Набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации рнк возбудителей сапа burkholderia mallei и мелиоидоза burkholderia pseudomallei на основе транскрипционной амплификации (nasba) в режиме "реального времени"

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei на основе транскрипционной амплификации NASBA в режиме реального времени. Изобретение может быть использовано для выявления РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei в пробах чистых культур, биологическом материале и объектах окружающей среды для нужд здравоохранения, службы Роспотребнадзора и в научных исследованиях. 1 ил., 1 табл., 3 пр.

 

Изобретение относится к области биотехнологии, молекулярной биологии и может быть использовано для выявления РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei в пробах чистых культур, биологическом материале и объектах окружающей среды специалистами учреждений как практического здравоохранения, службы Роспотребнадзора, так и в научных исследованиях.

В связи с развитием транспортного сообщения между странами, расширением туристических направлений, а также значительными миграционными потоками населения возникает настороженность в отношении завоза на территорию РФ новых или «забытых» для страны патогенов, к числу которых относятся возбудители сапа и мелиоидоза. Рост числа подтвержденных случаев заболевания мелиоидозом отмечается не только в эндемичных по данной инфекции регионах Юго-Восточной Азии и Северной Австралии, но и в ряде стран Европы, Северной и Латинской Америки. Заболеваемость людей сапом отмечается редко, в основном носит профессиональный характер, но в ряде стран, в том числе сопредельных с РФ (Монголия, Турция, Иран и др.) продолжают регистрировать вспышки заболевания у животных. Не исключена возможность использования данных возбудителей, которые относятся к микроорганизмам I-II групп патогенности, в качестве потенциальных агентов биотерроризма. Многообразие клинических проявлений сапа и мелиоидоза существенно затрудняют диагностику и своевременное назначение этиотропной терапии этих опасных заболеваний. Совокупность данных факторов определяет необходимость исследований, направленных на совершенствование лабораторных методов выявления патогенных буркхольдерий.

В настоящее время среди молекулярно-генетических способов диагностики различных инфекций все более широкое применение находят методы изотермической амплификации нуклеиновых кислот, что обусловлено их способностью выявлять генетический материал микроорганизма в концентрации меньшей нижнего предела детекции полимеразной цепной реакции (ПЦР). К числу таких методов относится основанная на транскрипции амплификация нуклеиновых кислот NASBA (Nucleic Acid Sequence-Based Amplification). Высокая чувствительность метода достигается использованием в качестве целевой мишени молекул матричной РНК (мРНК) или рибосомальной РНК (рРНК) микроорганизмов, количество которых может достигать нескольких десятков тысяч на одну бактериальную клетку. В ПЦР используемые в качестве мишени даже многокопийные участки ДНК не превышают двух десятков на бактериальную клетку. Поэтому, с помощью метода NASBA можно детектировать возбудителей и в тех случаях, когда их количество очень мало и недостаточно для выявления методом ПЦР. Это особенно актуально при латентном течении инфекции, на фоне отсутствия клинических признаков заболевания. Другим важным свойством РНК в качестве мишени амплификации является ее меньшая стабильность по сравнению с молекулой ДНК, что определяет возможность использования метода NASBA для контроля эффективности проведенной терапии.

В основе метода транскрипционной амплификации NASBA лежит обнаружение фрагмента РНК в изотермических условиях (при температуре 41°С) с помощью двух специфических праймеров и совместной ферментативной активности трех ферментов: обратной транскриптазы вируса миелобластоза птиц {avian myeloblastosis virus reverse transcriptase - AMV RT), РНКазы H Escherichia coli и РНК-полимеразы фага T7. При этом происходит экспоненциальное накопление одноцепочечной РНК, которая является удобной мишенью для гибридизационных методов детекции. Использование флуоресцентно-меченых зондов позволяет регистрировать специфический продукт амплификации непосредственно в процессе реакции в режиме «реального времени», что существенно сокращает время анализа, снижает риск контаминации и увеличивает специфичность метода.

