Средство для получения препаратов для диагностики риккетсиоза, вызываемого rickettsia raoultii генотипа dns14

Изобретение относится к области биотехнологии, а именно к применению штамма Rickettsia raoultii «Шайман» генотипа DnSH, депонированного во Всероссийском музее риккетсиозных культур ФГБУ «Федеральный научно-исследовательский центр эпидемиологии и микробиологии им. почетного академика Н.Ф. Гамалеи» МЗ России под номером 149, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii генотип DnS14. Штамм может быть использован для идентификации риккетсий группы клещевой пятнистой лихорадки на основании генотипических и фенотипических признаков и получения диагностических препаратов. 4 пр.

 

Изобретение относится к области биотехнологии. Штамм риккетсий «Шайман» является представителем вида Rickettsia raoultii, генотипа DnS14, изолированным на территории РФ. На основании изучения фенотипических и генотипических признаков штамм отнесен к порядку Rickettsiales, семейству Rickettsiaceae, роду Rickettsia, виду Rickettsia raoultii. Штамм «Шайман» при сравнения нуклеотидных последовательностей гена gltA и гена отрА имеет 99,9% и 100% гомологии соответственно с Rickettsia raoultii sp. DnS14 strain DnS14, описанному без изоляции штамма по образцу ДНК риккетсий из клещей Dermacentor nuttalli Рыдкиной с соавторами (Rydkina Е., Roux V., Fetisova N., Rudakov N., Gafarova M., Tarasevich I. New Rickettsiae in ticks collected in territories of the former Soviet Union. Emerg.Infect.Dis., 1999. - 5. - P. 811-814). Штамм «Шайман» культивируется в культуре клеток Vero и Нер-2.

Штамм R. raoultii генотипа DnS14 "Шайман" выделен в 2000 году из имаго клещей Dermacentor silvarum, собранных с растительности в республике Бурятия.

Штамм "Шайман" хранится во Всероссийском музее риккетсиозных культур ФГБУ «Федеральный научно-исследовательский центр эпидемиологии и микробиологии им. почетного академика Н.Ф. Гамалеи» МЗ России под инвентарным номером 149 от 26.11.2002 г. Штамм "Шайман" также депонирован в коллекцию штаммов de des Rickettsies (CSUR), WHO-Collaborative Centre for Rickettsioses, Borrelioses and Tick-borne Infections, Marseille, France, под номером CSUR R8.

В 1999 году в клещах, собранных на территории России, с использованием амплификации и секвенирования rrs (16S rRNA), gltA и отрА генов были идентифицированы три новых, тесно генетически близких генотипа риккетсий: RpA4, DnS14 и DnS28 (Rydkina Е., Roux V., Fetisova N., Rudakov N., Gafarova M., Tarasevich I. New Rickettsiae in ticks collected in territories of the former Soviet Union. Emerg.Infect.Dis., 1999. - 5. - P. 811-814). В 2008 году эти генотипы описаны как принадлежащие к одному новому виду риккетсий группы клещевой пятнистой лихорадки (КПЛ) (Rickettsia raoultii sp. nov. (Mediannikov О., Matsumoto K., Samoylenko I., Drancourt M., Roux V., Rydkina E. Rickettsia raoultii sp. nov., a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia // Intern. J. Syst. Evol. Microbiol, 2008. - V.58. - P. 1635-1639).

R. raoultii широко распространена в клещах преимущественно рода Dermacentor в России и Казахстане, а также в различных странах Евразии и Северной Африки (Рудаков Н.В, Шпынов С.Н, Самойленко И.Е, Оберт А.С. Клещевой риккетсиоз и риккетсий группы клещевой пятнистой лихорадки в России. Омск: ИЦ «Омский научный вестник», 2011. - 232 с; Parola Р, Rovery С., Rolain J.M., Brouqui Р., Davoust В., and Raoult D. Rickettsia slovaca and R. raoultii in tick-borne rickettsioses // Emerg. Infect. Dis, 2009. - 15 (7). - P. 1105-1108).

