Композиции для модулирования экспрессии sod-1

Группа изобретений относится к медицине и касается антисмыслового соединения для снижения экспрессии супероксиддисмутазы 1 (SOD-1), где антисмысловое соединение имеет следующую формулу: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Те (последовательность азотистых оснований SEQ ID NO: 725) или его фармацевтически приемлемой соли. Группа изобретений также касается фармацевтической композиции для снижения экспрессии супероксиддисмутазы 1 (SOD-1), содержащей указанное антисмысловое соединение или его фармацевтически приемлемую соль; способа лечения или предупреждения связанного с SOD-1 нейродегенеративного расстройства или связанного с SOD-1 ALS, включающего введение указанного антисмыслового соединения или его фармацевтически приемлемой соли. Группа изобретений обеспечивает лечение или предупреждение связанного с SOD-1 нейродегенеративного расстройства или связанного с SOD-1 ALS. 12 н. и 5 з.п. ф-лы, 19 пр., 71 табл.

 

Перечень последовательностей

Настоящая заявка подана вместе с перечнем последовательностей в электронном формате. Перечень последовательностей представлен в виде файла под названием BIOL0240WOSEQ_ST25.pdf, созданного 30 марта 2015 года, размером 320 Кб. Информация о перечне последовательностей в электронном формате в полном объеме включена в настоящий документ посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ

Представлены композиции и способы снижения экспрессии мРНК и белка растворимой супероксиддисмутазы 1 (SOD-1) у животного. Указанные способы подходят для лечения, предупреждения или облегчения нейродегенеративных заболеваний, включая амиотрофический латеральный склероз (ALS), посредством ингибирования экспрессии SOD-1 у животного.

УРОВЕНЬ ТЕХНИКИ

Растворимый фермент SOD-1 (также известный как Cu/Zn супероксиддисмутаза) представляет собой одну из супероксиддисмутаз, которые обеспечивают борьбу с окислительным повреждением биомолекул посредством катализа дисмутации супероксида до пероксида водорода (H2O2) (Fridovich, Annu. Rev. Biochem., 1995, 64, 97-112). Супероксид-анион (O2-) представляет собой потенциально опасный клеточный побочный продукт, образующийся, главным образом, в результате ошибочного окислительного фосфорилирования в митохондриях (Turrens, J. Physiol. 2003, 552, 335-344)

Мутации в гене SOD-1 связаны с доминантной наследственной формой амиотрофического латерального склероза (ALS, также известного как болезнь Лу Герига), расстройства, характеризующегося селективной дегенерацией верхних и нижних двигательных нейронов (Rowland, N. Engl. J. Med. 2001, 344, 1688-1700). Существует тесная генетическая связь между наследственным ALS и миссенс-мутациями в гене SOD1 (Rosen, Nature, 1993, 362, 59-62). Токсичность мутантной SOD1 предположительно обусловлена первоначальным неправильным сворачиванием (с приобретением функций), снижающим ядерную защиту от активного фермента (потеря функции в ядре), процессом, который может участвовать в патогенезе ALS (Sau, Hum. Mol. Genet. 2007, 16, 1604-1618).

ALS представляет собой изнуряющее прогрессирующее нейродегенеративное заболевание, постоянно поражающее 30000 жителей США. Прогрессирующая дегенерация двигательных нейронов при ALS в конечном итоге приводит к их гибели. При гибели двигательных нейронов способность головного мозга инициировать и контролировать движение мышц теряется. При прогрессирующем ухудшении произвольного движения мышц пациенты на поздних стадиях заболевания могут стать полностью парализованными.

В настоящее время отсутствуют приемлемые варианты лечения таких нейродегенеративных заболеваний. Поэтому целью настоящего изобретения является обеспечение способов лечения указанных заболеваний.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

В настоящем документе представлены способы, соединения и композиции для модулирования экспрессии мРНК и белка растворимой супероксиддисмутазы 1 (SOD-1). В некоторых вариантах реализации изобретения соединения, пригодные для модулирования экспрессии мРНК и белка SOD-1, представляют собой антисмысловые соединения. В некоторых вариантах реализации изобретения антисмысловые соединения представляют собой модифицированные олигонуклеотиды.

В некоторых вариантах реализации изобретения модуляция может происходить в клетке или ткани. В некоторых вариантах реализации изобретения клетки или ткани находятся в организме животного. В некоторых вариантах реализации животное представляет собой человека. В некоторых вариантах реализации изобретения уровни мРНК SOD-1 снижаются. В некоторых вариантах реализации изобретения уровни белка SOD-1 снижаются. Подобные сокращения могут возникать в зависимости от времени или в зависимости от дозы.

Также представлены способы, соединения и композиции, подходящие для предупреждения, лечения и облегчения заболеваний, расстройств и патологических состояний. В некоторых вариантах реализации изобретения такие SOD-1-связанные заболевания, расстройства и патологические состояния представляют собой нейродегенеративные заболевания. В некоторых вариантах реализации такие нейродегенеративные заболевания, расстройства и патологические состояния включают амиотрофический латеральный склероз (ALS).

Такие заболевания, расстройства и патологические состояния могут в совокупности иметь один или несколько факторов риска, причин или последствий. Некоторые факторы риска и причины развития ALS включают старение, наличие личной или семейной истории болезни, или генетическую предрасположенность. Однако большинство случаев ALS являются случайными, и не существует известных факторов риска. Некоторые симптомы и исходы, связанные с развитием ALS, включают, но не ограничиваются ими: фасцикуляцию, колики, напряженные и застывшие мышцы (спастичность), мышечную слабость, поражающую руку или ногу, невнятную и назальную речь, затруднения при ходьбе, затруднения при жевании или проглатывании (дисфагия), затруднения при разговоре или формировании слов (дисартрия), слабость или атрофию, спастичность, преувеличенные рефлексы (гиперрефлексия) и наличие симптома Бабинского. По мере прогрессирования ALS симптомы и исходы могут включать ослабление других конечностей, возможно сопровождающееся подергиванием, мышечными судорогами и преувеличенными, убыстренными рефлексами; проблемы при жевании, проглатывании и дыхании; может возникать слюнотечение; случайны паралич; и смерть.

В некоторых вариантах реализации изобретения способы лечения включают введение антисмыслового соединения против SOD-1 индивидууму, нуждающемуся в этом. В некоторых вариантах реализации изобретения способы лечения включают введение модифицированного олигонуклеотида против SOD-1 индивидууму, нуждающемуся в этом.

ПОДРОБНОЕ ОПИСАНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Следует понимать, что изложенное выше общее описание и следующее подробное описание являются лишь примерными и пояснительными, и не являются ограничивающими заявленное изобретение. В настоящем документе использование единственного числа включает множественное число, если специально не указано иное. При использовании в настоящем документе, термин «или» означает «и/или», если не указано иное. Кроме того, в данном контексте применение термина «и» означает «и/или», если не указано иное. Кроме того, использование термина «включая», а также других форм, таких как «включает» и «включенный», не является ограничивающим. Также, такие термины как «элемент» или «компонент» охватывают как элементы и компоненты, содержащие одну единицу, так и элементы и компоненты, которые содержат более одной субъединицы, если специально не указано иное. Кроме того, все последовательности, описанные в настоящем документе, указаны в направлении от 5' к 3', если не указано иное.

Заголовки разделов, используемые в настоящем документе, предназначены лишь для организационных целей и не должны истолковываться как ограничения описанного объекта изобретения. Все документы или фрагменты документов, цитируемые в настоящем изобретении, включая, но не ограничиваясь ими, патенты, патентные заявки, опубликованные патентные заявки, статьи, книги, монографии и учетные номера GENBANK, а также информацию об ассоциированной последовательности, получаемую посредством баз данных, таких как Национальный центр информации по биотехнологии (NCBI), и другие данные, указанные в в тексте настоящего описания, явным образом включены в настоящий документ посредством ссылки в отношении тех фрагментов документов, которые рассмотрены в настоящем документе, а также в полном объеме.

Определения

При отсутствии конкретных определений, номенклатура, используемая в связи с ними, а также в связи с приемами и методиками аналитической химии, синтетической органической химии, а также медицинской и фармацевтической химии, описанная в настоящем документе, является общеизвестной и общепринятой в данной области техники. Для химического синтеза и химического анализа могут быть использованы стандартные методики.

Если не указано иное, следующие термины имеют следующие значения:

«2'-Дезоксинуклеозид» (также 2'-дезоксирибонуклеозид) означает нуклеозид, содержащий 2'-Н фуранозильный сахарный фрагмент, находящийся в природных дезоксирибонуклеозидах (ДНК). В некоторых вариантах реализации 2'-дезоксинуклеозид может содержать модифицированное азотистое основание или может содержать азотистое основание РНК (например, урацил).

«2'-Дезоксирибозный сахар» означает 2'-Н фуранозильный сахарный фрагмент, находящийся в природных дезоксирибонуклеиновых кислотах (ДНК).

«2'-O-метоксиэтил» (также 2'-МОЕ и 2'-ОСН2СН2-ОСН3 и МОЕ, и 2'-O-метоксиэтилрибоза) относится к О-метоксиэтильной модификации 2'-положении фуранозного кольца. 2'-O-метоксиэтилрибозный модифицированный сахар представляет собой модифицированный сахар.

«2'-O-метоксиэтилрибозный модифицированный нуклеозид» (также «2'-МОЕ нуклеозид») обозначает нуклеозид, содержащий модифицированный 2'-МОЕ сахарный фрагмент.

«2'-замещенный нуклеозид» означает нуклеозид, содержащий отличный от Н или ОН заместитель в 2'-положении фуранозного кольца. В некоторых вариантах реализации 2'-замещенные нуклеозиды включают нуклеозиды с бициклическими сахарными модификациями.

«5-метилцитозин» означает цитозин модифицированный метильной группой в 5 положении. 5-метилцитозин представляет собой модифицированное азотистое основание.

«Около» означает в пределах ±10% от значения. Например, если указано, что «соединения вызывают ингибирование SOD-1 по меньшей мере около 50%», это означает, что уровни SOD-1 ингибируются в пределах диапазона от 45% до 55%. «Вводят совместно» относится к совместному введению двух фармацевтических агентов любым способом, при котором фармакологические эффекты обоих проявляются у пациента одновременно. Совместное применение не требует, чтобы оба фармацевтических агента вводились в одной фармацевтической композиции, в одной лекарственной форме или одним способом введения. Эффекты обоих фармацевтических агентов не обязательно должны проявляться одновременно. Эффекты должны только перекрываться в промежутке времени и не обязательно должны иметь одинаковую продолжительность.

«Введение» означает обеспечение фармацевтическим агентом животного и включает, но не ограничивается этим, введение медицинским работником и самостоятельное введение.

«Улучшение» относится к уменьшению, замедлению, остановке или инвертированному течению по меньшей мере одного показателя тяжести состояния или заболевания. Степень тяжести показателей может быть определена субъективными или объективными показателями, которые известны специалистам в данной области техники.

«Животное» относится к человеку или животному, не являющемуся человеком, включающему, но не ограничивающемуся ими, мышей, крыс, кроликов, собак, кошек, свиней и приматов, включая, но не ограничиваясь ими, обезьян и шимпанзе.

«Антитело» относится к молекуле, характеризующейся специфическим взаимодействием с антигеном каким-либо образом, при этом антитело и антиген определены относительно друг друга. Антитело может относиться к целой молекуле антитела, или какому-либо ее фрагменту или области, такой как тяжелая цепь, легкая цепь, область Fab и область Fc.

«Антисмысловая активность» означает любую обнаруживаемую или поддающуюся измерению активность, обусловленную гибридизацией антисмыслового соединения с его нуклеиновой кислотой-мишенью. В неких вариантах реализации антисмысловая активность представляет собой уменьшение количества или экспрессии нуклеиновой кислоты-мишени или белка, кодируемого такой нуклеиновой кислотой-мишенью.

«Антисмысловое соединение» означает олигомерное соединение, способное к гибридизации, к целевой нуклеиновой кислоте за счет водородных связей. Примеры антисмысловых соединений включают одноцепочечные и двухцепочечные соединения, такие как антисмысловые олигонуклеотиды, миРНК, мшРНК, оцРНК и соединения на их основе.

«Антисмысловое ингибирование» означает снижение уровней целевой нуклеиновой кислоты в присутствии антисмыслового соединения комплементарного целевой нуклеиновой кислоте по сравнению с уровнями целевой нуклеиновой кислоты или в отсутствие антисмыслового соединения.

«Антисмысловые механизмы» представляют собой все те механизмы гибридизации соединения с целевой нуклеиновой кислотой, отличающиеся тем, что результат или эффект гибридизации или целевой деградации, или целевой занятости с сопутствующей остановкой клеточных механизмов, при участии, например, транскрипции или сплайсинга.

«Антисмысловой олигонуклеотид» означает одноцепочечный олигонуклеотид, содержащий последовательности, обеспечивающие гибридизацию соответствующему сегменту целевой нуклеиновой кислоты.

«Комплементарность основания» относится к способности спаривания конкретной пары азотистых оснований олигонуклеотида с соответствующими азотистыми основаниями в нуклеиновой кислоте-мишени (т.е. гибридизации), опосредованной уотсон-криковским, хугстиновским или обратным хугстиновским водородным связыванием между соответствующими азотистыми основаниями.

«Бициклический сахар» означает фуранозное кольцо, модифицированное образованием мостика между двумя атомами. Бициклический сахар представляет собой модифицированный сахар.

«Бициклическая нуклеиновая кислота» или «БНК» относится к нуклеозиду или нуклеотиду, в котором фуранозная часть нуклеозида или нуклеотида содержит мостик, соединяющий два атома углерода фуранозного кольца, с образованием бициклической кольцевой системы.

«Кэп-структура» или «кэп-терминальный фрагмент» означает химические модификации, которые были сделаны на любом конце антисмыслового соединения.

«cEt» или «стерически затрудненный этил», или «cEt-модифицированный сахар» означает бициклический нуклеозид, содержащий сахарный фрагмент, содержащий мостик, соединяющий 4'-углерод и 2'-углерод, причем мостик имеет формулу: 4'-СН(СН3)-O-2'. cEt-модифицированный сахар представляет собой модифицированный сахар.

«cEt-модифицированный нуклеозид» означает бициклический нуклеозид, содержащий сахарный фрагмент, содержащий мостик, соединяющий 4'-углерод и 2'-углерод, причем мостик имеет формулу: 4'-СН(СН3)-O-2'. cEt-модифицированный сахар представляет собой модифицированный сахар.

«Химически различимый участок» относится к участку антисмыслового соединения, который в некотором роде химически отличается от другого участка того же антисмыслового соединения. Например, участок, содержащий 2'-O-метоксиэтиловые нуклеозиды, является химически отличным от участка, содержащего нуклеозиды без 2'-O-метоксиэтиловых модификаций.

«Химерное антисмысловое соединение» означает антисмысловое соединение, которое имеет по меньшей мере два химически различных участка, каждая позиция имеет множество субъединиц.

