «трансплантат против хозяина», ассоциированной с ИЛ-21.

Изобретение относится к биохимии. Описано выделенное антитело или его антигенсвязывающий фрагмент для доставки цитотоксина, содержащие домен CH1 IgG, где домен CH1 IgG содержит остаток аспарагина в положении аминокислоты 114 в соответствии с нумерацией Kabat, где боковая цепь указанного остатка аспарагина связана с гликаном.

Настоящее изобретение относится к иммунологии. Предложен связывающий домен против EGFRvIII, содержащий его химерный антигенный рецептор, кодирующие нуклеиновые кислоты, вектор, клетка, а также применения указанных изобретений в производстве лекарственного средства, способы создания клетки и получения популяции клеток, способ обеспечения иммунитета, способ лечения.

Настоящее изобретение относится к области иммунологии. Предложены антитело и его антигенсвязывающий фрагмент, которое специфически связывается с ErbB3, а также фармацевтическая композиция для профилактики или лечения заболевания, связанного с активацией или сверхэкспрессией белка ErbB3.

Настоящее изобретение относится к области иммунологии. Предложены антитела к рецептору инсулиноподобного фактора роста 1 (IGF-1R) и их антигенсвязывающие фрагменты.

Изобретение относится к области иммунологии. Предложены антитела к рецептору инсулиноподобного фактора роста 1 (IGF-1R) и их антигенсвязывающие фрагменты.

Настоящее изобретение относится к области иммунологии. Предложены химерные антигенные рецепторы (CAR), которые специфически связываются с ВСМА (антигеном созревания В-клеток).

Изобретение относится к биотехнологии. Описан связывающий элемент, обладающий специфичностью связывания к ФНО-альфа, включающий:(i) вариабельные последовательности CDR-H1, CDR-H2 и CDR-H3 тяжелой цепи, представленные в SEQ ID No: 6, 7 и 8; и (ii) вариабельные последовательности CDR-L1, CDR-L2 и CDR-L3 легкой цепи, представленные в SEQ ID No: 3, 4 и 5.

Изобретение относится к области иммунологии. Предложены варианты применения выделенного антитела или его антигенсвязывающего участка, специфичного к B7-H1, в лечении рака.

Изобретение относится к биотехнологии. Описан полипептид для нацеливания на выделяющийся фосфатидилсерин (PtdS) клеточной мембраны, который включает: (а) домен гамма-карбоксиглутаминовой кислоты белка S, представленный в SEQ ID NO: 1, или последовательности, по меньшей мере на 95% гомологичной ей, который не содержит домен протеазы или гормон-связывающий домен; и (б) белок S EGF домена.

Изобретение относится к области биотехнологии. Предложен штамм гибридных культивируемых клеток H.sapiens/Mus musculus 8D4E9-Ba-LF, продуцирующий человеческие моноклональные антитела против летального фактора возбудителя сибирской язвы.

Изобретение относится к выделенному антителу или его антигенсвязывающему фрагменту, которое специфически связывается с Psl Pseudomonas, и фармацевтической композиции, содержащей указанное антитело. Антитело содержит вариабельную область тяжелой цепи и вариабельную область легкой цепи, которые содержат аминокислотные последовательности VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2 и VLCDR3, выбранные из группы, состоящей из: SEQ ID NO: 17, 18, 19, 20, 21 и 22, SEQ ID NO: 23, 24, 25, 20, 21 и 22, SEQ ID NO: 26, 27, 28, 20, 21 и 22, SEQ ID NO: 29, 30, 31, 32, 33 и 34, SEQ ID NO: 35, 36, 37, 38, 39 и 40, SEQ ID NO: 41, 42, 43, 44, 45 и 46, SEQ ID NO: 47, 48, 49, 50, 51 и 52, SEQ ID NO: 47, 48 75, 50, 51 и 52 и SEQ ID NO: 59, 60, 61, 62, 63 и 64. При этом антитело способствует опсонофагоцитарному уничтожению P. aeruginosa и, необязательно, может ингибировать прикрепление P. aeruginosa к эпителиальным клеткам. Фармацевтическая композиция, предназначенная для профилактики или лечения инфекции Pseudomonas, содержит эффективное количество указанного антитела или его фрагмента и носитель. Изобретения могут быть использованы для эффективного предупреждения или лечения инфекции Pseudomonas. 2 н. и 10 з.п. ф-лы, 21 ил., 4 табл., 13 пр.

Наверх