Получены данные о роли этого нового вида риккетсий в возникновении синдрома TIBOLA (от англ. "tick-borne lymphadenopathy" - лимфаденопатия после присасывания клеща) или DEBONEL (Dermacentor-borne necrosis erythema and lymphadenopathy) (Ibarra V., Portillo A., Santibanez S., Blanco J.R., Perez-Martinez L., Marquez J. DEBONEL/TIBOLA: is Rickettsia slovaca the only etiological agent? // Ann. N.Y. Acad. Sci, 2005. - 1063. - P. 346-348), в том числе генотипа DnS14 (Mediannikov О., Matsumoto K. Samoylenko I., Drancourt M., Roux V., Rydkina E. Rickettsia raoultii sp. nov, a spotted fever group rickettsia associated with Dermacentor ticks in Europe and Russia // Intern. J. Syst. Evol. Microbiol, 2008. - V. 58. - P. 1635-1639; Parola P., Rovery C., Rolain J.M., Brouqui P., Davoust B., and Raoult D. Rickettsia slovaca and R. raoultii in tick-bome rickettsioses // Emerg. Infect. Dis, 2009. - 15 (7). - P. 1105-1108;.

В Китае описано два случая инфекции, связанной с R. raoultii (Jia N., Zheng Y.-C., Ma 1., Huo Q.-B., Ni X.-B., Jiang B.-G., Chu Y.-L., Jiang R.-R., Jiang J.-F., Cao W.-C. Human infections with Rickettsia raoultii, China // Emer. Inf. Dis., 2014. - 20 (5). - P. 866-868), при отсутствии классической клиники клещевого риккетсиоза или синдрома TIBOLA, с преобладанием местных проявлений на месте присасывания клеща в виде болезненной эритематозной сыпи.

Заболеваемость риккетсиозом, вызываемым R. raoultii, в настоящее время в России не регистрируется, поскольку диагностические препараты для верификации данного заболевания в РФ не выпускаются. Диагноз риккетсиоза, ассоциированного с R. raoultii, может быть поставлен только при лабораторном обследовании с использованием тест-систем на основе производственных штаммов вида R. raoultii.

Задача изобретения - оригинальный штамм вида Rickettsia raoultii DnS14, который может быть использован для разработки и изготовления диагностических препаратов (наборов реагентов).

Технический результат - использование штамма Rickettsia raoultii «Шайман» в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого R. raoultii. Заявляемый штамм обладает биологически и технологически значимыми свойствами, такими как: генетическая идентичность типовому штамму R. raoultii, способность активно размножаться на культуре клеток Vero Е6, Нер-2 и накапливать производственную биомассу в процессе культивирования, что позволяет использовать его для серийного (коммерческого) выпуска диагностических препаратов (наборов реагентов). Использование штамма Rickettsia raoultii «Шайман» в качестве продуцента диагностических препаратов позволяет оптимизировать лабораторную диагностику риккетсиозов.

Генотипические характеристики.

Выделенный штамм R. raoultii «Шайман» характеризуется следующими признаками.

Морфологические признаки. Типичны для риккетсий, но чаще встречаются кокковидные и палочковидные формы (типы а и b по классификации П.Ф. Здродовского). Грамотрицательны.

Культуралъные свойства.

1. Успешно пассируются в культурах клеток Vero и Нер-2 с накоплением до 10-15 риккетсий в поле зрения, с локализацией как в цитоплазме, так и в ядрах клеток.

2. Успешно пассируется в организме иксодовых клещей рода Dermacentor, характеризуется высоким уровнем вертикальной передачи. При моделировании естественного цикла метаморфоза в первом поколении переносчиков (F1) уровень трансовариальной передачи риккетсий составил 98%, уровень трансфазовой передачи - 100%. Средний уровень накопления риккетсий в голодных личинках - 10, после кровопитания личинок на сосунках белых мышей - 55 микробных клеток в поле зрения (тотальные мазки исследованы в МФА с поликлональными антителами к риккетсиям группы КПЛ). Средний уровень накопления риккетсий в голодных нимфах составил - 8, после кровопитания нимф 50 микробных клеток в поле зрения. Штвмм изолирован с использованием клещевой экспериментальной модели и высушен из имаго второго поколения естественно инфицированной линии клещей D. silvarum.