«Совместное введение» означает введение двух или более фармацевтических средств индивидууму. Два или более фармацевтических агента могут быть в одной фармацевтической композиции или могут быть в отдельных фармацевтических композициях. Каждый из двух или более фармацевтических агентов может вводиться через те же или различные пути введения. Совместное введение включает параллельное или последовательное введение.

«Комплементарность» означает способность спаривания азотистых оснований первой и второй нуклеиновых кислот.

«Включать», «включает» и «включающий» следует понимать как включение указанной стадии или элемента, или группы элементов или стадий, но не исключение любого другого элемента или стадии, или группы стадий или элементов.

«Непрерывные азотистые основания» означают азотистые основания, непосредственно примыкающие друг к другу.

«Конструирование» или «сконструированный для» относиться к процессу конструирования олигомерного соединения, которое специфически гибридизуются с выбранной молекулой нуклеиновой кислоты.

«Разбавитель» означает ингредиент в композиции, в котором отсутствует фармакологическая активность, но который является фармацевтически необходимым или желательным. Например, в препаратах, которые вводят парентерально, разбавитель может быть жидкостью, например, солевым раствором.

«Доза» означает количество указанного фармацевтического агента, предоставляемое при одном введении или в определенный период времени. В некоторых вариантах реализации доза может вводиться в одной, двух или более пилюлях, таблетках или инъекциях. Например, в определенных вариантах реализации, где необходимо подкожное введение, нужная доза требует объема, который не помещается в одной инъекции, поэтому для достижения желаемой дозы могут быть использованы две или более инъекций. В некоторых вариантах реализации фармацевтический агент вводят путем инфузии в течение длительного периода времени или непрерывно. Дозы могут быть указаны как количество фармацевтического агента в час, день, неделю, или месяц.

«Эффективное количество» в контексте модулирования активности или лечения или предупреждения состояния, означает введение данного количества фармацевтического агента субъекту, нуждающемуся в такой модуляции, лечении или профилактике, или в однократной дозе или как часть серии, которое является эффективным для модуляции данного эффекта, или для лечения или профилактики или улучшения данного состояния. Эффективное количество может варьировать среди индивидуумов в зависимости от здоровья и физического состояния индивидуума, подлежащего лечению, таксономической группы индивидуумов, подлежащих лечению, рецептуры композиции, оценки индивидуального состояния здоровья и других релевантных факторов.

«Эффективность» означает способность производить желаемый эффект.

«Экспрессия» включает в себя все функции, благодаря которым информация, закодированная в гене, преобразуется в структуры, присутствующие и функционирующие в клетке. Такие структуры включают, но не ограничиваются ими, продукты транскрипции и трансляции.

«Полностью комплементарный» или «100% комплементарный» означает, что каждое азотистое основание первой нуклеиновой кислоты имеет комплементарное азотистое основание во второй нуклеиновой кислоте. В некоторых вариантах реализации первая нуклеиновая кислота представляет собой антисмысловое соединение, а нуклеиновая кислота-мишень представляет собой вторую нуклеиновую кислоту.

«Гэпмер» означает химерное антисмысловое соединение, в котором внутренний участок, имеющий множество нуклеозидов, которые поддерживают расщепление РНКазой Н, располагается между внешними участками, имеющими один или несколько нуклеозидов, причем нуклеозиды, составляющие внутренние участки, химически отличаются от нуклеозида или нуклеозидов, составляющих внешние участки. Внутренняя область может быть описана как «гэп», а внешние области могут быть описаны как «крылья».

«Гэп-суженный» означает химерное антисмысловое соединение, имеющее сегмент гэп из 9 или менее последовательных 2'-дезоксирибонуклеозидов, расположенный между и непосредственно примыкающий к 5' и 3' сегментам крыльев, имеющим от 1 до 6 нуклеозидов.

«Гэп-расширенный» означает химерное антисмысловое соединение, имеющее сегмент гэп из 12 или более последовательных 2'-дезоксирибонуклеозидов, расположенный между и непосредственно примыкающий к 5' и 3' сегментам крыльев, имеющим от 1 до 6 нуклеозидов.

«Гибридизация» означает соединение комплементарных молекул нуклеиновых кислот. В некоторых вариантах реализации комплементарные молекулы нуклеиновых кислот включают, но не ограничиваются ими, антисмысловое соединение и нуклеиновую кислоту-мишень. В некоторых вариантах реализации комплементарные молекулы нуклеиновых кислот включают, но не ограничиваются ими, олигонуклеотид и нуклеиновую кислоту-мишень.

«Идентификация животного, имеющего SOD-1-связанное заболевание» обозначает идентификацию животного, которому поставлен диагноз связанного с SOD-1 заболевания, или которое предрасположено к развитию связанного с SOD-1 заболевания. Индивидуумы, предрасположенные к развитию связанного с SOD-1 заболевания, включают тех, у кого присутствуют один или несколько факторов риска развития связанного с SOD-1 заболевания, включая старение, личный или семейный анамнез или генетическую предрасположенность к одному или нескольким связанным с SOD-1 заболеваниям. Такая идентификация может быть выполнена любым способом, включая оценку истории болезни человека и стандартными клиническими испытаниями или оценками, такими как генетическое тестирование.

«Непосредственно примыкающий» означает, что нет никаких промежуточных элементов между непосредственно примыкающими элементами.

«Индивидуум» означает человека или животное, не являющееся человеком, выбранное для лечения или терапии.

«Ингибирование SOD-1» обозначает снижение уровня или экспрессии мРНК и/или белка SOD-1. В некоторых вариантах реализации изобретения уровни мРНК и/или белка SOD-1 ингибируются в присутствии антисмыслового соединения, нацеленного на SOD-1, включая модифицированный олигонуклеотид, нацеленный на SOD-1, по сравнению с экспрессией мРНК и/или уровнями белка SOD-1 в отсутствие антисмыслового соединения против SOD-1, такого как модифицированный олигонуклеотид.

«Ингибирование экспрессии или активности» означает снижение или блокаду экспрессии или активности и не обязательно говорит о полном прекращении экспрессии или активности.

«Межнуклеозидная связь» относится к химической связи между нуклеозидами.

«Связанные нуклеозиды» означают соседние нуклеозиды, связанные между собой межнуклеозидной связью.

«Несоответствие» или «некомплементарное азотистое основание» относится к случаю, когда азотистое основание первой нуклеиновой кислоты не способно связываться с соответствующим азотистым основанием второй или нуклеиновой кислоты-мишени.

«Смешанный остов» означает последовательность межнуклеозидных связей, содержащую по меньшей мере две различные межнуклеозидные связи. Например, олигонуклеотид со смешанным остовом может содержать по меньшей мере одну фосфодиэфирную связь и по меньшей мере одну тиофосфатную связь.

«Модифицированная межнуклеозидная связь» относится к замене или любому изменению природной межнуклеозидной связи (т.е. фосфодиэфирной межнуклеозидной связи).

«Модифицированное азотистое основание» означает любое азотистое основание, отличное от аденина, цитозина, гуанина, тимидина или урацила. «Немодифицированное азотистое основание» означает пуриновые основания: аденин (А) и гуанин (G), и пиримидиновые основания: тимин (Т), цитозин (С) и урацил (U).

«Модифицированный нуклеозид» означает нуклеозид, содержащий независимо модифицированный сахарный фрагмент и/или модифицированное азотистое основание.

«Модифицированный нуклеотид» означает нуклеотид, содержащий независимо модифицированный сахарный фрагмент, модифицированную межнуклеозидную связь и/или модифицированное азотистое основание.

«Модифицированный олигонуклеотид» обозначает олигонуклеотид, содержащий по меньшей мере одну модифицированную межнуклеозидную связь, модифицированный сахар и/или модифицированное азотистое основание.

«Модифицированный сахар» означает замещение и/или изменение любого из природных сахарных фрагментов.

«Мономер» означает одно звено олигомера. Мономеры включают, но не ограничиваются ими, нуклеозиды и нуклеотиды, природные или модифицированные.

«Мотив» означает конфигурацию из немодифицированных и модифицированных нуклеозидов в антисмысловом соединении.

«Природный сахарный фрагмент» означает фрагмент сахара, находящийся в ДНК (2'-Н) или РНК (2'-ОН).

«Природная межнуклеозидная связь» означает 3' к 5' фосфодиэфирную связь.

«Некомплементарное азотистое основание» относится к паре азотистых оснований нуклеиновых кислот, которые не образуют водородных связей друг с другом или иным образом не поддерживают гибридизацию.

«Нуклеиновая кислота» означает молекулы, состоящие из мономерных нуклеотидов. Нуклеиновая кислота включает, но не ограничивается ими, рибонуклеиновые кислоты (РНК), дезоксирибонуклеиновые кислоты (ДНК), одноцепочечные нуклеиновые кислоты, двуцепочечные нуклеиновые кислоты, малые интерферирующие рибонуклеиновые кислоты (миРНК) и микроРНК.

«Азотистое основание» означает гетероциклический фрагмент, способный спариваться с основанием другой нуклеиновой кислоты.

«Комплементарность азотистого основания» относится к азотистому основанию, способному к спариванию с другим основанием. Например, в ДНК аденин (А) комплементарен тимину (Т). Например, в РНК аденин (А) комплементарен урацилу (U). В некоторых вариантах реализации комплементарное азотистое основание относится к азотистому основанию антисмыслового соединения, способному спариваться с азотистым основанием своей нуклеиновой кислоты-мишени. Например, если азотистое основание в определенном положении антисмыслового соединения способно к водородному связыванию с азотистым основанием в определенном положении нуклеиновой кислоты-мишени, то это положение водородного связывания между олигонуклеотидом и нуклеиновой кислотой-мишенью считается комплементарным по этой паре азотистых оснований.

«Последовательность азотистых оснований» означает порядок последовательных азотистых оснований, независимый от любого сахара, связи и/или модификации азотистого основания.

«Нуклеозид» означает азотистое основание, связанное с сахаром.

«Миметик нуклеозида» включает структуры, используемые для замены сахара или сахара и основания и необязательно связи в одном или нескольких положениях олигомерного соединения, например, такие как миметики нуклеозидов, содержащие морфолино, циклогексенил, циклогексил, тетрагидропиранил, бицикло или трицикло сахара-миметики, например, нефуранозные сахарные звенья. Миметик нуклеотида включает структуры, используемые для замены нуклеозида и связи в одном или более положениях олигомерного соединения, такие как, например, пептидные нуклеиновые кислоты или морфолино (морфолино, связанные -N(H)-C(=O)-O- или другой не фосфодиэфирной связью). Заменитель сахара пересекается с более широким термином нуклеозид-миметик, но предназначен для обозначения замены только сахарной единицы (фуранозного кольца). Тетрагидропираниловые кольца, представленные в настоящем документе, иллюстрируют пример заменителя сахара, в котором сахарная фуранозная группа заменена тетрагидропираниловой кольцевой системой. «Миметик» относится к группам, которые заменяют сахар, азотистое основание и/или межнуклеозидную связь. Как правило, миметик используют вместо сахара или комбинации сахара с межнуклеозидной связью, а азотистое основание сохраняется для гибридизации с выбранной мишенью.

«Нуклеотид» означает нуклеозид, имеющий фосфатную группу, ковалентно связанную с сахарной частью нуклеозида.

«Нецелевой эффект» означает нежелательный или вредный биологический эффект, связанный с модуляцией экспрессии РНК или белка гена, отличного от нуклеиновой кислоты-мишени.

«Олигомерное соединение» или «олигомер» означает полимер из связанных мономерных субъединиц, которые способны к гибридизации с по меньшей мере областью молекулы нуклеиновой кислоты.

«Олигонуклеотид» означает полимер связанных нуклеозидов, каждый из которых может быть модифицированным или немодифицированным, независимо друг от друга.

«Парентеральное введение» означает введение путем инъекций (например, болюсная инъекция) или инфузии. Парентеральное введение включает подкожное введение, внутривенное введение, внутримышечное введение, внутриартериальное введение, внутрибрюшинное введение или внутричерепное введение, например, интратекальное или интрацеребровентрикулярное введение.

«Пептид» означает молекулу, образованную путем связывания по меньшей мере двух аминокислот посредством амидных связей. Без ограничений, в данном контексте пептид относится к полипептидам и белкам.

«Фармацевтический агент» означает вещество, которое обеспечивает терапевтический эффект при введении индивидууму. Например, в некоторых вариантах реализации модифицированный олигонуклеотид, направленный на SOD-1, представляет собой фармацевтический агент.

«Фармацевтическая композиция» означает смесь веществ, пригодных для введения субъекту. Например, фармацевтическая композиция может содержать модифицированный олигонуклеотид и стерильный водный раствор.

«Фармацевтически приемлемое производное» включает фармацевтически приемлемые соли, конъюгаты, пролекарства или изомеры соединений, описанных в настоящем документе.

«Фармацевтически приемлемые соли» обозначает физиологически и фармацевтически приемлемые соли антисмысловых соединений, т.е. соли, которые сохраняют желательную биологическую активность исходного олигонуклеотида и не вызывают нежелательных токсикологических эффектов.

«Тиофосфатная связь» означает связь между нуклеозидами, где фосфодиэфирные связи модифицированы путем замены одного из немостиковых атомов кислорода на атом серы. Тиофосфатная связь представляет собой модифицированную межнуклеозидную связь.

«Часть» означает определенное количество смежных (т.е. связанных) азотистых оснований нуклеиновой кислоты. В некоторых вариантах реализации часть представляет собой определенное число смежных азотистых оснований нуклеиновой кислоты-мишени. В некоторых вариантах реализации часть представляет собой определенное число смежных азотистых оснований антисмыслового соединения.

«Предупреждать» или «предупреждение» относится к задержке или предотвращению появления или развития заболевания, расстройства или патологического состояния в течение периода времени от нескольких минут до дней, недель или месяцев, или на неопределенный срок.

«Пролекарство» означает терапевтический агент, который получают в неактивной форме, которая преобразуется в активную форму (например, лекарство) в организме или его клетках под действием эндогенных ферментов или других химических веществ и/или условий.

«Профилактически эффективное количество» означает такое количество фармацевтического агента, которое обеспечивает профилактический или превентивный эффект для животного.

«Область» определяют как фрагмент нуклеиновой кислоты-мишени, имеющий по меньшей мере одну идентифицируемую структуру, функцию или характеристику.

«Рибонуклеотид» означает нуклеотид, имеющий гидрокси-группу в 2' положении сахарного фрагмента нуклеотида. Рибонуклеотиды могут быть модифицированы с помощью любого из множества заместителей.

«Соли» означает физиологически и фармацевтически приемлемые соли антисмысловых соединений, т.е. соли, которые сохраняют требуемую биологическую активность исходного олигонуклеотида и не вызывают нежелательных токсикологических эффектов.

«Сегменты» определяют как меньшие или субфрагменты областей в составе нуклеиновой кислоты-мишени.

«Укороченные» или «усеченные» версии олигонуклеотидов SOD-1 ght, описанные в настоящем документе, имеют один, два или более удаленных нуклеозидов.