Технология транскрипционной амплификации NASBA в режиме «реального времени» была применена для выявления возбудителей особо опасных инфекций, таких как Vibrio cholerae [Fykse Е.М., Skogan G., Davies W., et al. (2007) Detection of Vibrio cholerae by real-time nucleic acid sequence-based amplification. Appl. Environ. Microbiol. 73(5), 1457-1466] и ряда РНК-содержащих вирусов - высоковирулентного штамма вируса гриппа AH5N1, вируса иммунодефицита человека (ВИЧ-1), коронавируса SARS, вируса энцефалита Сент-Луис, вируса гепатита С, вируса бешенства, а также вирусов лихорадок Денге, Западного Нила и Чикунгунья [Sidoti F., Bergallo М., Costa С, Cavallo R. (2013) Alternative molecular tests for virological diagnosis. Mol. Biotechnol. 53(3), 352-362]. Однако диагностические реагенты на основе реакции транскрипционной амплификации NASBA для выявления В. mallei и В. pseudomallei не разработаны.

Наиболее близким аналогом являются панбактериальные праймеры и зонд, сконструированные на основе нуклеотидной последовательности гена 23 S рибосомальной РНК и предназначенные для выявления целевого фрагмента нуклеиновой кислоты бактерий методом NASBA в режиме «реального времени» с целью мониторинга микробиологического качества рециркулируемой воды на борту международной космической станции [Bechy-Loizeau A.L., Flandrois J.P., Abaibou Н. (2015) Assessment of polycarbonate filter in a molecular analytical system for the microbiological quality monitoring of recycled waters onboard ISS. Life Sci. Space. Res. (Amst). 6, 29-35]. Однако отсутствие определения видовой специфичности бактерий с помощью олигонуклеотидов, используемых в вышеприведенном прототипе, исключает возможность их использования для идентификации возбудителей сапа и мелиоидоза.

Целью настоящего изобретения является разработка набора высокоспецифичных олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации В. mallei и В, pseudomallei методом транскрипционной амплификации NASBA в режиме «реального времени».

Цель достигается созданием набора олигонуклеотидов для идентификации РЫК возбудителей сапа и мелиоидоза, содержащего пару высокоспецифичных олигонуклеотидных полимеров к целевой последовательности гена 23 S рРНК, обладающих активностью прямого и обратного праймеров в реакции транскрипционной амплификации NASBA, и флуоресцентно-меченый зонд с комплементарными концевыми последовательностями по типу «молекулярного маяка», обеспечивающего детекцию продуктов реакции в режиме «реального времени», имеющих следующую структуру:

5'-ААТ ТСТ ААТ ACG ACT САС TAT AGG GAG ACG GCT ААС ААТ АСА ААТ AAA GAG ТА-3' - Burk23SrRNA-T7-P1

5'-ССТ ТТТ GGG ТСА ТСС TAG А-3' - Burk23SrRNA-P2

5'(FAM)-CCA САС ATA GGT СТА GTG AGG CGT GTG G-(RTQ-1)3' - Burk23SrRNA-MM

где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 490 нм, а длина волны флуоресценции - 520 нм. RTQ-1 - гаситель флуоресценции с диапазоном гашения 470-570 нм.

Характеристика олигонуклеотидных праймеров, зонда и РНК-мишени для гибридизации.

Основываясь на данных, представленных в международной базе GenBank Национального центра биотехнологической информации США (http://www.ncbi.nlm.nih.gov/genome), подобраны праймеры, обозначенные Burk23SrRNA-T7-P l/Burk23SrRNA-P2, комплементарные участку гена 23S pPHK и обеспечивающие в реакции NASBA амплификацию специфичного фрагмента рибонуклеиновой кислоты размером 159 п.н.

Для детекции продуктов амплификации NASBA в режиме «реального времени» сконструирован зонд формата «молекулярный маяк», обозначенный Burk23SrRNA-MM, на разных концах которого расположены флуорофор и гаситель флуоресценции. Подобная структура зонда обеспечивает максимальный эффект тушения и низкую фоновую флуоресценцию, поскольку молекулы флуорофора и гасителя сближены в пространстве.

Апробация разработанного набора олигонуклеотидов была осуществлена на наборе штаммов возбудителей сапа и мелиоидоза из коллекции ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора. В качестве положительного контроля в экспериментах использовали референтные штаммы В. mallei 10230 и В. pseudomallei С-141. Выделение РНК проводили из обеззараженных бактериальных суспензий микроорганизмов в концентрациях от 1×109 м.к./мл до 1×100 м.к./мл. Специфичность амплификации дополнительно подтверждали секвенированием.