Антигенные свойства. Антигенные детерминанты R. raoultii выявляются методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы клещевой пятнистой лихорадки люминесцирующими, сухими (Филиал ФГУП «НПО «Микроген» МЗ РФ «Пермское НПО «Биомед», г. Пермь). Антигенные свойства соответствуют риккетсиям группы КПЛ по данным МФА с поликлональными антителами к риккетсиям группы КПЛ.

Определена нуклеотидная последовательность гена ОтрА, кодирующего 190 - kD белок наружной мембраны риккетсий, получена последовательность нуклеотидов длиной 454 п. о.:

При идентификации в GenBank данная последовательность нуклеотидов имела 100% гомологии с Rickettsia DnS14 strain DnS14, депонированной в GenBank под номером АН009130.2.

Определена нуклеотидная последовательность гена цитрат синтазы (gltA) длиной 762 пары оснований штамма «Шайман», которая имела 99,9% гомологии с последовательностью гена цитрат синтазы Rickettsia sp. DnS14 strain DnS14, депонированной в GenBank под номером AF120028:

На основании морфологических, антигенных и генетических признаков изолированный штамм относен к роду Rickettsia виду Rickettsia raoultii, генотипу DnS14.

Изобретение иллюстрируется следующими примерами.

Пример 1. Идентификация на основании генотипических признаков.

Экстракция ДНК

Экстракцию риккетсиальной ДНК из пробы культур клеток осуществляют, применяя QIAamp Tissue Kit (QIAGEN, Hilden, Germany) и протеиназу К в концентрации 2,0 мг/мл (Boehringer Mannheim, Mannheim, Germany) в соответствии с протоколом QIAamp Tissue Kit.

Полимеразная цепная реакция (ПЦР) и секвенс-реакция.

Полимеразную цепную реакцию (ПЦР) и секвенс-реакцию выполняют, применяя праймеры, специфичные для Rickettsiae, используют две пары праймеров, амплифицирующие gltA ген, кодирующий цитрат синтетазу: CSld (ATGACTAATGGCAATAATAA) и CS535r (GAATATTTATAAGACAT-TGC), CS409d (CCTATGGCTATTATGCTTGC) и RP1258n (ATTGCAAAAAGTACAGTGAACA), а также праймеры 190.70 (ATGGCGAATATTTCTCCAAAA), 190.180 (GCAGCGATAATGCTGAGTA) и 190.701 (GTTCCGTTAATGGCAGCATCT), амплифицирующие ompA ген, кодирующий белок наружной мембраны (Roux, V., et al., 1997; Fournier, P-E., et al., 1998).

Однораундовую ПЦР выполняют в термоциклере Peltier модель РТС-200 (Mj Research, Inc, Watertown, MA). Реакцию амплификации выполняют в объеме 25 мкл, в присутствии 5 пкМ каждого праймера и 1 ед. Taq-полимеразы, 2,5 мкл смеси дезоксинуклеотидов трифосфатов (2% dATP, 2% dCTP, 2% dTTP, 2% dGTP в стерильной воде), 1 мкл 25 mM раствора MgCl2, 2,5 мкл 10х реакционного буфера (Perkin-Elmer Cetus, Norwalk, Conn.). Профиль амплификации включает начальную денатурацию в течение 15 минут при 95°С, 39 циклов амплификации (денатурация при 94°С-60 с, отжиг праймеров при 54°С - 30 с, элонгация при 72°С - 60 с) и финальную элонгацию в течение 5 минут при 72°С. Каждая постановка ПЦР включает отрицательный контроль (дистиллированная вода) и положительный контроль (ДНК R. montanensis).

Пурификацию ПЦР-продукта проводят, применяя QIAquick PCR Purification Kit (Germany) в соответствии с протоколом.