«Побочные эффекты» означают отличающиеся от желаемых физиологические ответы, приписываемые лечению. В некоторых вариантах реализации побочные эффекты включают, без ограничения, реакции в месте инъекции, аномалии функциональных проб печени, отклонения в функциях почек, гепатотоксичность, нефротоксичность, аномалии центральной нервной системы и миопатии.

«Одноцепочечный олигонуклеотид» означает олигонуклеотид, который не гибридизирован с комплементарной цепью.

«Сайты» в данном контексте определяют как уникальные положения азотистых оснований в нуклеиновой кислоте-мишени.

«Замедляет прогрессирование» означает ослабление развития указанного заболевания.

«SOD-1» означает ген млекопитающего растворимой супероксиддисмутазы 1 (SOD-1), включая человеческий ген растворимой супероксиддисмутазы 1 (SOD-1).

«Связанное с SOD-1 заболевание» обозначает любое заболевание, связанное с любой нуклеиновой кислотой SOD-1 или продуктом ее экспрессии. Такие заболевания могут включать нейродегенеративное заболевание. Такие нейродегенеративные заболевания могут включать амиотрофический латеральный склероз (ALS).

«мРНК SOD-1» обозначает любой матричный РНК продукт экспрессии последовательности ДНК, кодирующей SOD-1.

«Нуклеиновая кислота SOD-1» обозначает любую нуклеиновую кислоту, кодирующую SOD-1. Например, в некоторых вариантах реализации изобретения нуклеиновая кислота SOD-1 включает последовательность ДНК, кодирующую SOD-1, последовательность РНК, транскрибированную из ДНК, кодирующей SOD-1 (в том числе, геномной ДНК, содержащей интроны и экзоны), и последовательность мРНК, кодирующую SOD-1. «мРНК SOD-1» обозначает мРНК, кодирующую белок SOD-1.

«Белок SOD-1» обозначает полипептидный продукт экспрессии нуклеиновой кислоты SOD-1.

«Специфично гибридизуется» обозначает антисмысловое соединение, обладающее достаточной степенью комплементарности между олигонуклеотидом и нуклеиновой кислотой-мишенью, чтобы вызывать желаемый эффект, минимально или никак не влияния на нецелевые нуклеиновые кислоты в условиях, в которых специфическое связывание является желательным, т.е., в физиологических условиях в случае анализов in vivo и терапевтического лечения.

«Строгие условия гибридизации» или «жесткие условия» означают условия, при которых олигомерное соединение гибридизуется со своей целевой последовательностью, но с минимальным количеством других последовательностей.

«Субъект» означает человека или животного, не являющегося человеком, выбранного для лечения или терапии.

«Сахарный химический мотив» означает характерный участок сахарных модификаций, содержащий по меньшей мере две различные сахарные модификации. Например, олигонуклеотид со смешанным остовом может содержать по меньшей мере один 2'-O-метоксиэтил-модифицированный нуклеозид и/или один cEt-модифицированный нуклеозид, и/или один 2'-дезоксинуклеозид.

«Целевой» относится к белку, модуляция которого является желательной.</g1>

«Ген-мишень» означает ген, кодирующий белок-мишень.

«Таргетинг» или «целевой» означает процесс конструирования и выбора антисмыслового соединения, которое будет специфически гибридизоваться с целевой нуклеиновой кислотой и вызывать желаемый эффект.

«Целевая нуклеиновая кислота», «целевая РНК,» и «целевой РНК транскрипт» и «нуклеиновые кислоты-мишени» означает нуклеиновую кислоту, способную стать мишенью для антисмысловых соединений.

«Область-мишень» означает фрагмент нуклеиновой кислоты-мишени, на который нацелено одно или более антисмысловых соединений.

«Сегмент-мишень» означает последовательность нуклеотидов нуклеиновой кислоты-мишени, на которую нацелено антисмысловое соединение. «5' Сайт-мишень» относится к 5'-крайнему нуклеотиду целевого сегмента. «3' Сайт-мишень» относится к 3'-крайнему нуклеотиду целевого сегмента.

«Терапевтически эффективное количество» означает количество фармацевтического агента, которое обеспечивает терапевтический эффект для индивидуума.

«Лечить» или «лечение», или «терапия» обозначает введение композиции с целью достижения изменения или облегчения заболевания или патологического состояния.

«Немодифицированные азотистые основания» означает пуриновые основания: аденин (А) и гуанин (G), и пиримидиновые основания: тимин (Т), цитозин (С), и урацил (U).

«Немодифицированный нуклеотид» означает нуклеотид, состоящий из природных азотистых оснований, сахарных фрагментов и межнуклеозидных связей. В некоторых вариантах реализации изобретения немодифицированный нуклеотид представляет собой РНК нуклеотид (т.е., β-D-рибонуклеозид) или ДНК нуклеотид (т.е., β-D-дезоксирибонуклеозид).

«Сегмент крыла» означает множество нуклеозидов, модифицированных для придания олигонуклеотиду свойств, таких как усиленная ингибирующая активность, повышенная аффинность связывания с нуклеиновой кислотой-мишенью или устойчивость к разложению нуклеазами in vivo.

Некоторые варианты реализации изобретения

Некоторые варианты реализации обеспечивают способы, соединения и композиции для ингибирования экспрессии мРНК и белка SOD-1. Некоторые варианты реализации обеспечивают способы, соединения и композиции для снижения уровней мРНК и белка SOD-1.

В некоторых вариантах реализации представлены антисмысловые соединения, направленные на нуклеиновую кислоту SOD-1. В некоторых вариантах реализации нуклеиновая кислота SOD-1 представляет собой последовательность с номером доступа GENBANK NM_000454.4 (включенную в настоящий документ как SEQ ID NO: 1), с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000 (включенную в настоящий документ как SEQ ID NO: 2), и комплемент номера доступа GENBANK NW_001114168.1, усеченный с нуклеотида с 2258000 по 2271000 (включенный в настоящий документ как SEQ ID NO: 3).

В некоторых вариантах реализации представлены способы лечения, предупреждения или облегчения заболеваний, расстройств или патологических состояний, связанных с SOD-1, у индивидуума, нуждающегося в этом. Также предусмотрены способы получения лекарственного средства для лечения, предупреждения или облегчения заболевания, расстройства или патологического состояния, связанного с SOD-1. Заболевания, расстройства и патологические состояния, связанные с SOD-1, включают нейродегенеративные заболевания. В некоторых вариантах реализации заболевания, связанные с SOD-1, включают амиотрофический латеральный склероз (ALS).

Вариант реализации 1. Соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность азотистых оснований, содержащую по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных оснований любой из последовательностей азотистых оснований SEQ ID NO: 118-1461.

Вариант реализации 2. Соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов и имеющий последовательность азотистых оснований, содержащую по меньшей мере 8, по меньшей мере 9, по меньшей мере 10, по меньшей мере 11, по меньшей мере 12, по меньшей мере 13, по меньшей мере 14, по меньшей мере 15, по меньшей мере 16, по меньшей мере 17, по меньшей мере 18, по меньшей мере 19 или по меньшей мере 20 последовательных азотистых оснований любой из последовательностей азотистых оснований SEQ ID NO: 15, 21, 23, 47, 54 и 67, при этом по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную связь.

Вариант реализации 3. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид имеет смешанный остов.

Вариант реализации 4. Соединение в соответствии с вариантом реализации 3, отличающееся тем, что смешанный мотив остова представляет собой любой из следующих:

и

, где

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 5. Соединение в соответствии с любым из предшествующих вариантов реализация, отличающееся тем, что модифицированный олигонуколеотид имеет любой из следующих сахарных химических мотивов:

и

, где

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

Вариант реализации 6. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что последовательность азотистых оснований модифицированного олигонуклеотида по меньшей мере на 80%, по меньшей мере на 81%, по меньшей мере на 82%, по меньшей мере на 83%, по меньшей мере на 84%, по меньшей мере на 85%, по меньшей мере на 86%, по меньшей мере на 87%, по меньшей мере на 88%, по меньшей мере на 89%, по меньшей мере на 90%, по меньшей мере на 91%, по меньшей мере на 92%, по меньшей мере на 93%, по меньшей мере на 94%, по меньшей мере на 95%, по меньшей мере на 96%, по меньшей мере на 97%, по меньшей мере на 98%, по меньшей мере на 99% или 100% комплементарна SEQ ID NO: 1 или SEQ ID NO: 2.

Вариант реализации 7. Соединение в соответствии с любым из предшествующих вариантов реализации, состоящее из одноцепочечного модифицированного олигонуклеотида.

Вариант реализации 8. Соединение в соответствии с любым из предшествующих вариантов реализация, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой межнуклеозидную связь.

Вариант реализации 9. Соединение в соответствии с вариантом реализации 8, отличающееся тем, что по меньшей мере одна модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

Вариант реализации 10. Соединение в соответствии с вариантом реализации 9, отличающееся тем, что каждая модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

Вариант реализации 11. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную межнуклеозидную связь.

Вариант реализации 12. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой тиофосфатную связь, и по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную связь.

Вариант реализации 13. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что по меньшей мере один нуклеозид содержит модифицированное азотистое основание.

Вариант реализации 14. Соединение в соответствии с вариантом реализации 13, отличающееся тем, что модифицированное азотистое основание представляет собой 5-метилцитозин.

Вариант реализации 15. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что по меньшей мере один нуклеозид модифицированного олигонуклеотида содержит модифицированный сахар.

Вариант реализации 16. Соединение в соответствии с вариантом реализации 15, отличающееся тем, что по меньшей мере один модифицированный сахар представляет собой бициклический сахар.

Вариант реализации 17. Соединение в соответствии с вариантом реализации 16, отличающееся тем, что бициклический сахар содержит химическую связь между 2' и 4' положением сахарного мостика 4'-CH2-N(R)-O-2', где R независимо представляет собой Н, С112 алкил или защитную группу.

Вариант реализации 18. Соединение в соответствии с вариантом реализации 17, отличающееся тем, что бициклический сахар содержит мостик 4'-CH2-N(R)-O-2', где R независимо представляет собой H, C1-C12 алкил или защитную группу.

Вариант реализации 19. Соединение в соответствии с вариантом реализации 15, отличающееся тем, что по меньшей мере один модифицированный сахар содержит 2'-O-метоксиэтильную группу.

Вариант реализации 20. Соединение в соответствии с вариантом реализации 15, отличающееся тем, что модифицированный сахар содержит группу 2'-O(CH2)2-OCH3.

Вариант реализации 21. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 10 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 5 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 22. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 9 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 5 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 23. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 5 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 24. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 4 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 25. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 5 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 7 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 26. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 8 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 6 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 6 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 27. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид содержит:

сегмент гэп, состоящий из 9 связанных дезоксинуклеозидов;

сегмент 5'-крыла, состоящий из 6 связанных нуклеозидов; и

сегмент 3'-крыла, состоящий из 5 связанных нуклеозидов;

причем сегмент гэп расположен между сегментом 5'-крыла и сегментом 3'-крыла и,

при этом каждый нуклеозид каждого сегмента крыла содержит модифицированный сахар.

Вариант реализации 28. Соединение в соответствии с любым из предшествующих вариантов реализации, отличающееся тем, что модифицированный олигонуклеотид состоит из 12, 13, 14, 15, 16, 17, 18, 19 или 20 связанных нуклеозидов.

Вариант реализации 29. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 30. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 31. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 32. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 33. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 34. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 35. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 36. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле:

Вариант реализации 37. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Те; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 38. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Tes Teo Aeo Aes Tds Gds Tds Tds Tds Ads Tds Ads Tds mCds Ako Gko Ges Aes Те; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 39. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo Aeo Тео Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 40. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo Aeo Тео Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь

Вариант реализации 41. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo Aeo Тео Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 42. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Aes Gko Тео Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 43. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Aes Gko Тео Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 44. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 45. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: mCes mCeo Geo Teo mCeo Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Ges mCes Ae, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 46. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: mCes mCeo Geo Teo mCes Gds mCds mCds mCds Tds Tds mCds Ads Ges mCeo Aeo mCeo Ges mCes Ae, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

Т = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 47. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: mCes mCeo Geo Тео mCes Gds mCds mCds mCds Tds Tds mCds Ads Gds mCds Aeo mCeo Geo mCes Ae, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 48. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Aes mCeo Aeo mCeo mCes Tds Tds mCds Ads mCds Tds Gds Gds Tds mCds mCeo Aeo Teo Tes Ae, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 49. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCeo Aes mCe, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

Т = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 50. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo mCeo Geo Aes Tes mCds mCds mCds Ads Ads Tds Tds Ads mCeo Aeo mCeo mCes Aes mCe, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 51. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo mCeo Geo Aes Tds mCds mCds mCds Ads Ads Tds Tds Aes mCeo Aeo mCeo mCes Aes mCe, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 52. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Geo mCeo Geo Aeo Tes mCds mCds mCds Ads Ads Tds Tds Ads mCds Aeo mCeo mCes Aes mCe, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 53. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Тео mCeo Geo mCes mCds mCds Tds Tds mCds Ads Gds mCds Ads mCds Geo mCeo Aeo mCes Ae, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 54. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Tes mCeo Geo mCeo mCes mCds Tds Tds mCds Ads Gds mCds Ads mCds Gds mCeo Aeo mCeo Aes mCe, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Вариант реализации 55. Соединение, состоящее из модифицированного олигонуклеотида согласно следующей формуле: Ges Aes Aes Aes Tes Tds Gds Ads Tds Gds Ads Tds Gds mCds mCds mCes Tes Ges mCes Ae, где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар, и

s = тиофосфатная межнуклеозидная связь.

Вариант реализации 56. Композиция, содержащая соединение в соответствии с любым из предшествующих вариантов реализации или его соль и по меньшей мере один фармацевтически приемлемый носитель или разбавитель.

Вариант реализации 57. Способ, включающий введение животному соединения или композиции в соответствии с любым из предшествующих вариантов реализации.

Вариант реализации 58. Способ в соответствии с вариантом реализации 57, отличающийся тем, что животное представляет собой человека.

Вариант реализации 59. Способ в соответствии с вариантом реализации 57, отличающийся тем, что введение соединения обеспечивает предупреждение, лечение, облегчение или замедление прогрессирования заболевания, связанного с SOD-1.

Вариант реализации 60. Способ в соответствии с вариантом реализации 59, отличающийся тем, что заболевание, связанное с SOD-1, представляет собой нейродегенеративное заболевание.

Вариант реализации 61. Способ в соответствии с вариантом реализации 60, отличающийся тем, что заболевание, связанное с SOD-1, представляет собой ALS.

Вариант реализации 62. Применение соединения или композиции в соответствии с любым из предшествующих вариантов реализации для изготовления лекарственного средства для лечения нейродегенеративного расстройства.

Вариант реализации 63. Применение соединения или композиции в соответствии с любым из предшествующих вариантов реализации для изготовления лекарственного средства для лечения ALS.

Вариант реализации 64. Соединение или композиция в соответствии с любым из предшествующих вариантов реализации, отличающиеся тем, что модифицированный олигонуклеотид не имеет последовательность азотистых оснований SEQ ID NO: 21.