Оптимизацию условий реакции NASBA в режиме «реального времени» проводили с использованием коммерчески доступных реагентов, ферментов и приборов, предназначенных для массового использования в лабораторной практике, что позволяет осуществлять быстрое и надежное применение данного изобретения в медицинских и научно-исследовательских лабораториях.

Примеры конкретного выполнения.

Пример 1. Методика конструирования олигонуклеотидных праймеров и флуоресцентно-меченого гибридизационного зонда для идентификации РНК возбудителей сапа и мелиоидоза методом NASBA в режиме «реального времени».

На основе изучения in silico структуры рибосомального кластера генов (16SpPHK, 23SpPHK, 5S рРНК) в составе секвенированных нуклеотидных последовательностей возбудителей сапа и мелиоидоза, представленных в генетической базе данных GenBank NCBI, для конструирования праймеров и зонда был выбран ген 23S рРНК (GeneID: 3112968 (BPSLr08)) (таб. 1).

Для синтеза целевого фрагмента 23 S рРНК методом транскрипционной амплификации NASBA подобрана пара праймеров Burk23SrRNA-T7-P1 и Burk23SrRNA-P2, длина нуклеотидной последовательности которых составила 53 и 19 нуклеотидов, соответственно. GC-содержание гибридизующихся частей праймеров с мишенью составило 32% для праймера Burk23SrRNA-T7-P1 и 47,4% для праймера Burk23SrRNA-P2. При конструировании праймера Burk23SrRNA-T7-P1 для формирования функционального промотора Т7 РНК-полимеразы к 5'-концевому участку добавлена последовательность длиной 25 нуклеотидов. Между промоторной зоной праймера Burk23SrRNA-T7-P1 и его участком, гибридизующимся с мишенью, дополнительно добавлены три пуриновых нуклеотида с целью улучшения амплификации. Расчетный размер фрагмента гена 23S рРНК, фланкируемого предлагаемыми праймерами, - 159 п.н.

Для детекции продуктов реакции NASBA в режиме «реального времени» сконструирован зонд Burk23SrRNA-MM в формате «молекулярный маяк», потенциально способный гибридизоваться с амплифицированными 23 S рРНК-мишенями возбудителей сапа и мелиоидоза с образованием стабильных гибридов при температуре 41°С. Флуоресцентное мечение зонда осуществляли ко мбинацией красителя FAM на 5'-конце и гасителя RTQ-1 на 3'-конце. Сконструированный флуоресцентно-меченый зонд представлял собой стебель-петля-структурированный олигонуклеотид и имел в регионе стебля 6 взаимнокомплементарных нуклеотидов, при этом размер петли составил 16 нуклеотидов. Вторичную структуру и термодинамические параметры разработанного зонда оценивали в онлайн-режиме с использованием сервера Mfold Web Server (http://mfold.rna.albany.edu).

Предварительно специфичность разработанных праймеров и зонда оценивали in silico методом множественного сравнения последовательностей с помощью ресурса BLAST NCBI для установления гомологии между ними и нуклеотидными последовательностями близкородственных видов рода Burkholderia и гетерологичных микроорганизмов. На момент проведения компьютерного анализа гомологии выявлено не было.

Пример 2. Амплификация и детекция специфических фрагментов 23S рРНК с помощью разработанного набора праймеров Burk23SrRNA-T7-P1/Burk23SrRNA-P2 и флуоресцентно-меченого зонда Burk23SrRNA-MM для идентификации возбудителей сапа и мелиоидоза методом NASBA в режиме «реального времени».

Для проведения NASBA в режиме «реального времени» с разработанными праймерами Burk23SrRNA-T7-P1/Burk23SrRNA-P2 и олигонуклеотидным зондом Burk23SrRNA-MM необходимо отдельно приготовить раствор ферментов и реакционную смесь, содержащую все остальные компоненты реакции.

Реакционная смесь объемом 12.3 мкл (из расчета на одну пробу) включала следующие компоненты: 40 мМ Tris-HCl (рН=8,5), 1 мМ каждого из дезоксинуклеозидтрифосфатов («Fermentas», США), 2 мМ каждого из рибонуклеозидтрифосфатов («Fermentas», США), 12 мМ MgCb («Dialat Ltd», Россия), 87 мМ KCl («Sigma-ALDRICH», Германия), 0.5 мМ DTT («Fermentas», США), 15% ДМСО («АррНСЬет», Германия), 0.125 мкМ прямого и обратного праймеров и 0.0625 мкМ флуоресцентно-меченого зонда. Полученную реакционная смесь выдерживали при температуре 65°С в течение 5 мин.