Секвенс-реакцию с ПЦР-продуктами выполняют, применяя d-Rhodamine Terminator Cycle Sequencing Ready Reaction kit (Applied Biosistems, Warrington, UK). Секвенирование выполняют на ABI 3100 PRISM (Applied Biosystems) автоматическом секвенаторе. Анализ полученных нуклеотидных последовательностей для сравнения степени гомологии с последовательностями Банка данных GenBank проводят с помощью программы BLAST в режиме прямого доступа.

Пример 2. Культивирование риккетсий и идентификация на основании фенотипических (культуральных и антигенных) свойств.

2.1. Культивирование риккетсий с использованием экспериментальной клещевой модели.

Культивирование и изучение уровня трансовариальной и трансфазовой передачи проводят с использованием экспериментальной клещевой модели (Тагильцев А.А., Тарасевич Л.Н., Богданов И.И., Якименко В.В. Изучение членистоногих убежищного комплекса в природных очагах трансмиссивных вирусных инфекций: Руководство по работе в полевых и лабораторных условиях, - Томск, 1990) в сочетании с методами выявления и изучения риккетсий. Кормление пары естественно инфицированных имаго клещей (самка и самец) проводят на взрослых лабораторных животных (морские свинки или белые мыши). Появившееся потомство содержат в серийных кормлениях-линьках «личинка-нимфа-имаго». Для определения наличия риккетсий в потомстве образцы появившихся личинок и нимф исследуют методом флюоресцирующих антител с поликлональными антителами как в голодном состоянии, так и после напитывания.

2.2. Культивирование риккетсий с использованием перевиваемых культур клеток.

Версенизация и выращивание клеточных культур.

Для работы культуры клеток Vero Е6 и Нер-2 подвергают версенизации по стандартной методике Соловьева В.Д., Бектемирова Т.А. (1972 г.), в матрац добавляют раствор Версена до конечной концентрации 0,25% и раствор трипсина также до концентрации 0,25%. На флакон с культуральной поверхностью 25 см достаточно 0,5 мл раствора. Его равномерно распределяют по слою клеток покачиванием флакона, выдерживают при 37°С до тех пор, пока все клетки не отделятся от ростовой поверхности (проверяют под инвертированным микроскопом), энергично постукивают по стенке флакона; отделившиеся клетки ресуспендируют в ростовой среде (4,5 мл на флакон с ростовой поверхностью 25 см2), которая останавливает действие трипсина. Суспензию пипетируют, чтобы раздробить агрегаты клеток, разводят суспензию клеток ростовой средой Игла MEM с двойным набором аминокислот до нужной концентрации, основываясь на подсчете клеток: 150 тыс. в 1 мл. К общему объему добавляют эмбриональную сыворотку до концентрации 5%. Рассевают полученную клеточную суспензию в культуральные флаконы или пробирки, плотно закрывают и помещают в термостат при 37°С. Когда монослой почти сформирован (1-2 дня) заменяют ростовую среду поддерживающей средой. Культуры клеток обычно перевивают каждые 5-7 дней.

Заражение культур клеток.

Клеточную культуру во флаконе заражают 50%-ой суспензией, приготовленной из лиофильно высушенных штаммов, в объеме 0,5 мл на флакон. Флаконы с зараженными клетками центрифугируют при 800 об/мин при температуре 22°С в течение 30 мин, после центрифугирования во все флаконы добавляют среду поддержки (Игла MEM с добавлением 1% эмбриональной сыворотки) в объеме 1,5 мл на флакон (Raoult D., 2000). Флаконы с зараженными клетками инкубируют в углекислотном термостате при температуре 37°С в течение 8-14 суток, в зависимости от культуры клеток. После чего флаконы подвергают замораживанию при температуре минус 20°С, затем размораживают при комнатной температуре, для разрушения клеток и максимального выхода из них микроорганизмов. После размораживания, материал в объеме 0,5 мл берут на следующий пассаж, а из 0,2 мл делают мазки, остатки супернатанта хранят в криопробирках в низкотемпературном холодильнике при температуре минус 20°С. Степень накопления риккетсий и отсутствие посторонней микрофлоры определяют в мазках, окрашивая их по Романовскому - Гимза.