Вариант реализации 65. Соединение или композиция в соответствии с любым из предшествующих вариантов реализации, отличающиеся тем, что модифицированный олигонуклеотид не имеет последовательность азотистых оснований любой из SEQ ID NO: 21-118.

Вариант реализации 66. Соединение, содержащее модифицированный олигонуклеотид, состоящий из 12-30 связанных нуклеозидов, и имеющий последовательность азотистых оснований, которая содержит часть из по меньшей мере 12 последовательных азотистых оснований, комплементарную равному количеству азотистых оснований нуклеотидов 665-684 SEQ ID NO: 1, при этом модифицированный олигонуклеотид по меньшей мере на 80% комплементарен SEQ ID NO: 1.

Вариант реализации 67. Соединение в соответствии с вариантом реализации 66, отличающееся тем, что модифицированный олигонуклеотид на 100% комплементарен SEQ ID NO: 1.

Вариант реализации 68. Соединение в соответствии с вариантом реализации 66, отличающееся тем, что модифицированный олигонуклеотид представляет собой одноцепочечный модифицированный олигонуклеотид.

Вариант реализации 69. Соединение в соответствии с вариантами реализации 66-68, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой модифицированную межнуклеозидную связь.

Вариант реализации 70. Соединение в соответствии с вариантом реализации 69, отличающееся тем, что по меньшей мере одна модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

Вариант реализации 71. Соединение в соответствии с вариантом реализации 70, отличающееся тем, что каждая модифицированная межнуклеозидная связь представляет собой тиофосфатную межнуклеозидную связь.

Вариант реализации 72. Соединение в соответствии с вариантами реализации 66-69, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную межнуклеозидную связь.

Вариант реализации 73. Соединение в соответствии с вариантами реализации 66-71 и 72-73, отличающееся тем, что по меньшей мере одна межнуклеозидная связь представляет собой тиофосфатную связь, и по меньшей мере одна межнуклеозидная связь представляет собой фосфодиэфирную связь.

Вариант реализации 74. Соединение в соответствии с вариантами реализации 66-73, отличающееся тем, что по меньшей мере один нуклеозид содержит модифицированное азотистое основание.

Вариант реализации 75. Соединение в соответствии с вариантом реализации 74, отличающееся тем, что модифицированное азотистое основание представляет собой 5-метилцитозин.

Вариант реализации 76. Соединение в соответствии с вариантами реализации 66-75, отличающееся тем, что по меньшей мере один нуклеозид модифицированного олигонуклеотида содержит модифицированный сахар.

Вариант реализации 77. Соединение в соответствии с вариантом реализации 76, отличающееся тем, что по меньшей мере один модифицированный сахар представляет собой бициклический сахар.

Вариант реализации 78. Соединение в соответствии с вариантом реализации 77, отличающееся тем, что бициклический сахар содержит мостик 4'-CH(R)-O-2', где R независимо представляет собой Н, С112 алкил или защитную группу.

Вариант реализации 79. Соединение в соответствии с вариантом реализации 78, отличающееся тем, что R представляет собой метил.

Вариант реализации 80. Соединение в соответствии с вариантом реализации 78, отличающееся тем, что R представляет собой Н.

Вариант реализации 81. Соединение в соответствии с вариантом реализации 76, отличающееся тем, что по меньшей мере один модифицированный сахар содержит 2'-O-метоксиэтильную группу.

Антисмысловые соединения

Олигомерные соединения включают, но не ограничиваются ими, олигонуклеотиды, олигонуклеозиды, аналоги олигонуклеотидов, миметики олигонуклеотидов, антисмысловые соединения, антисмысловые олигонуклеотиды, модифицированные олигонуклеотиды и миРНК. Олигомерное соединение может быть «антисмысловым» к нуклеиновой кислоте-мишени, что означает, что оно способно подвергаться гибридизации с нуклеиновой кислотой-мишенью посредством водородного связывания.

В некоторых вариантах реализации антисмысловое соединение содержит последовательность азотистых оснований, которая при написании в 5'-3' направлении содержит обратный комплемент целевого сегмента нуклеиновой кислоты-мишени, на которую она направлена. В некоторых таких вариантах реализации олигонуклеотид имеет последовательность азотистых оснований, которая при написании в 5'-3' направлении содержит обратный комплемент целевого сегмента нуклеиновой кислоты-мишени, на которую она направлена.

В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 12-30 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 12-25 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 12-22 субъединицы. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 14-20 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 15-25 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 18-22 субъединицы. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 19-21 субъединицу. В некоторых вариантах реализации антисмысловое соединение имеет от 8 до 80, от 12 до 50, от 13 до 30, от 13 до 50, от 14 до 30, от 14 до 50, от 15 до 30, от 15 до 50, от 16 до 30, от 16 до 50, от 17 до 30, от 17 до 50, от 18 до 30, от 18 до 50, от 19 до 30, от 19 до 50 или от 20 до 30 связанных субъединиц в длину.

В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 12 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 13 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 14 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 15 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 16 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 17 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 18 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 19 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 20 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 21 субъединицу. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 22 субъединицы. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 23 субъединицы. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 24 субъединицы. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 25 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 26 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 27 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 28 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 29 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 30 субъединиц. В некоторых вариантах реализации изобретения длина антисмыслового соединения, нацеленного на нуклеиновую кислоту SOD-1, составляет 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 или 80 связанных субъединиц или находится в диапазоне, определенном любыми двумя из упомянутых выше значений. В некоторых вариантах реализации антисмысловое соединение представляет собой модифицированный олигонуклеотид, и связанными субъединицами являются нуклеозиды.

В некоторых вариантах реализации изобретения олигонуклеотиды, нацеленные на нуклеиновую кислоту SOD-1, могут быть укороченными или усеченными. Например, одна субъединица может быть удалена с 5' конца (5' усечение), или же с 3' конца (3' усечение). В укороченном или усеченном антисмысловом соединении, нацеленном на нуклеиновую кислоту SOD-1, две субъединицы могут быть удалены на 5' конце или, в качестве альтернативы, две субъединицы могут быть удалены на 3' конце антисмыслового соединения. В альтернативном варианте удаленные нуклеозиды могут быть рассеяны по всему антисмысловому соединению, например, в антисмысловом соединении с одним нуклеозидом, удаленным с 5' конца, и одним нуклеозидом, удаленным с 3' конца.

Если в удлиненном антисмысловом соединении присутствует одна дополнительная субъединица, то дополнительная субъединица может быть расположена на 5' или 3' конце антисмыслового соединения. При наличии двух или более дополнительных субъединиц, добавленные субъединицы могут быть расположены рядом друг с другом, например, в антисмысловом соединении, имеющем две субъединицы, добавленные на 5' конце (5' присоединение) или, в альтернативном варианте, на 3' конце (3' присоединение). В альтернативном варианте присоединенные субъединицы могут быть рассеяны по всему антисмысловому соединению, например, в антисмысловом соединении, имеющем одну субъединицу, присоединенную к 5' концу, и одну субъединицу, присоединенную к 3' концу.

Длина антисмыслового соединения, такого как модифицированный олигонуклеотид, может быть увеличена или уменьшена, и/или могут быть введены некомплементарные основания без аннулирования активности. Например, в Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) описан ряд олигонуклеотидов длиной 13-25 азотистых оснований, которые были испытаны на их способность индуцировать расщепление целевой РНК в модели инъекции в ооцит. Олигонуклеотиды длиной 25 азотистых оснований с 8 или 11 некомплементарными основаниями вблизи концов олигонуклеотидов были способны управлять прямым расщеплением целевой мРНК, хотя и в меньшей степени, чем олигонуклеотиды, которые не содержали никаких несоответствий. Аналогичным образом целевое специфическое расщепление было достигнуто с применением олигонуклеотидов из 13 азотистых оснований, включая такие, что имели 1 или 3 несоответствия.

Gautschi et al (J. Natl. Natl. Cancer Inst. 93:463-471, March 2001) продемонстрировали способность олигонуклеотида, обладающего 100% комплементарностью мРНК bcl-2 и содержащего 3 рассогласованных основания по отношению к мРНК bcl-xL, уменьшать экспрессию как bcl-2, так и bcl-xL in vitro и in vivo. Кроме того, данный олигонуклеотид продемонстрировал высокую противоопухолевую активность in vivo.

Maher и Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) провели испытания серии тандемов олигонуклеотидов из 14 азотистых оснований и олигонуклеотидов из 28 и 42 азотистых оснований, состоящих из последовательности двух или трех тандемов олигонуклеотидов, соответственно, на их способность к блокированию трансляции ДГФР человека в анализе на ретикулоцитах кролика. Каждый из трех олигонуклеотидов из 14 азотистых оснований в одиночку был способен ингибировать трансляцию, хотя и на более низком уровне, чем олигонуклеотиды из 28 или 42 азотистых оснований.

Мотивы антисмысловых соединений

В некоторых вариантах реализации изобретения антисмысловые соединения, нацеленные на нуклеиновую кислоту SOD-1, содержат химически модифицированные субъединицы, организованные в паттерны или мотивы, для придания антисмысловым соединениям таких свойств, как например усиленная ингибирующая активность, повышенная аффинность связывания с нуклеиновой кислотой-мишенью или сопротивление разложению нуклеазами in vivo.

Химерные антисмысловые соединения обычно содержат по меньшей мере одну область, модифицированную таким образом, чтобы придать повышенную устойчивость к разложению под действием нуклеаз, усиление клеточного поглощения, повышенную аффинность связывания с целевой нуклеиновой кислотой, и/или повышенную ингибирующую активность. Второй химерный участок антисмыслового соединения может дополнительно служить в качестве субстрата для клеточной эндонуклеазы РНКазы Н, которая отщепляет нить РНК в РНК : ДНК-дуплексе.

Антисмысловые соединения, имеющие гэпмерный мотив, представляют собой химерные антисмысловые соединения. В гэпмере внутренняя область, имеющая множество нуклеотидов, которые поддерживают расщепление РНКазой Н, расположена между внешними областями, имеющими множество нуклеотидов, химически отличающихся от нуклеозидов внутренней области. В случае олигонуклеотида, имеющего гэпмерный мотив, сегмент гэп, как правило, служит в качестве субстрата для расщепления эндонуклеазой, в то время как сегменты крыльев содержат модифицированные нуклеозиды. В некоторых вариантах реализации указанные области гэпмера различаются по типам сахарных фрагментов в составе каждой отдельной области. Типы сахарных фрагментов, которые используют для дифференциации областей гэпмера, в некоторых вариантах реализации включают β-D-рибонуклеозиды, β-D-дезоксирибонуклеозиды, 2'-модифицированные нуклеозиды (такие 2'-модифицированные нуклеозиды могут включать, среди прочего, 2'-МОЕ и 2'-O-CH3) и модифицированные бициклическими сахарами нуклеозиды (такие модифицированные бициклическими сахарами нуклеозиды могут включать те, которые имеют мостик 4'-(CH2)n-O-2', где n=1 или n=2, и 4'-CH2-O-CH2-2'). В некоторых вариантах реализации крылья могут содержат несколько модифицированных сахарных фрагментов, включая, например, 2'-МОЕ. В некоторых вариантах реализации крылья могут содержать несколько модифицированных и немодифицированных сахарных фрагментов. В некоторых вариантах реализации крылья могут содержать различные комбинации 2'-МОЕ нуклеозидов и 2'-дезоксинуклеозидов.

Каждая отдельная область может содержать одинаковые сахарные фрагменты, различные или чередующиеся сахарные фрагменты. Мотив крыло-гэп-крыло часто описывают как «Х-Y-Z», где «X» обозначает длину 5' крыла, «Y» обозначает длину гэпа, a «Z» обозначает длину 3' крыла. «X» и «Z» могут содержать одинаковые, различные или чередующиеся сахарные фрагменты. В некоторых вариантах реализации «X» и «У»могут содержать один или более 2'-дезоксинуклеозида. «Y» может содержать 2'-дезоксинуклеозиды. В данном контексте гэпмер, описанный как «Х-Y-Z», имеет такую конфигурацию, что гэп расположен непосредственно возле каждого из 5' крыла и 3' крыла. Таким образом, между 5' крылом и гэп или гэп и 3' крылом нет промежуточных нуклеотидов. Любое из антисмысловых соединений, описанных в настоящем документе, может иметь гэпмерный мотив. В некоторых вариантах реализации «X» и «Z» являются одинаковыми; в других вариантах реализации они различны.

В некоторых вариантах реализации гэпмер, описанный в настоящем документе, содержит, например 20 оснований, имея 5-10-5 мотив.

В некоторых вариантах реализации гэпмеры, описанные в настоящем документе, содержат, например, 19-меры, имеющие мотив 5-9-5.

В некоторых вариантах реализации гэпмеры, описанные в настоящем документе, содержат, например, 18-меры, имеющие мотив 5-8-5.

В некоторых вариантах реализации гэпмеры, описанные в настоящем документе, содержат, например, 18-меры, имеющие мотив 4-8-5.

В некоторых вариантах реализации гэпмеры, описанные в настоящем документе, содержат, например, 18-меры, имеющие мотив 5-8-7.

В некоторых вариантах реализации гэпмеры, описанные в настоящем документе, содержат, например, 18-меры, имеющие мотив 6-8-6.

В некоторых вариантах реализации гэпмеры, описанные в настоящем документе, содержат, например, 18-меры, имеющие мотив 6-8-5.

В некоторых вариантах реализации модифицированный олигонуклеотид содержит по меньшей мере один 2'-O-метоксиэтил-модифицированный нуклеозид и по меньшей мере один cEt-модифицированный нуклеозид, и по меньшей мере один 2'-дезоксинуклеозид. В некоторых вариантах реализации модифицированный олигонуклеотид имеет любой из следующих сахарных химических мотивов:

, где

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

Нуклеиновые кислоты-мишени, области-мишени и нуклеотидные последовательности

Нуклеотидные последовательности, которые кодируют SOD-1, включают, без ограничения, следующие: с номером доступа GENBANK NM_000454.4 (включенную в настоящий документ как SEQ ID NO: 1), с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000 (включенную в настоящий документ как SEQ ID NO: 2), и комплемент номера доступа GENBANK NW_001114168.1, усеченный с нуклеотида с 2258000 по 2271000 (включенный в настоящий документ как SEQ ID NO: 3).

Понятно, что последовательность, изложенная в каждом SEQ ID NO в примерах, содержащихся в настоящем документе, является независимой от любой модификации сахарного фрагмента, межнуклеозидной связи или азотистого основания. Следовательно, антисмысловое соединение, определяемое по SEQ ID NO, может независимо содержать одну или более модификации сахарного фрагмента, межнуклеозидной связи или азотистого основания. Антисмысловые соединения, описанные по номеру Isis (Isis №) указывают сочетание последовательности азотистых оснований и мотива.

В некоторых вариантах реализации целевая область представляет собой структурно определенную область нуклеиновой кислоты-мишени. Например, целевая область может охватывать 3' UTR, 5' UTR, экзон, интрон, экзон/интронное сочленение, кодирующую область, область инициации трансляции, область терминации трансляции или другими определенные области нуклеиновой кислоты. Структурно определенные области для SOD-1 могут быть получены по номеру доступа из баз данных последовательностей, таких как NCBI, и такая информация включена в данное описание посредством ссылки. В некоторых вариантах реализации целевая область может охватывать последовательность от 5' сайта-мишени одного целевого сегмента в пределах области-мишени до 3' сайта-мишени другого целевого сегмента в пределах той же области-мишени.