Раствор ферментов объемом 2.7 мкл (из расчета на одну пробу) включал следующие компоненты: 2.1 мкг BSA («Fermentas», США), 0.08 активных единиц RNase Н («Thermo Scientific)), США), 6.4 активных единиц AMV Reverse Transcriptase («Promega», США), 32 активные единицы Т7 RNA Polymerase («Thermo Scientific)), США).

В микроцентрифужные пробирки объемом 0,2 мл вносили 12.3 мкл приготовленной реакционной смеси и 5 мкл экстракта РНК анализируемых образцов, после чего термостатировали в следующем режиме: 65°С - 5 мин, 41°С - 5 мин. По окончании инкубации добавляли раствор ферментов и устанавливали пробирки в амплификатор. В качестве отрицательного контрольного образца в реакционную смесь добавляли РНК-буфер.

Реакцию транскрипционной амплификации NASBA в режиме «реального времени» проводили на приборе «Rotor-Gene Q» («QIAGEN GmbH», Германия) в изотермических условиях: 41°С - 5 мин, затем 95 циклов (41°С - 60 с) с детекцией интенсивности флуоресцентного сигнала.

Регистрацию результатов проводили в графической и табличной форме. Детекцию продукта амплификации участка 23SpPHK В. mallei и В. pseudomallei для флуорофора FAM осуществляли по каналу Green. Результат считали положительным в случае, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала установленную на определенном уровне пороговую линию, что соответствует наличию значения порогового цикла «Ct» в соответствующей графе в таблице результатов.

Пример 3. Определение чувствительности и специфичности реакции транскрипционной амплификации NASBA в режиме «реального времени» с помощью разработанного набора олигонуклеотидных праймеров Burk23SrRNA-T7-P l/Burk23SrRNA-P2 и флуоресцентно-меченого зонда Burk23SrRNA -ММ для идентификации РНК В. mallei и В. pseudomallei.

Чувствительность реакции транскрипционной амплификации NASBA с разработанным набором олигонуклеотидных праймеров Burk23SrRNA-T7-Pl/Burk23SrRNA-P2 и флуоресцентно-меченого зонда Burk23SrRNA-MM оценивали при исследовании десятикратных разведений препаратов РНК, полученных из чистых культур возбудителей сапа и мелиоидоза. Штаммы буркхольдерий выращивали на плотных питательных средах в течение 1-2 суток. Готовили бактериальные взвеси клеток в 4 мл 0,15 М раствора натрия хлорида в концентрации 1×109 м.к./мл по отраслевому стандартному образцу мутности 10 единиц ФГБУ «НЦЭСМП» (ОСО 42-28-85-П (10МЕ).

Предварительную инактивацию образцов и выделение нуклеиновых кислот проводили в условиях, регламентированных СП 1.3.3118-13 «Безопасность работы с микроорганизмами I-II групп патогенности» и методическими указаниями МУ 1.3.2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности». Процедуру выделения нуклеиновых кислот из исследуемого материала осуществляли с использованием набора «РИБО-преп» (ФБУН ЦНИИ Эпидемиологии Роспотребнадзора, Россия) согласно инструкции производителя. Постановку реакции NASBA в режиме «реального времени» проводили, как описано в примере 2.

Измерение концентрации РНК проводили при помощи коммерческого набора «Qubit™ RNA HS Assay Kit» («Invitrogen», США) и флуориметра «QUBIT 2.0» («Invitrogen», США). Определение количества тотальной РНК осуществляли в пробах чистых культур В. mallei и В. pseudomallei, выделенных из концентрации 1×108 м.к./мл, а затем проводили последовательные десятикратные разведения образцов нуклеиновых кислот.

В результате была определена чувствительность реакции транскрипционной амплификации NASBA в режиме «реального времени» с разработанным набором олигонуклеотидов, составившая 0.4 фг/мкл тотальной РНК в образце, что соответствовало 101 м.к./мл (рис. 1).

Рисунок 1 отображает график нарастания кривых флуоресценции, полученных при амплификации РНК штаммов В. mallei 10230 и В. pseudomallei С-141 с помощью сконструированных праймеров Burk23SrRNA-T7-P1/Burk23SrRNA-P2 и зонда Burk23SrRNA-ММ (1 - В. mallei 10230 в концентрации 102 м.к./мл, 2 - В. pseudomallei С-141 в концентрации 102 м.к./мл, 3-B. mallei 10230 в концентрации 101 м.к./мл, 4 - В. pseudomallei С-141 в концентрации 101 м.к./мл, 5 - отрицательный контроль).