Полученные образцы кроме того исследуют методом флюоресцирующих антител по стандартной методике, используюя иммуноглобулины диагностические для выявления риккетсий группы КПЛ, антитела люминесцирующие сухие (НПО «Биомед). Изучение морфологических и тинкториальных свойств, проводят по методу Здродовского (Здродовский П.Ф., Голиневич Е.М., 1972).

2.3 Изучение антигенных свойств.

Антигенные детерминанты Rickettsia raoultii генотипа DnS14 в клещах и на культуре клеток выявляют методом флюоресцирующих антител с иммуноглобулинами диагностическими для выявления риккетсий группы КПЛ, люминесцирующими, сухими (НПО «Биомед»).

Пример 3. Приготовление корпускулярного антигена.

После завершения культивирования культуру зараженных клеток замораживают в низкотемпературном холодильнике при минус 20°С, а потом размораживают для разрушения клеток и максимального выхода из них риккетсий. Материал центрифугируют 10 минут при 3000 оборотах в минуту. Супернатант используют для нанесения корпускулярного антигена на стекла и проведения реакции непрямой иммунофлюоресценции для исследования сывороток крови больных после присасывания иксодовых клещей.

Пример 4. Приготовление цельнорастворимых антигенов

Для приготовления антигена зараженные культуры клеток подвергают центрифугированию при 6000 оборотах в минуту в течение 60 минут, далее удаляют супернатант, а из полученной взвеси делают мазки, которые окрашивают по Романовскому - Гимза.

После микроскопического контроля во взвесь зараженных клеток 0,5%. Фенол (0,5 мл цельного фенола плюс 99,5 мл забуференного физиологического раствора рН 7,0) из расчета 2 мл фенола на 1 мл клеточной взвеси. После встряхивания в шейкере пробирки с зараженной клеточной взвесью помещают в рефрижератор на 3-4 дня для осаждения посторонних белковых примесей.

После этого клеточную взвесь подвергают многократной эфирной обработке по Craigie (1945 г.). При первой эфирной обработке к материалу добавляют 1,5-2 объема наркозного эфира и после встряхивания оставляют при комнатной температуре до следующего дня в темном месте. Затем водную фазу отделяют, и второй раз обрабатывают эфиром (равный объем эфира в отношении водной фазы), встряхивают и оставляют на 2 часа, затем водную фазу вновь отделяют и в третий раз обрабатывают эфиром (1/2 объема эфира по отношению к объему водной фазы) таким же образом.

При образовании среднего тканевого слоя после третьей обработки делают еще одну эфирную обработку с таким же соотношением эфира и водной фазы. После окончания эфирной обработки производят отгонку эфира под небольшим вакуумом. Пробирки с антигеном оставляют в течение суток в холодильнике при температуре 6+2°С для испарения эфира. Полученные серии антигенов испытывают в реакции связывания комплемента (РСК) на антикомплементарность, специфичность, чувствительность и определяют титр. Также антигены стандартизуют по уровню аминного азота методом формольного титрования (%) и белка с помощью биуретовой реакции (%). После испытания антигены разливают в ампулы по 1,0 мл и лиофильно высушивают. Высушенный антиген хранят при температуре минус 20°С.

Таким образом, по результатам сравнения нуклеотидных последовательностей гена gltA и гена отрА штамм имеет 99,9% и 100% гомологии соответственно с Rickettsia raoultii генотип DnS14 (strain DnS14), активно размножается на культурах клеток Vero Е6 и Нер-2, что позволяет в процессе культивирования накапливать производственную биомассу. С учетом этого, он может быть использован в качестве производственного штамма при разработке и изготовлении препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii генотипа DnS14.

Применение штамма Rickettsia raoultii «Шайман» генотипа DnS14, депонированного во Всероссийском музее риккетсиозных культур ФГБУ «Федеральный научно-исследовательский центр эпидемиологии и микробиологии им. почетного академика Н.Ф. Гамалеи» МЗ России под номером 149, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii генотипа DnS14.