Таргетирование включает в себя определение по меньшей мере одного целевого сегмента, с которым гибридизируется антисмысловое соединение, например, для достижения желаемого эффекта. В некоторых вариантах реализации желаемый эффект представляет собой снижение уровней мРНК нуклеиновой кислоты-мишени. В некоторых вариантах реализации желаемый эффект представляет собой снижение уровней белка, кодируемого нуклеиновой кислотой-мишенью, или фенотипическое изменение, связанное с нуклеиновой кислотой-мишенью.

Область-мишень может содержать один или более целевых сегментов. Несколько целевых сегментов в области-мишени могут быть перекрывающимися. Альтернативно, они могут быть не перекрывающимися. В некоторых вариантах реализации целевые сегменты в пределах области-мишени разделены не более чем около 300 нуклеотидами. В некоторых вариантах реализации целевые сегменты в пределах области-мишени разделены числом нуклеотидов, равным, равным около, не более чем, не более чем около 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 или 10 нуклеотидами в нуклеиновой кислоте-мишени, или находится в пределах, определяемых любыми двумя из предшествующих значений. В некоторых вариантах реализации целевые сегменты в пределах области-мишени разделены не более чем, или не более чем около 5 нуклеотидами в нуклеиновой кислоте-мишени. В некоторых вариантах реализации целевые сегменты непрерывны. Предусмотрены области-мишени, определенные диапазоном, имеющим стартовую нуклеиновую кислоту, которая представляет собой любую из 5' сайта-мишени или 3' сайта-мишени, перечисленных в настоящем документе.

Подходящие целевые сегменты могут быть расположены в 5' UTR, кодирующем участке, в 3' UTR, интроне, экзоне или в экзон/интронном сочленении. Целевые сегменты, содержащие стартовый кодон или стоп-кодон, также представляют собой подходящие целевые сегменты. Подходящий целевой сегмент может специфически исключать некоторые структурно определенные области, такие как стартовый кодон или стоп-кодон.

Определение подходящих целевых сегментов может включать в себя сравнение последовательности нуклеиновой кислоты-мишени с другими последовательностями по всему геному. Например, для идентификации областей подобия среди различных нуклеиновых кислот может быть использован алгоритм BLAST. Это сравнение может предотвратить выбор последовательностей антисмыслового соединения, которые гибридизуются неспецифическим образом с последовательностями, отличными от выбранной нуклеиновой кислоты-мишени (например, нецелевые или побочные последовательности).

Могут быть вариации в активности (например, определенной по процентному снижению уровней нуклеиновой кислоты-мишени) антисмысловых соединений внутри активной целевой области. В некоторых вариантах реализации изобретения снижение уровней мРНК SOD-1 является индикатором ингибирования экспрессии SOD-1. Снижение уровней белка SOD-1 также указывает на подавление экспрессии мРНК-мишени. Фенотипические изменения указывают на подавление экспрессии SOD-1. Улучшение неврологических функций свидетельствует об ингибировании экспрессии SOD-1. Улучшение двигательной функции является показателем ингибирования экспрессии SOD-1.

Гибридизация

В некоторых вариантах реализации гибридизация происходит между антисмысловым соединением, раскрытым в данном описании, и нуклеиновой кислотой SOD-1. Наиболее распространенный механизм гибридизации включает водородное связывание (например, уотсон-криковское, хугстиновское или обратное хугстиновское водородное связывание) между комплементарными азотистыми основаниями молекул нуклеиновых кислот.

Гибридизация может происходить в различных условиях. Жесткие условия являются последовательность-зависимыми и определяются природой и составом гибридизуемых молекул нуклеиновых кислот.

Способ определения того, является ли последовательность специфически гибридизуемой с целевой нуклеиновой кислотой, хорошо известны в данной области техники. В некоторых вариантах реализации антисмысловые соединения, представленные в настоящем документе, являются специфически гибридизуемыми с нуклеиновой кислотой SOD-1.

Комплементарностъ

Антисмысловое соединение и нуклеиновая кислота-мишень комплементарны друг другу, если достаточное количество азотистых оснований антисмыслового соединения может образовывать водородную связь с соответствующими азотистыми основаниями нуклеиновой кислоты-мишени, таким образом, что будет достигаться желательный эффект (например, антисмысловое ингибирование нуклеиновой кислоты-мишени, такой как нуклеиновая кислота SOD-1).

Некомплементарные азотистые основания между антисмысловым соединением и нуклеиновой кислотой SOD-1 могут быть допустимыми при условии, что антисмысловое соединение сохраняет способность специфично гибридизоваться с нуклеиновой кислотой-мишенью. Кроме того, антисмысловое соединение может гибридизоваться с одним или несколькими сегментами нуклеиновой кислоты SOD-1 таким образом, что промежуточные или смежные сегменты не участвуют в гибридизации (например, петлевая структура, рассогласование или структура шпильки).

В некоторых вариантах реализации антисмысловые соединения, представленные в настоящем изобретении, или определенные их части, являются или по меньшей мере на 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, или 100% комплементарны нуклеиновой кислоте SOD-1, области-мишени, сегменту-мишени или определенной ее части. Процент комплементарности антисмыслового соединения с целевой нуклеиновой кислотой может быть определен с использованием стандартных методов.

Например, антисмысловое соединение, в котором 18 из 20 азотистых оснований антисмыслового соединения являются комплементарными к области-мишени, и поэтому будут специфически гибридизоваться, имеет 90 процентов комплементарности. В данном примере оставшиеся некомплементарные азотистые основания могут быть расположены кластерно или вперемешку с комплементарных азотистыми основаниями и не обязаны быть смежными друг с другом или комплементарными азотистыми основаниям. Таким образом, антисмысловое соединение, длина которого составляет 18 азотистых оснований, содержащее 4 (четыре) некомплементарных азотистых основания, фланкированных двумя областями полной комплементарности с нуклеиновой кислотой-мишенью, обладает общей комплементарностью с нуклеиновой кислотой-мишенью 77,8%, и таким образом, входит в границы объема настоящего изобретения. Процент комплементарности антисмыслового соединения с областью нуклеиновой кислоты-мишени может быть определен с помощью программ BLAST (основное средство поиска локального выравнивания) и программ PowerBLAST, известных в данной области техники (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang и Madden, Genome Res., 1997, 7, 649 656). Процент гомологии, идентичность или комплементарность последовательностей, могут быть определены, например, программой Gap (висконсинский пакет анализа последовательностей, версия 8 для Unix, Genetics Computer Group, Висконсинский Университет, Мэдисон, штат Висконсин), с использованием настроек по умолчанию, которые используют алгоритм Смита и Ватермана (Adv. Appl. Math., 1981, 2, 482 489).

В некоторых вариантах реализации антисмысловые соединения, предложенные в настоящем документе, или их определенные части полностью комплементарны (т.е. на 100% комплементарны) нуклеиновой кислоте-мишени или ее определенной части. Например, антисмысловое соединение может быть полностью комплементарно нуклеиновой кислоте SOD-1 или ее области-мишени, или ее сегменту-мишени, или ее последовательности-мишени. В данном контексте «полностью комплементарный» означает, что каждое азотистое основание антисмыслового соединения способно точно спариваться с соответствующими азотистыми основаниями нуклеиновой кислоты-мишени. Например, антисмысловое соединение из 20 азотистых оснований полностью комплементарно целевой последовательности, которая имеет 400 азотистых оснований в длину, при условии, что существует соответствующая часть целевой нуклеиновой кислоты из 20 азотистых оснований, которая полностью комплементарна указанному антисмысловому соединению. Полностью комплементарный может также использоваться в отношении определенного фрагмента первой и/или второй нуклеиновой кислоты. Например, фрагмент из 20 азотистых оснований антисмыслового соединения, состоящего из 30 азотистых оснований, может быть «полностью комплементарным» последовательности-мишени, которая имеет 400 азотистых оснований в длину. Фрагмент из 20 азотистых оснований олигонуклеотида, состоящего из 30 азотистых оснований, полностью комплементарен целевой последовательности, если целевая последовательность имеет соответствующий фрагмент из 20 азотистых оснований, при этом каждое его азотистое основание комплементарно фрагменту из 20 азотистых оснований антисмыслового соединения. В то же время, все антисмысловое соединение из 30 азотистых оснований может быть или не быть полностью комплементарным целевой последовательности в зависимости от того, будут ли остальные 10 азотистых оснований антисмыслового соединения также комплементарны целевой последовательности.

Некомплементарное азотистое основание может располагаться на 5' конце или 3' конце антисмыслового соединения. В альтернативном варианте некомплементарное азотистое основание или азотистые основания могут быть внутри антисмыслового соединения. При наличии двух или более некомплементарных азотистых оснований, они могут быть смежными (т.е. связанными) или не смежными. В одном варианте реализации некомплементарное азотистое основание расположено в сегменте крыла гэпмера олигонуклеотида.

В некоторых вариантах реализации антисмысловые соединения, которые содержат точно или до 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 азотистых оснований в длину, содержат не более 4, не более 3, не более 2 или не более 1 некомплементарного азотистого основания(-ий) относительно нуклеиновой кислоты-мишени, такой как нуклеиновая кислота SOD-1, или ее определенной части.

В некоторых вариантах реализации антисмысловые соединения, которые содержат точно или до 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 азотистых оснований в длину, содержат не более 6, не более 5, не более 4, не более 3, не более 2 или не более 1 некомплементарного азотистого основания(-ий) относительно нуклеиновой кислоты-мишени, такой как нуклеиновая кислота SOD-1, или ее определенной части.

Антисмысловые соединения, представленные в настоящем документе, включают также те, которые являются комплементарными части целевой нуклеиновой кислоты. В данном контексте «часть» относится к определенному количеству смежных (т.е. связанных) азотистых оснований в пределах области или сегмента нуклеиновой кислоты-мишени. «Часть» также может относиться к определенному количеству смежных азотистых оснований антисмыслового соединения. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 8 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 9 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 10 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 11 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 12 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 13 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 14 азотистых оснований. В некоторых вариантах реализации антисмысловые соединения комплементарны части целевого сегмента из по меньшей мере 15 азотистых оснований. Также предусмотрены антисмысловые соединения, которые являются комплементарными части из по меньшей мере 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 или более азотистых оснований целевого сегмента, или диапазон, определяемый любыми двумя из указанных значений.

Идентичность

Антисмысловые соединения, представленные в настоящем документе, также могут иметь определенный процент идентичности конкретной нуклеотидной последовательности, SEQ ID NO, или соединению, представленному конкретным номером Isis, или его части. В данном контексте антисмысловое соединение идентично последовательности, описанной в настоящем документе, если оно имеет такую же способность к спариванию азотистых оснований. Например, РНК, которая содержит урацил вместо тимидина в описанной последовательности ДНК, считают идентичной последовательности ДНК, поскольку и урацил, и тимидин спариваются с аденином. Предусмотрены также укороченные и удлиненные варианты антисмысловых соединений, описанных в настоящем документе, а также соединений, обладающих неидентичными основаниями по отношению к антисмысловым соединениям, предложенным в настоящем документе. Неидентичные основания могут быть смежными друг с другом или рассеянными по всему антисмысловому соединению. Процент идентичности антисмыслового соединения рассчитывают по количеству оснований, которые имеют идентичное спаривание оснований, относительно последовательности, с которой идет сравнение.

В некоторых вариантах реализации антисмысловые соединения или их части по меньшей мере на 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% или 100% идентичны одному или более антисмысловым соединениям из SEQ ID NO, или их части, как описано в настоящем документе.

В некоторых вариантах реализации фрагмент антисмыслового соединения сравнивают с равной по длине части нуклеиновой кислоты-мишени. В некоторых вариантах реализации сравнивают часть из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 азотистых оснований с равной по длине частью нуклеиновой кислоты-мишени.

В некоторых вариантах реализации часть олигонуклеотида сравнивают с равной по длине частью нуклеиновой кислоты-мишени. В некоторых вариантах реализации сравнивают часть из 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 или 25 азотистых оснований с равной по длине частью нуклеиновой кислоты-мишени.

Модификации

Нуклеозид представляет собой комбинацию азотистое основание-сахар. Азотистое основание (также известное как основание) - часть нуклеозида, обычно представляющая собой фрагмент гетероциклического основания. Нуклеотиды представляют собой нуклеозиды, которые дополнительно содержат фосфатную группу, ковалентно связанную с сахарной частью нуклеозида. Для тех нуклеозидов, которые содержат пентофуранозильный сахар, фосфатная группа может быть связана с 2', 3' или 5' гидроксильным фрагментом сахара. Олигонуклеотиды образуются посредством ковалентного связывания соседних нуклеозидов друг с другом с образованием линейного полимерного олигонуклеотида. В олигонуклеотидной структуре фосфатные группы обычно называют как образующие межнуклеозидные связи олигонуклеотида.

Модификации антисмысловых соединений охватывают замещения или изменения межнуклеозидных связей, сахарных фрагментов или азотистых оснований. Модифицированные антисмысловые соединения зачастую предпочтительны по сравнению с нативными формами за счет желаемых свойств, таких как, например, улучшенное клеточное поглощение, повышенная аффинность связывания с нуклеиновой кислотой-мишенью, повышенная стабильность в присутствии нуклеаз или повышенная ингибирующая активность.

Химически модифицированные нуклеозиды также могут быть использованы для повышения аффинности связывания укороченного или усеченного олигонуклеотида с его нуклеиновой кислотой-мишенью. Следовательно, сопоставимые результаты часто могут быть получены с помощью более коротких антисмысловых соединений, которые имеют такие химически модифицированные нуклеозиды.

Модифицированные межнуклеозидные связи

Природная межнуклеозидная связь РНК и ДНК представляет собой 3'-5' фосфодиэфирную связь. Часто выбор делается в пользу антисмысловых соединений, содержащих одну или более модифицированных, т.е., не встречающихся в природе межнуклеозидных связей, по сравнению с антисмысловыми соединениями, содержащими природные межнуклеозидные связи, из-за желательных свойств, например, таких как увеличение захвата клеткой, повышенная аффинность к нуклеиновым кислотам-мишеням и повышенная устойчивость в присутствии нуклеаз.

Олигонуклеотиды, имеющие модифицированные межнуклеозидные связи, включают межнуклеозидные связи, которые сохраняют атом фосфора, а также межнуклеозидные связи, которые не имеют атома фосфора. Иллюстративные фосфорсодержащие межнуклеозидные связи включают, но не ограничиваются ими, фосфодиэфиры, фосфотриэфиры, метилфосфонаты, фосфорамидаты и тиофосфаты. Способы получения фосфорсодержащих и не содержащих фосфор связей хорошо известны.