Специфичность разработанного набора олигонуклеотидов оценена на коллекции из 58 штаммов микроорганизмов, из которых 14 штаммов В. mallei, 20 штаммов В. pseudomallei и 24 штаммов гетерологичных микроорганизмов (12 штаммов Burkholderia cepacia, 5 штаммов Burkholderia thailandensis и по 1 штамму Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas putida, Francisella tularensis, Yersinia pestis, Bacillus anthracis, Echerichia coli). Оценка специфичности показала отсутствие перекрестных реакций с гетерологичными штаммами и наличие специфической амплификации со всеми штаммами В. mallei и В. pseudomallei.

Таким образом, разработанный набор олигонуклеотидных праймеров Burk23SrRNA-T7-P1/Burk23SrRNA-P2 и флуоресцентно-меченого зонда Burk23SrRNA-MM может быть использован для идентификации возбудителей сапа и мелиоидоза методом транскрипционной амплификации NASBA в режиме «реального времени» и позволяет в короткий срок с высокой чувствительностью и специфичностью детектировать РНК В. mallei и В. pseudomallei в пробах чистых культур, биологическом материале и объектах окружающей среды.

Набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei на основе транскрипционной амплификации (NASBA) в режиме «реального времени», содержащий пару высокоспецифичных олигонуклеотидных полимеров к целевой последовательности гена 23S рРНК, обладающих активностью прямого и обратного праймеров в реакции транскрипционной амплификации NASBA, и флуоресцентно-меченый зонд с комплементарными концевыми последовательностями по типу «молекулярного маяка», обеспечивающего детекцию продуктов реакции в режиме «реального времени», имеющих следующую структуру:

5'-AAT TCT AAT ACG ACT CAC TAT AGG GAG ACG GCT AAC AAT ACA AAT AAA GAG TA-3' - Burk23SrRNA-T7-P1

5'-CCT TTT GGG TCA TCC TAG A-3' - Burk23SrRNA-P2

5'(FAM)-CCA CAC ATA GGT CTA GTG AGG CGT GTG G-(RTQ-1)3' - Burk23SrRNA-MM,

где FAM - карбоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 490 нм, а длина волны флуоресценции - 520 нм. RTQ-1 - гаситель флуоресценции с диапазоном гашения 470-570 нм.



 

Похожие патенты:

Изобретение относится к области медицины, биологии и биотехнологии и предназначено для определения генотипа человека по полиморфизму в гене матриксной металлопротеиназы 3 (ММР3) -1171>5А/6А.

Изобретение относится к области медицины, в частности к молекулярной биологии, онкологии, и предназначено для прогнозирования развития метастазов у больных раком тела матки.

Изобретение относится к области биотехнологии. Изобретение представляет собой тест-систему для выявления РНК возбудителя вируса артериита у лошадей, включающую буфер для проведения полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени, смесь для ее проведения, состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для возбудителя вируса инфекции и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента TAQ POLYMERASE; буфер для разведения РНК, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для выделения РНК используют биологический материал, взятый от инфицированных возбудителем вируса артериита (Equine viral arteritis - EAV) лошадей, при этом для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца - смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса артериита (Equine viral arteritis - EAV) у лошадей и фрагмент генома бактериофага MS2, взятых в соотношении 1:1.

Изобретение относится к области биотехнологии. Предложен способ определения сапробности гидробионтов для оценки экологического состояния водоемов, характеризующийся тем, что отбирают пробы гидробионтов из водоема, определяют видовой состав организмов в пробе, получают очищенную ДНК этих организмов, получают последовательности генов с последующей трансляцией в последовательности маркерных белков, пополняют полученными первичными последовательностями генов и белков международные базы данных с последующей выборкой первичных последовательностей ДНК/РНК и белков гидробионтов водоемов.

Изобретение относится к области медицины, в частности к медицинской генетике и онкогематологии, и предназначено для количественного определения мутаций F317L и F359V/C киназного домена BCR-ABL у больных хроническим миелоидным лейкозом, резистентных к терапии ингибиторами тирозинкиназ.