 

Похожие патенты:

Изобретение относится к микробиологии и биотехнологии. Предложен штамм бактерий Bifidobacterium longum ICIS-505, который является продуцентом биологически активных веществ, обладающих антиперсистентной активностью в отношении условно-патогенных и патогенных бактерий и дрожжевых грибов.

Изобретение относится к областям биотехнологии, молекулярной биологии и медицинской микробиологии. Разработан набор олигонуклеотидных праймеров для реакции петлевой изотермической амплификации (LAMP), который позволяет амплифицировать специфические для бактерий вида Francisella tularensis фрагменты ДНК из целевого гена, имеющего нуклеотидную последовательность SEQ ID №:1.
Изобретение относится к области биотехнологии. Предложен штамм бактерий Streptococcus equi для изготовления вакцины против мыта лошадей.
Изобретение относится к области биотехнологии. Предложен обладающий способностью к деструкции нефти и нефтепродуктов штамм Pseudoalteromonas arctica.

Группа изобретений относится к области биотехнологии. Предложена аланиндегидрогеназа, отличающаяся тем, что указанный фермент имеет последовательность, которая по меньшей мере на 85% идентична последовательности под SEQ ID NO: 72.

Изобретение относится к биотехнологии. Пробиотический препарат для интенсивного откорма сельскохозяйственных животных и птицы получен путем смешивания лиофилизированных культур штаммов Enterococcus hirae ВКПМ В-12670 и Enterococcus mundtii ВКПМ В-12675 в соотношении 1:1.

Группа изобретений относится к получению тагатозы из фруктозы. Предложен белок для получения тагатозы из фруктозы, имеющий аминокислотную последовательность, представленную в SEQ ID NO:1-7.

Изобретение относится к биотехнологии. Питательная среда для культивирования бруцеллезного микроба содержит пептон, натрия хлорид, мясную воду, стерильную сыворотку крупного рогатого скота, декстрозу, агар-агар и геотермальную воду при заданном соотношении компонентов.

Группа изобретений относится к биотехнологии и включает кристаллообразующий штамм бактерий Brevibacillus laterosporus ВКПМ В-13186 и варианты его применения. Предлагаемый штамм является спорообразующим и обладает широким спектром антагонистической активности против различных видов организмов, что позволяет использовать его как эффективный биоцид.

Группа изобретений относится к биотехнологии и производству биологических средств защиты растений. Группа изобретений включает спорообразующий штамм бактерий Bacillus amyloliquefaciens ВКПМ В-11443 и биопрепарат на его основе.

Изобретение относится к медицинской микробиологии и может быть использовано для изготовления вакцинных препаратов. Предложен способ получения вакцины гемофильной тип b конъюгированной. Способ включает культивирование штамма Haemophilus influenzae тип b «ГКПМ-Оболенск» В-7884 на жидкой питательной среде с добавлением рибозы, инактивацию культуры нагреванием до 55±5°С и выдерживанием 15±3 мин, отделение биомассы центрифугированием и выделение полирибозилрибитолфосфата (ПРФ) путем осаждения 10%-ным раствором цетилтриметиламмония бромида (ЦТАБ). Затем выполняют концентрирование, очистку, осветление, активацию ПРФ и смешивание его со столбнячным анатоксином. Затем полученную субстанцию очищают, стерилизуют, добавляют фармацевтически приемлемые носители, разливают и лиофильно высушивают. Способ обеспечивает повышение выхода целевого продукта. 1 з.п. ф-лы, 1 ил., 2 табл., 2 пр.

Изобретение относится к области биотехнологии, а именно к применению штамма Rickettsia raoultii «Шайман» генотипа DnSH, депонированного во Всероссийском музее риккетсиозных культур ФГБУ «Федеральный научно-исследовательский центр эпидемиологии и микробиологии им. почетного академика Н.Ф. Гамалеи» МЗ России под номером 149, для разработки препаратов для диагностики риккетсиоза, вызываемого Rickettsia raoultii генотип DnS14. Штамм может быть использован для идентификации риккетсий группы клещевой пятнистой лихорадки на основании генотипических и фенотипических признаков и получения диагностических препаратов. 4 пр.

Наверх