В некоторых вариантах реализации модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту SOD-1, содержат одну или более модифицированных межнуклеозидных связей. В некоторых вариантах реализации модифицированные межнуклеозидные связи рассеяны по всему антисмысловому соединению. В некоторых вариантах реализации модифицированные межнуклеозидные связи представляют собой тиофосфатные связи. В некоторых вариантах реализации каждая межнуклеозидная связь в модифицированном олигонуклеотиде представляет собой тиофосфатную межнуклеозидную связь.

В некоторых вариантах реализации модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту SOD-1, содержат одну или более фосфодиэфирных межнуклеозидных связей. В некоторых вариантах реализации модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту SOD-1, содержат по меньшей мере одну тиофосфатную межнуклеозидную связь и по меньшей мере одну фосфодиэфирную межнуклеозидную связь. В некоторых вариантах реализации модифицированный олигонуклеотид имеет смешанный мотив остова из следующих:

и

, где

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

Модифицированные сахарные фрагменты

Антисмысловые соединения могут необязательно содержать один или более нуклеозидов, в которых модифицирована сахарная группа. Такие нуклеозиды с модифицированным сахаром могут придавать антисмысловым соединениями повышенную устойчивость к нуклеазам, повышенную аффинность связывания или некоторые другие полезные биологические свойства. В некоторых вариантах реализации нуклеозиды содержат химически модифицированные фрагменты рибофуранозного кольца. Примеры химически модифицированных рибофуранозных колец включают, без ограничения, введение групп заместителей (включая 5' и 2' группы заместителей, соединение мостиком негеминальных кольцевых атомов с образованием бициклических нуклеиновых кислот (БНК), замену атома кислорода в рибозильном кольце на S, N(R) или C(R1)(R2) (R, R1 и R2, каждый независимо, представляют собой Н, С112 алкил или защитную группу) и их комбинации. Примеры химически модифицированных Сахаров включают 2'-F-5'-метил-замещенный нуклеозид (см. международную заявку РСТ WO 2008/101157, опубликованную 8/21/08, где представлены другие описанные 5',2'-бис-замещенные нуклеозиды) или замену атома кислорода рибозильного кольца на S с дополнительным замещением в 2'-положении (см. опубликованную заявку на патент США US 2005-0130923, опубликованную 16 июня 2005 года), или в альтернативном варианте с 5'-замещением БНК (см. международную заявку РСТ WO 2007/134181, опубликованную 11/22/07, где ЗНК замещена, например, 5'-метильной или 5'-винильной группой).

Примеры нуклеозидов, имеющих модифицированные сахарные фрагменты, включают, без ограничения, нуклеозиды, содержащие 5'-винильные, 5'-метильные (R или S), 4'-S, 2'-F, 2'-OCH3, 2'-ОСН2СН3, 2'-OCH2CH2F и 2'-O(CH2)2OCH3 группы заместителей. Заместитель в 2' положении также может быть выбран из аллила, амино, азидо, тио, O-аллила, O-C110 алкила, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-O-N(Rm)(Rn), O-CH2-C(=O)-N(Rm)(Rn) и O-CH2-C(=O)-N(R1)-(CH2)2-N(Rm)(Rn), где каждый R1, Rm и Rn независимо представляет собой Н или замещенный или незамещенный C1-C10 алкил.

В данном контексте «бициклические нуклеозиды» относятся к модифицированным нуклеозидам, содержащим бициклический сахарный фрагмент. Примеры бициклических нуклеиновых кислот (БНК) включают, без ограничения, нуклеозиды, содержащие мостик между 4' и 2' атомами рибозильного кольца. В некоторых вариантах реализации антисмысловые соединения, предложенные в настоящем документе, содержат один или более БНК нуклеозидов, при этом мостик содержит одну из формул: 4'-(СН2)-O-2' (ЗНК); 4'-(CH2)-S-2'; 4'-(СН2)2-O-2' (ЭНК); 4'-СН(СН3)-O-2' и 4'-СН(СН2ОСН3)-O-2' (и их аналоги, см. патент США 7399845, выданный 15 июля 2008 года); 4'-C(CH3)(СН3)-O-2' (и их аналоги, см. PCT/US 2008/068922, опубликованную как WO 2009/006478 8 января 2009 года); 4'-CH2-N(OCH3)-2' (и их аналоги, см. PCT/US 2008/064591, опубликованную как WO/2008/150729 11 декабря 2008 года); 4'-CH2-O-N(CH3)-2' (см. опубликованную заявку на патент США US 2004-0171570, опубликованную 2 сентября 2004 года); 4'-CH2-N(R)-O-2', где R представляет собой Н, С112 алкил или защитную группу (см. патент США 7427672, выданный 23 сентября 2008 года); 4'-СН2-С(Н)(СН3)-2' (см. Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); и 4'-CH2-С(=СН2)-2' (и их аналоги, см. PCT/US 2008/066154, опубликованную как WO 2008/154401 8 декабря 2008 года).

Дополнительные бициклические нуклеозиды описаны в опубликованной литературе (см., например: Srivastava et al., J. Am. Chem. Soc, 2007, 129(26) 8362-8379; Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372; Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; патенты США №:7399845; 7053207; 7034133; 6794499; 6770748; 6670461; 6525191; 6268490; публикации патентов США №: US 2008-0039618; US 2007-0287831; US 2004-0171570; заявки на патент США, серийные номера: 12/129154; 61/099844; 61/097787; 61/086231; 61/056564; 61/026998; 61/026995; 60/989574; международные заявки WO 2007/134181; WO 2005/021570; WO 2004/106356; WO 94/14226; и международные заявки РСТ №: PCT/US 2008/068922; PCT/US 2008/066154; и PCT/US 2008/064591). Каждый из указанных бициклических нуклеозидов может быть получен с одной или более стереохимическими конфигурациями сахара, включая, например, α-L-рибофуранозу и β-D-рибофуранозу (см. международную заявку РСТ PCT/DK 98/00393, опубликованную 25 марта 1999 года как WO 99/14226).

В данном контексте «моноциклические нуклеозиды» относятся к нуклеозидам, содержащим модифицированные сахарные фрагменты, которые не являются бициклическими сахарными фрагментами. В некоторых вариантах реализации сахарный фрагмент или аналог сахарного фрагмента нуклеозида может быть модифицирован или замещен в любом положении.

В данном контексте «4'-2' бициклический нуклеозид» или «4' к 2' бициклический нуклеозид» относится к бициклическому нуклеозиду, содержащему фуранозное кольцо, содержащее мостик, соединяющий два атома углерода фуранозного кольца, соединяющий 2' атом углерода и 4' атом углерода сахарного кольца.

В некоторых вариантах реализации бициклические сахарные фрагменты нуклеозидов БНК включают, но не ограничиваются ими, соединения, имеющие по меньшей мере один мостик между 4' и 2' атомами углерода пентофуранозильного сахарного фрагмента, включая, без ограничения, мостики, содержащие 1 или от 1 до 4 связанных групп, независимо выбранных из -[C(Ra)(Rb)]n-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x- и -N(Ra)-; где: x равен 0, 1 или 2; n равен 1, 2, 3 или 4; каждый Ra и Rb независимо представляет собой Н, защитную группу, гидроксил, С112 алкил, замещенный С112 алкил, С212 алкенил, замещенный C2-C12 алкенил, С212 алкинил, замещенный С212 алкинил, С520 арил, замещенный С520 арил, гетероциклический радикал, замещенный гетероциклический радикал, гетероарил, замещенный гетероарил, С57 алициклический радикал, замещенный С57 алициклический радикал, галоген, OJ1, NJ1J2, SJ1, N3, COOJ1, ацил (С(=O)-Н), замещенный ацил, CN, сульфонил (S(=O)2-J1) или сульфоксил (S(=O)-J1); и

каждый J1 и J2 независимо представляет собой Н, С112 алкил, замещенный С112 алкил, С212 алкенил, замещенный С212 алкенил, С212 алкинил, замещенный С212 алкинил, С520 арил, замещенный С520 арил, ацил (С(=O)-Н), замещенный ацил, гетероциклический радикал, замещенный гетероциклический радикал, С112 аминоалкил, замещенный С112 аминоалкил или защитную группу.

В некоторых вариантах реализации мостик бициклического сахарного фрагмента представляет собой -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-, -C(RaRb)-N(R)-O- или -C(RaRb)-O-N(R)-. В некоторых вариантах реализации мостик представляет собой 4'-СН2-2', 4'-(СН2)2-2', 4'-(СН2)3-2', 4'-СН2-О-2', 4'-(СН2)2-O-2', 4'-CH2-O-N(R)-2' и 4'-CH2-N(R)-O-2'-, где каждый R независимо представляет собой Н, защитную группу или С112 алкил.

В некоторых вариантах реализации бициклические нуклеозиды дополнительно определяют по изомерной конфигурации. Например, нуклеозид, содержащий мостик 4'-(СН2)-O-2', может быть в α-L конфигурации или в β-D конфигурации. Ранее α-L-метиленокси (4'-СН2-O-2') БНК были внедрены в антисмысловые олигонуклеотиды, которые демонстрировали антисмысловую активность (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

В некоторых вариантах реализации бициклические нуклеозиды включают нуклеозиды, имеющие 4'-2' мостик, где такие мостики включают, без ограничения,, α-L-4'-(CH2)-O-2', β-D-4'-CH2-O-2', 4'-(СН2)2-O-2', 4'-CH2-O-N(R)-2', 4'-CH2-N(R)-O-2', 4'-СН(СН3)-O-2', 4'-CH2-S-2', 4'-CH2-N(R)-2', 4'-СН2-СН(СН3)-2' и 4'-(СН2)3-2', где R представляет собой Н, защитную группу или С112 алкил.

В некоторых вариантах реализации бициклические нуклеозиды имеют формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

-Qa-Qb-Qc- представляет собой -CH2-N(Rc)-CH2-, -C(=O)-N(Rc)-CH2-, -CH2-O-N(Rc)-, -СН2-N(Rc)-O- или -N(Rc)-O-CH2;

Rc представляет собой С112 алкил или аминозащитную группу; и

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, группу конъюгата, реакционноспособную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки.

В некоторых вариантах реализация бициклического нуклеозиды имеют формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, группу конъюгата, реакционноспособную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

Za представляет собой C16 алкил, С26 алкенил, С26 алкинил, замещенный C16 алкил, замещенный С26 алкенил, замещенный С26 алкинил, ацил, замещенный ацил, замещенный амид, тиол или замещенный тиол.

В одном из вариантов реализации каждая из замещенных групп независимо является моно или полизамещенной группами заместителей, выбранными из галогена, оксо, гидроксила, OJc, NJcJd, SJc, N3, OC(=X)Jc и NJeC(=X)NJcJd, где каждый Jc, Jd и Je независимо представляет собой Н, C16 алкил ил изамещенный C16 алкил, и X представляет собой О или NJc.

В некоторых вариантах реализации бициклические нуклеозиды имеют формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, группу конъюгата, реакционноспособную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

Zb представляет собой C1-C6 алкил, С26 алкенил, С26 алкинил, замещенный C16 алкил, замещенный С26 алкенил, замещенный С26 алкинил или замещенный ацил (C(=O)-).

В некоторых вариантах реализации бициклические нуклеозиды имеют формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, группу конъюгата, реакционноспособную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

Rd представляет собой C16 алкил, замещенный C16 алкил, С26 алкенил, замещенный С26 алкенил, С26 алкинил или замещенный С26 алкинил;

каждый qa, qb, qc и qd независимо представляет собой Н, галоген, C16 алкил, замещенный C16 алкил, С26 алкенил, замещенный С26 алкенил, С26 алкинил или замещенный С26 алкинил, C16 алкоксил, замещенный C16 алкоксил, ацил, замещенный ацил, C16 аминоалкил или замещенный C16 аминоалкил;

В некоторых вариантах реализации бициклические нуклеозиды имеют формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, группу конъюгата, реакционноспособную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

qa, qb, qe и qf, каждый независимо, представляют собой водород, галоген, С112 алкил, замещенный С112 алкил, С212 алкенил, замещенный С212 алкенил, С212 алкинил, замещенный С212 алкинил, С112 алкокси, замещенный С112 алкокси, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk;

или qe и qf вместе представляют собой =C(qg)(qh);

qg и qh, каждый независимо, представляют собой Н, галоген, С112 алкил или замещенный C112 алкил.

Описаны синтез и получение бициклических нуклеозидов аденина, цитозина, гуанина, 5-метилцитозина, тимина и урацила, имеющих мостик 4'-CH2-O-2', а также их олигомеризация и свойства распознавания нуклеиновых кислот (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). Описан также синтез бициклических нуклеозидов в WO 98/39352 и WO 99/14226.

Были также получены аналоги различных бициклических нуклеозидов, которые имеют 4'-2' мостиковые группы, такие как 4'-CH2-O-2' и 4'-CH2-S-2' (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Описано также получение олигодезоксирибонуклеотидных дуплексов, содержащих бициклические нуклеозиды, для применения в качестве субстратов для полимераз нуклеиновых кислот (Wengel et al., WO 99/14226). Кроме того, в данной области техники описан синтез 2'-амино-БНК, нового конформационно ограниченного высокоаффинного аналога олигонуклеотида (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Кроме того, ранее были получены 2'-амино- и 2'-метиленамино БНК, и была описана термостабильность их дуплексов с комплементарными нитями РНК и ДНК.

В некоторых вариантах реализации бициклические нуклеозиды имеют формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

Ta и Tb, каждый независимо, представляют собой Н, гидрокси-защитную группу, группу конъюгата, реакционноспособную фосфорную группу, фосфорный фрагмент или ковалентное присоединение к среде подложки;

каждый qi, qj, qk и ql независимо представляет собой Н, галоген, С112 алкил, замещенный C112 алкил, С212 алкенил, замещенный С212 алкенил, С212 алкинил, замещенный С212 алкинил, С112 алкоксил, замещенный С112 алкоксил, OJj, SJj, SOJj, SO2Jj, NJjJk, N3, CN, C(=O)OJj, C(=O)NJjJk, C(=O)Jj, O-C(=O)NJjJk, N(H)C(=NH)NJjJk, N(H)C(=O)NJjJk или N(H)C(=S)NJjJk; и

qi и qj или qi и qk вместе представляют собой =C(qg)(qh), где qg и qh, каждый независимо, представляют собой Н, галоген, С112 алкил или замещенный С112 алкил.

Описан один карбоциклический бициклический нуклеозид, имеющий мостик 4'-(СН2)3-2', и мостик из аналога алкенила 4'-СН=СН-СН2-2' (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 и Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). Описан также синтез и получение карбоциклических бициклических нуклеозидов вместе с их олигомеризацией и биохимическими исследованиями (Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

В некоторых вариантах реализации бициклические нуклеозиды включают, но не ограничиваются ими, (А) α-L-метиленокси (4'-СН2-O-2') БНК, (В) β-D-метиленокси (4'-СН2-O-2') БНК, (С) этиленокси (4'-(СН2)2-O-2') БНК, (D) аминоокси (4'-CH2-O-N(R)-2') БНК, (Е) оксиамино (4'-CH2-N(R)-O-2') БНК, (F) метил(метиленокси) (4'-СН(СН3)-O-2') БНК (также называемый стерически затрудненным этилом или cEt), (G) метилентио (4'-CH2-S-2') БНК, (Н) метиленамино (4'-CH2-N(R)-2') БНК, (I) метилкарбоциклическую (4'-СН2-СН(СН3)-2') БНК, (J) пропиленкарбоциклическую (4'-(СН2)3-2') БНК и (К) винил-БНК, как показано ниже.