Изобретение относится к области медицины, а именно к лабораторной диагностике, основанной на генетическом методе выявления критериев, свидетельствующих о тяжести клинического течения гемофилии.

Изобретение относится к биотехнологии. Изобретение может быть использовано в разработке и оптимизации ПЦР и ОТ-ПЦР систем, применяемых для выявления нуклеиновых кислот, в том числе при диагностике генетических, вирусных и других заболеваний.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен способ определения нуклеотидной последовательности-мишени, включающий создание библиотеки для секвенирования нового поколения, что включает амплификацию нуклеотидной последовательности-мишени с использованием праймера, содержащего специфичную в отношении мишени последовательность и последовательность A, с получением ампликона, где указанный ампликон может быть одноцепочечным или двуцепочечным, при этом указанная последовательность А представляет собой известную последовательность, которая является одинаковой среди множества праймеров, при этом со всеми праймерами, содержащими указанную последовательность А, можно проводить манипуляции и/или амплификацию, идентификацию, секвенирование или выделение одинаковым или сходным образом; лигирование первого адаптерного олигонуклеотида, содержащего последовательность B, с указанным ампликоном для образования адаптера-ампликона, при этом указанная последовательность В представляет собой известную последовательность, которая является одинаковой среди множества праймеров, при этом со всеми праймерами, содержащими указанную последовательность В, можно проводить манипуляции и/или амплификацию, идентификацию, секвенирование или выделение одинаковым или сходным образом; и создание библиотеки, представляющей собой «лестницу» фрагментов, содержащей множество фрагментов для применения в качестве библиотеки для секвенирования нового поколения; и секвенирование фрагмента указанной библиотеки, представляющей собой «лестницу» фрагментов, где нуклеотидная последовательность, определенная в результате секвенирования, содержит нуклеотидную субпоследовательность нуклеотидной последовательности-мишени.
Изобретение относится к области медицины, в частности к медицинской генетике и кардиологии, и предназначено для выявления предрасположенности пациента к атеросклерозу или наличия доклинических признаков этой патологии.

Прибор для обработки биологического образца содержит шасси. С шасси соединен лентопротяжный тракт, вдоль которого лента с матрицей лунок может автоматически продвигаться через прибор, дозирующий узел для дозирования биологического образца и реагента в матрицу лунок на ленте для образования смеси биологического образца и реагента, узел герметизации для герметизации смеси биологического образца и реагента в ленте и узел амплификации и детектирования для детектирования сигнала от смеси биологического образца и реагента в матрице лунок в ленте.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченные зонды для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени:полевой изолят ЗУД КРС:f- 5'- TAGAAAATGGATGTACCACAAATACAG 3',r 5' -TTGTTACAACTCAAATCGTTAGGTG-3',зонд 5' -ACCACCTAATGATAGTGTTTATGATTTACC-3;каприпоксвирусы:f - 5' ATGAAACCAATGGATGGGATA 3',r - 5' CGAAATGAAAAACGGTATATGGA 3',зонд - 5' ATGAGCCATCCATTTTCCAA 3'4;вакцинный штамм ЗУД КРС:f- 5'-TGTTTCCATTCTCCACTGCT-3',r - 5' -TACTTACTAAAAAATGGGCGCА-3',зонд - 5'-TCGCTGACATCGTTAGTCCАСТС-3'.Предложен способ дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита (нодулярного дерматита) КРС с дополнительной детекцией генома каприпоксвирусов с помощью ПЦР в режиме реального времени при одинаковом термическом профиле с использованием этих праймеров и зондов, и тест-система ПЦР в режиме реального времени для его проведения. Разработан высокочувствительный ПЦР-набор, состоящий из готовой ПЦР смеси, фермента Taq-полимеразы, положительного контроля и отрицательного контроля, позволяющий в кратчайшие сроки специфично выявить и дифференцировать геном. 3 н.п. ф-лы, 3 ил., 2 табл., 3 пр.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен набор олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei на основе транскрипционной амплификации NASBA в режиме реального времени. Изобретение может быть использовано для выявления РНК возбудителей сапа Burkholderia mallei и мелиоидоза Burkholderia pseudomallei в пробах чистых культур, биологическом материале и объектах окружающей среды для нужд здравоохранения, службы Роспотребнадзора и в научных исследованиях. 1 ил., 1 табл., 3 пр.

Наверх