где Вх представляет собой фрагмент основания, а R независимо представляет собой Н, защитную группу, C16 алкил или C16 алкокси.

В данном контексте термин «модифицированный тетрагидропирановый нуклеозид» или «модифицированный ТГП нуклеозид» означает нуклеозид, имеющий шестичленный тетрагидропирановый «сахар», заменивший пентофуранозильный остаток в обычных нуклеозидах, и он может быть упомянут как заменитель сахара. ТГП-модифицированные нуклеозиды включают, но не ограничиваются ими, те, которые в данной области техники называют гекситоловой нуклеиновой кислотой (ГНК), анитоловой нуклеиновой кислотой (АНК), манитоловой нуклеиновой кислотой (МНК) (см. Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) или фтор-ГНК (F-ГНК), имеющие тетрагидропирановую кольцевую систему, как показано ниже.

В некоторых вариантах реализации выбраны заменители сахара, имеющие формулу:

где:

Вх представляет собой фрагмент гетероциклического основания;

Т3 и Т4, каждый независимо, представляют соой межнуклеозидную линкерную группу, связывающую аналог тетрагидропиранового нуклеозида с олигомерным соединением, или один из Т3 и Т4 представляет собой межнуклеозидную линкерную группу, связывающую аналог тетрагидропиранового нуклеозида с олигомерным соединением или олигонуклеотидом, а другой из Т3 и Т4 представляет собой Н, гидроксил-защитную группу, связанную группу конъюгата или 5(или 3'-концевую группу;

q1, q2, q3, q4, q5, q6 q7, каждый независимо, представляют собой Н, C16 алкил, замещенный C16 алкил, С26 алкенил, замещенный С26 алкенил, С26 алкинил или замещенный С26 алкинил; и

один из R1 и R2 представляет собой водород, а другой выбран из галогена, замещенного или незамещенного алкокси, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 и CN, где X представляет собой О, S или NJ1, и каждый J1, J2 и J3 независимо представляет собой Н или C16 алкил.

В некоторых вариантах реализации каждый q1, q2, q3, q4, q5, q6 и q7 представляет собой H. В некоторых вариантах реализации по меньшей мере один из q1, q2, q3, q4, q5, q6 и q7 отличен от H. В некоторых вариантах реализации по меньшей мере один из q1, q2, q3, q4, q5, q6 и q7 представляет собой метил. В некоторых вариантах реализации предложены ТГП нуклеозиды, в которых один из R1 и R2 представляет собой F. В некоторых вариантах реализации R1 представляет собой фтор, a R2 представляет собой Н; R1 представляет собой метокси, a R2 представляет собой Н, и R1 представляет собой метоксиэтокси, a R2 представляет собой Н.

В некоторых вариантах реализации заменители сахара содержат кольца, имеющие более 5 атомов и более одного гетероатома. Например, описаны нуклеозиды, содержащие морфолиносахарные фрагменты, и их применение в олигомерных соединениях (см., например: Braasch et al., Biochemistry, 2002, 41, 4503-4510; и патенты США 5698685; 5166315; 5185444; и 5034506). В данном контексте термин «морфолино» означает заменитель сахара, имеющий следующую формулу:

.

В некоторых вариантах реализации морфолино могут быть модифицированными, например, добавлением или изменением различных групп заместителей относительно представленной выше структуры морфолино. Такие заменители сахара в данном контексте называют «модифицированными морфолино».

Предложены также комбинации модификаций, без ограничения, такие как 2'-F-5'-метил-замещенные нуклеозиды (см. международную заявку РСТ WO 2008/101157, опубликованную 8/21/08, где описаны другие 5', 2'-бис-замещенные нуклеозиды) и замену рибозильного кольцевого атома кислорода на S с дополнительным замещением в 2'-положении (см. опубликованную заявку на патент США US2005-0130923, опубликованную 16 июня 2005 года) или в альтернативном варианте с 5'-замещением бициклической нуклеиновой кислоты (см. международную заявку РСТ WO 2007/134181, опубликованную 11/22/07, где 4'-СН2-O-2' бициклический нуклеозид дополнительно замещен в 5' положении 5'-метильной или 5'-винильной группой). Описан также синтез и получение карбоциклических бициклических нуклеозидов вместе с их олигомеризацией и биохимическими исследованиями (см., например, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

В некоторых вариантах реализации антисмысловые соединения содержат один или более модифицированных циклогексенильных нуклеозидов, которые представляют собой нуклеозиды, имеющие шестичленный циклогексенил вместо пентофуранозильного остатка в природных нуклеозидах. Модифицированные циклогексенильные нуклеозиды включают, но не ограничиваются ими, нуклеозиды, описанные в данной области техники (см., например, параллельную опубликованную заявку РСТ WO 2010/036696, опубликованную 10 апреля, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; опубликованную заявку РСТ WO 06/047842; и опубликованную заявку РСТ WO 01/049687; полное содержание каждой из которых включено в настоящий документ посредством ссылки). Некоторые модифицированные циклогексенильные нуклеозиды имеют формулу X.

где независимо для каждого указанного по меньшей мере одного циклогексенильного нуклеозидного аналога формулы X:

Вх представляет собой фрагмент гетероциклического основания;

Т3 и Т4, каждый независимо, представляют собой межнуклеозидную линкерную группу, которая связывает циклогексенильный нуклеозидный аналог с антисмысловым соединением, или один из Т3 и Т4 представляет собой межнуклеозидную линкерную группу, которая связывает тетрагидропирановый нуклеозидный аналог с антисмысловым соединением, а другой из Т3 и Т4 представляет собой Н, гидроксил-защитную группу, связанную группу конъюгата или 5'-или 3'-концевую группу; и

q1, q2, q3, q4, q5, q6, q7, q8 и q9 каждый независимо, представляют собой Н, C16 алкил, замещенный C16 алкил, С26 алкенил, замещенный С26 алкенил, С26 алкинил, замещенный С26 алкинил или другие группы-заместители сахара.

В данной области техники известны также многие другие моноциклические, бициклические и трициклические кольцевые системы, и они подходят в качестве заменителей сахара, которые могут быть использованы для модификации нуклеозидов для внедрения в олигомерные соединения, предложенные в настоящем документе (см., например, обзорную статью: Leumann, Christian J. Bioorg. & Med. Chem., 2002, 10, 841-854). Такие кольцевые системы могут быть подвергнуты различным дополнительным замещениям для дополнительного повышения их активности.

В данном контексте «2'-модифицированный сахар» означает фуранозильный сахар, модифицированный в 2' положении. В некоторых вариантах реализации такие модификации включают заместители, выбранные из: галогенидов, включая, но не ограничиваясь ими, замещенный и незамещенный алкокси, замещенный и незамещенный тиоалкил, замещенный и незамещенный аминоалкил, замещенный и незамещенный алкил, замещенный и незамещенный аллил и замещенный и незамещенный алкинил. В некоторых вариантах реализации 2' модификации выбраны из заместителей, включающих, но не ограничиваясь ими: O[(СН2)nO]mCH3, O(CH2)nNH2, O(СН2)nCH3, O(CH2)nF, O(CH2)nONH2, OCH2C(=O)N(H)CH3 и O(CH2)nON[(CH2)nCH3]2, где n и m равны от 1 до около 10. Другие 2' группы заместителей также могут быть выбраны из: С112 алкила, замещенного алкила, алкенила, алкинила, алкарила, аралкила, О-алкарила или О-аралкила, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, гетероциклоалкила, гетероциклоалкарила, аминоалкиламино, полиалкиламино, замещенного силила, РНК расщепляющей группы, репортерной группы, интеркалятора, группы для улучшения фармакокинетических свойств или группы для улучшения фармакодинамических свойств антисмыслового соединения, и других заместителей с подобными свойствами. В некоторых вариантах реализации модифицированные нуклеозиды содержат 2'-МОЕ боковую цепь (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Такие 2'-MOE замещения описаны как улучшающие аффинность связывания по сравнению с немодифицированными нуклеозидами и с другими модифицированными нуклеозидами, такими как 2'-О-метил, О-пропил и О-аминопропил. Было показано, что олигонуклеотиды, имеющие 2'-МОЕ заместитель, являются антисмысловыми ингибиторами экспрессии генов с перспективными возможностями для применения in vivo (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; и Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

В данном контексте «2'-модифицированный» или «2'-замещенный» относится к нуклеозиду, содержащему сахар, содержащий заместитель в 2' положении, отличный от Н или ОН. 2'-модифицированные нуклеозиды включают, но не ограничиваются ими, бициклические нуклеозиды, в которых мостик, соединяющий два атом углерода сахарного кольца, соединяет 2' атом углерода и другой атом углерода сахарного кольца; и нуклеозиды с немостиковыми 2' заместителями, такими как аллил, амино, азидо, тио, О-аллил, O-C1-C10 алкил, -OCF3, O-(СН2)2-O-СН3, 2'-O(СН2)2SCH3, O-(CH2)2-O-N(Rm)(Rn) или O-CH2-C(=O)-N(Rm)(Rn), где каждый Rm и Rn независимо представляет собой Н или замещенный или незамещенный C110 алкил. 2'-модифицированные нуклеозиды могут также содержать другие модификации, например, в других положениях сахара и/или азотистого основания.

В данном контексте «2'-F» относится к нуклеозиду, содержащему сахар, содержащий группу фтора в 2' положении сахарного кольца.

В данном контексте «2'-ОМе» или «2'-ОСН3», «2'-O-метил» или «2'-метокси» относятся к нуклеозиду, содержащему сахар, содержащий группу -ОСН3 в 2' положении сахарного кольца.

В данном контексте «МОЕ» или «2'-МОЕ», или «2'-ОСН2СН2ОСН3», или «2'-O-метоксиэтил» относится к нуклеозиду, содержащему сахар, содержащий группу -ОСН2СН2ОСН3 в 2' положении сахарного кольца.

Способы получения модифицированных сахаров хорошо известны специалистам в данной области техники. Некоторые иллюстративные патенты США, которые описывают получение таких модифицированных сахаров, включают, без ограничения, патенты США: 4981957; 5118800; 5319080; 5359044; 5393878; 5446137; 5466786; 5514785; 5519134; 5567811; 5576427; 5591722; 5597909; 5610300; 5627053; 5639873; 5646265; 5670633; 5700920; 5792847 и 6600032, а также международную заявку PCT/US 2005/019219, поданную 2 июня 2005 года и опубликованную как WO 2005/121371 22 декабря 2005 года, полное содержание каждого из которых включено в настоящий документ посредством ссылки.

В данном контексте «олигонуклеотид» относится к соединению, содержащему множество связанных нуклеозидов. В некоторых вариантах реализации один или более из множества нуклеозидов являются модифицированными. В некоторых вариантах реализации олигонуклеотид содержит один или более рибонуклеозидов (РНК) и/или дезоксирибонуклеозидов (ДНК).

В нуклеотидах, имеющих модифицированные сахарные фрагменты, фрагменты азотистых оснований (природные, модифицированные или их комбинации) сохраняются для гибридизации с соответствующей нуклеиновой кислотой-мишенью.

В некоторых вариантах реализации антисмысловые соединения содержат один или более нуклеозидов, имеющих модифицированные сахарные фрагменты. В некоторых вариантах реализации модифицированный сахарный фрагмент представляет собой 2'-МОЕ. В некоторых вариантах реализации 2'-МОЕ модифицированные нуклеозиды расположены в гэпмерном мотиве. В некоторых вариантах реализации модифицированный сахарный фрагмент представляет собой бициклический нуклеозид, имеющий мостиковую группу (4'-СН(СН3)-O-2'). В некоторых вариантах реализации (4'-СН(СН3)-O-2') модифицированные нуклеозиды расположены в крыльях гэпмерного мотива.

Составы и способы для разработки фармацевтических композиций

Олигонуклеотиды могут быть смешаны с фармацевтически приемлемыми активными или инертными веществами для получения фармацевтических композиций или составов. Композиции и способы составления фармацевтических композиций зависят от множества критериев, включая, но не ограничиваясь этим, способ введения, тяжесть заболевания или дозу, подлежащую введению.

Антисмысловое соединение к нуклеиновой кислоте SOD-1 может быть использовано в фармацевтических композициях посредством объединения антисмыслового соединения с подходящим фармацевтически приемлемым разбавителем или носителем. Фармацевтически приемлемый разбавитель включает фосфатно-солевой буферный раствор (PBS). PBS представляет собой разбавитель, подходящий для применения в композициях, доставляемых парентерально. Соответственно, в одном из вариантов реализации в способах, описанных в настоящем документе, используют фармацевтическую композицию, содержащую антисмысловое соединение, направленное на нуклеиновую кислоту SOD-1, и фармацевтически приемлемый разбавитель. В некоторых вариантах реализации фармацевтически приемлемый разбавитель представляет собой PBS. В некоторых вариантах реализации антисмысловое соединение представляет собой модифицированный олигонуклеотид.

Фармацевтические композиции, содержащие антисмысловые соединения, включают любые фармацевтически приемлемые соли, сложные эфиры или соли таких сложных эфиров или любой другой олигонуклеотид, который, при введении животному, включая человека, способен обеспечить (прямо или косвенно) биологически активный метаболит или его остаток. Соответственно, например, настоящее описание относится также к фармацевтически приемлемым солям антисмысловых соединений, пролекарствам, фармацевтически приемлемым солям таких пролекарств и к другим биоэквивалентам. Подходящие фармацевтически приемлемые соли включают, но не ограничиваются ими, соли натрия и калия.

Пролекарство может включать внедрение дополнительных нуклеозидов с одного или обоих концов антисмыслового соединения, которые расщепляются в организме под действием эндогенных нуклеаз с образованием активного антисмыслового соединения.

Сопряженные антисмысловые соединения

Антисмысловые соединения могут быть ковалентно связаны с одним или более фрагментом или конъюгатом, которые усиливают активность, клеточное распределение или клеточное поглощение полученных олигонуклеотидов. Типичные группы конъюгата включают фрагменты холестерина и липидные фрагменты. Дополнительные группы конъюгата включают углеводы, фосфолипиды, биотин, феназин, соль фолиевой кислоты, фенантридин, антрахинон, акридин, флуоресцеины, родамины, кумарины, и красители.

Антисмысловые соединения могут также быть модифицированными, чтобы иметь одну или более стабилизирующих групп, которые обычно присоединяются к одному или обоим концам антисмысловых соединений для улучшения свойств, таких как, например, устойчивость к нуклеазам. Стабилизирующие группы включают кэпирующие структуры. Такие концевые модификации защищают антисмысловое соединение с концевой нуклеиновой кислотой от разрушения под действием экзонуклеаз и могут способствовать доставке и/или локализации внутри клетки. Кэп может быть расположен на 5'-конце (5'-кэп) или на 3'-конце (3'-кэп), или может находиться на обоих концах. Кэпирующие структуры хорошо известны в данной области техники и включают, например, инвертированные дезокси кэпы с удаленными азотистыми основаниями. Дополнительные 3' и 5'-стабилизирующие группы, которые могут быть использованы для кэпирования одного или обоих концов антисмыслового соединения для придания устойчивости к нуклеазам, включают группы, описанные в WO 03/004602 опубликованном 16 января 2003 года.

Клеточная культура и лечение антисмысловыми соединениями

Влияние антисмысловых соединений на уровень, активность или экспрессию нуклеиновых кислот SOD-1 может быть испытано in vitro на различных типах клеток. Различные типы клеток, используемые для таких анализов, имеются в продаже у коммерческих поставщиков (например, Американская коллекция типов культур (АТСС), Манассас, штат Вирджиния; Zen-Bio, Inc., Research Triangle Park, штат Северная Каролина; Clonetics Corporation, Уолкерсвиль, штат Мэриленд) и культивируются согласно инструкциям производителей с применением коммерчески доступных реагентов (например, Invitrogen Life Technologies, Карлсбад, штат Калифорния). Иллюстративные типы клеток включают, но не ограничиваются ими, клетки HepG2, клетки Нер3В, первичные гепатоциты, клетки А431 и клетки SH-SY5Y.

Тестирование олигонуклеотидов in vitro

Описываемые в настоящем документе способы лечения клеток с помощью олигонуклеотидов могут быть изменены соответствующим образом для лечения другими антисмысловыми соединениями.

Клетки могут быть обработаны олигонуклеотидами при 60-80% уровне конфлюентности в культуре.

Реагент, используемый для введения олигонуклеотидов в культивируемые клетки, включает катионный липидный трансфекционный реагент LIPOFECTIN (Invitrogen, Карлсбад, штат Калифорния). Олигонуклеотиды могут быть смешаны с LIPOFECTIN в OPTI-MEM 1 (Invitrogen, Карлсбад, штат Калифорния) для достижения желаемой конечной концентрации олигонуклеотида и концентрации LIPOFECTIN, которая может составлять от 2 до 12 мкг/мл при 100 нМ олигонуклеотида.

Другой реагент, используемый для введения олигонуклеотидов в культивируемые клетки, включает LIPOFECTAMINE (Invitrogen, Карлсбад, штат Калифорния). Олигонуклеотид смешивают с LIPOFECTAMINE в среде OPTI-MEM 1 со сниженным содержанием сыворотки (Invitrogen, Карлсбад, штат Калифорния) для достижения желаемой концентрации олигонуклеотида и концентрации LIPOFECTAMINE, которая может составлять от 2 до 12 мкг/мл при 100 нМ олигонуклеотида.

Другая технология, используемая для введения олигонуклеотидов в культивируемые клетки, включает электропорацию.

Клетки обрабатывают олигонуклеотидами с помощью стандартных способов. Клетки могут быть собраны через 16-24 часов после обработки олигонуклеотидом, после чего уровни РНК или белков нуклеиновых кислот-мишеней измеряют методами, известными в данной области техники и описанными в настоящем документе. Как правило, если обработку проводят в нескольких повторениях, данные представляют как среднее значение для многократных обработок.

Концентрация используемого олигонуклеотида варьируется в зависимости от линии клеток. Способы определения оптимальной концентрации олигонуклеотидна для конкретной линии клеток хорошо известны в данной области техники. Олигонуклеотиды обычно используют в концентрациях от 1 нМ до 300 нМ, при трансфекции с использованием LIPOFECTAMINE. Олигонуклеотиды используют в более высоких концентрациях в диапазоне от 625 до 20000 нМ при трансфекции с использованием электропорации.

Выделение РНК

Анализ РНК может быть проведен на общей клеточной РНК или поли(А)+мРНК. Способы выделения РНК хорошо известны в данной области техники. РНК получают с использованием способов, хорошо известных в данной области техники, например, с использованием реагента TRIZOL (Invitrogen, Карлсбад, штат Калифорния) по рекомендуемым протоколам производителя.

Анализ ингибирования целевых уровней или экспрессии

Ингибирование уровней или экспрессии нуклеиновой кислоты SOD-1 может быть проанализировано различными способами, известными в данной области техники. Например, уровни целевой нуклеиновой кислоты могут быть количественно измерены, например, нозерн-блоттингом, конкурентной полимеразной цепной реакцией (ПЦР) или количественной ПЦР в реальном времени. Анализ РНК может быть проведен на общей клеточной РНК или поли(А)+мРНК. Способы выделения РНК хорошо известны в данной области техники. Нозерн-блоттинг также является общепринятым в данной области техники. Количественная ПЦР в реальном времени может быть удобно выполнена с помощью имеющихся в продаже систем обнаружения последовательностей ABI PRISM 7600, 7700, или 7900 производства компании PE-Applied Biosystems, Фостер-Сити, штат Калифорния, и используемых в соответствии с инструкциями производителя.

Количественный анализ уровней целевой РНК методом ПЦР в реальном времени

Количественное определение уровней целевой РНК может быть проведено путем количественной ПЦР в реальном времени с использованием систем обнаружения последовательностей ABI PRISM 7600, 7700 или 7900 (PE-Applied Biosystems, Фостер-Сити, штат Калифорния) в соответствии с инструкциями производителя. Способы количественной ПЦР в реальном времени хорошо известны в данной области техники.

Перед проведением ПЦР в реальном времени изолированную РНК подвергают реакции обратной транскрипции (ОТ), которая производит комплементарную ДНК (кДНК), которую затем используют в качестве субстрата для амплификации в ПЦР в реальном времени. Реакции ОТ и ПЦР в реальном времени проводят последовательно в одном и том же образце. Реагенты для ОТ и ПЦР в реальном времени могут быть приобретены у компании Invitrogen (Карлсбад, штат Калифорния). Реакции ОТ и ПЦР в реальном времени проводят способами, хорошо известными специалистам в данной области техники.

Количества гена-мишени (или РНК), полученные путем ПЦР в реальном времени, нормализуют с использованием либо уровня экспрессии гена, экспрессия которого постоянна, такого как циклофилин А, или на основе количественной оценки суммарной РНК с использованием реагента RIBOGREEN (Invitrogen, Inc. Карлсбад, штат Калифорния). Экспрессию циклофилина А количественно определяют с помощью ПЦР в реальном времени, которую проводят одновременно с мишенью, мультиплексно или отдельно. Общую РНК количественно определяют с помощью реагента для количественного определения РНК RIBOGREEN (Invetrogen, Inc. Юджин, штат Орегон). Способы количественного определения РНК с использованием RIBOGREEN - SOD-1 ght изложены в Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). Для измерения флуоресценции RIBOGREEN используют прибор CYTOFLUOR 4000 (РЕ Applied Biosystems).

Зонды и праймеры конструируют для гибридизации с нуклеиновой кислотой SOD-1. Способы конструирования зондов и праймеров для ПЦР в реальном времени хорошо известны в данной области техники, и могут включать использование программного обеспечения, такого как PRIMER EXPRESS (Applied Biosystems, Фостер-Сити, штат Калифорния).

Анализ уровней белка

Антисмысловое ингибирование нуклеиновых кислот SOD-1 может быть оценено путем измерения уровней белка SOD-1. Уровни белка SOD-1 могут быть оценены или количественно измерены различными способами, хорошо известными в данной области техники, такими как иммунопреципитация, вестерн-блоттинг (иммуноблоттинг), иммуноферментный анализ (ELISA), количественный анализ белка, анализ активности белка (например, анализ активности каспазы), иммуногистохимия, иммуноцитохимия или сортировка флуоресцентно-активированных клеток (FACS). Антитела, направленные на мишень, могут быть идентифицированы и получены из различных источников, таких как каталог антител MSRS (Aerie Corporation, Бирмингем, штат Мичиган), или могут быть получены с помощью обычных способов генерации моноклональных или поликлональных антител, хорошо известных в данной области техники. В некоторых вариантах реализации соединения, представленные в настоящем документе, обеспечивают улучшенное снижение уровней белка.

Тестирование антисмысловых соединений in vivo

Антисмысловые соединения, например, модифицированные олигонуклеотиды, испытывали на животных с целью оценки их способности ингибировать экспрессию SOD-1 и производить фенотипические изменения, такие как улучшение двигательной функции. В некоторых вариантах реализации двигательную функцию измеряли анализом инициации ходьбы, оценки способности удерживания на вращающемся барабане, прочности сжатия, залезания на шест, теста «открытое поле», балансировки на бревне, анализа отпечатков задних лап у животного. Тестирование быть проведено на здоровых животных или в экспериментальных моделях заболеваний. Для введения животным олигонуклеотиды составляли с фармацевтически приемлемым разбавителем, таким как фосфатно-солевой буфер. Введение включает парентеральные пути введения, такие как внутрибрюшинное, внутривенное и подкожное. Доза и частота введения олигонуклеотида зависят от многих факторов, таких как, но не ограничиваясь ими, как способ введения и масса тела животного. После периода лечения с помощью олигонуклеотидов, РНК выделяют из ткани ЦНС или СМЖ и измеряют изменения экспрессии нуклеиновой кислоты SOD-1.

Некоторые показания

В некоторых вариантах реализации в настоящем документе представлены способы, соединения и композиции для лечения индивидуума, включающие введение одной или более фармацевтических композиций, описанных в настоящем документе. В некоторых вариантах реализации индивидуум страдает нейродегенеративным заболеванием. В некоторых вариантах реализации индивидуум имеет риск развития нейродегенеративного заболевания, включая, но не ограничиваясь им, амиотрофический латеральный склероз (ALS). В некоторых вариантах реализации у индивидуума идентифицировано заболевание, связанное с SOD-1. В некоторых вариантах реализации в настоящем документе представлены способы профилактического снижения экспрессии SOD-1 у индивидуума. Некоторые варианты реализации включают лечение индивидуума, нуждающегося в этом, путем введения индивидууму терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту SOD-1.

В одном из вариантов реализации введение терапевтически эффективного количества антисмыслового соединения, направленного на нуклеиновую кислоту SOD-1, сопровождают мониторингом уровней SOD-1 у индивидуума для определения реакции индивидуума на введение антисмыслового соединения. Реакцию индивидуума на введение антисмыслового соединения врач может использовать для определения объема и продолжительности терапевтического вмешательства.

В некоторых вариантах реализации введение антисмыслового соединения, направленного на нуклеиновую кислоту SOD-1, приводит к снижению экспрессии SOD-1 на по меньшей мере 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100%, или на диапазон, определенный любыми двумя из указанных значений. В некоторых вариантах реализации введение антисмыслового соединения, направленного на нуклеиновую кислоту SOD-1, приводит к улучшению двигательной функции у животного. В некоторых вариантах реализации введение антисмыслового соединения к SOD-1 обеспечивает улучшение двигательной функции на по меньшей мере 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 или 100%, или на диапазон, определенный любыми двумя из указанных значений.

В некоторых вариантах реализации фармацевтические композиции, содержащие антисмысловое соединение, направленное на SOD-1, используют для получения лекарственного средства для лечения пациента, страдающего или предрасположенного к нейродегенеративному заболеванию, включая амиотрофический латеральный склероз (ALS).

Некоторые композиции сравнения

Антисмысловые олигонуклеотиды, направленные на человеческую SOD-1, описаны в более ранней публикации (см. WO 2005/040180, включенную в настоящий документ посредством ссылки в полном объеме). Некоторые олигонуклеотиды (ISIS 333611, ISIS 146144, ISIS 146145, ISIS 150437, ISIS 150441, ISIS 150443, ISIS 150444, ISIS 150445, ISIS 150446, ISIS 150447, ISIS 150448, ISIS 150449, ISIS 150452, ISIS 150454, ISIS 150458, ISIS 150460, ISIS 150462-150467, ISIS 150470, ISIS 150472, ISIS 150474, ISIS 150475, ISIS 150476, ISIS 150479-150483, ISIS 150488, ISIS 150489, ISIS 150490, ISIS 150491-150493, ISIS 150495-150498, ISIS 150511, ISIS 333605, ISIS 333606, ISIS 333609-333617, ISIS 333619, ISIS 333620-333636, ISIS 333638 и ISIS 333640), описанные в указанном документе, использовали в качестве соединений сравнения при проведении отборочных скринингов новых антисмысловых соединений, описанных в настоящем документе.

В некоторых вариантах реализации ISIS 333611, 5-10-5 МОЕ гэпмер, имеющий последовательность (от 5' к 3') CCGTCGCCCTTCAGCACGCA (включенную в настоящий документ как SEQ ID NO: 21), где каждая межнуклеозидная связь представляет собой тиофосфатную связь, каждый цитозин представляет собой 5-метилцитозин, и каждый из нуклеозидов 1-5 и 16-20 (от 5' к 3') содержит 2'-O-метоксиэтильный фрагмент, использовали в качестве соединения сравнения. ISIS 333611 выбрали в качестве соединения сравнения, поскольку оно демонстрирует высокие уровни дозозависимого ингибирования в различных исследованиях, как описано в WO 2005/040180. Кроме того, завершены клинические испытания 1 фазы ISIS 333611 на людях. См. MILLER et al., "An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study" Lancet Neurol. (2013) 12(5): 435-442. Таким образом, ISIS 333611 предположительно является высокоэффективным и сильнодействующим соединением с приемлемым профилем безопасности (поскольку его испытывали на людях).

В некоторых вариантах реализации соединения, описанные в настоящем документе, имеют преимущество, заключающееся в улучшении одного или более свойств по сравнению с антисмысловыми соединениями, описанными в WO 2005/040180. Некоторые улучшенные свойства продемонстрированы в примерах, представленных в настоящем документе. В некоторых вариантах реализации соединения, описанные в настоящем документе, являются более эффективными, сильнодействующими и/или переносимыми в различных испытаниях in vitro и in vivo, чем соединения сравнения, описанные в настоящем документе, включая ISIS 333611. В некоторых вариантах реализации ISIS 666853, ISIS 666859, ISIS 666919, ISIS 666921, ISIS 666922, ISIS 666869, ISIS 666870 и ISIS 666867 являются более эффективными и/или сильнодействующими в различных in vitro и in vivo испытаниях, чем соединения сравнения, включая ISIS 333611. В некоторых вариантах реализации ISIS 666853, ISIS 666859, ISIS 666919, ISIS 666921, ISIS 666922, ISIS 666869, ISIS 666870 и ISIS 666867 являются более переносимыми в одном или более анализах переносимости у животных, чем соединения сравнения, описанные в настоящем документе, включая ISIS 333611. И это несмотря на то, что 333611 достаточно хорошо переносится для проведения клинических испытаний на людях.

В некоторых вариантах реализации некоторые соединения, описанные в настоящем документе, являются более эффективными, чем соединения сравнения, поскольку имеют значение IC50 in vitro менее 2 мкМ, менее 1,9 мкМ, менее 1,8 мкМ, менее 1,7 мкМ, менее 1,6 мкМ, менее 1,5 мкМ, менее 1,4 мкМ, менее 1,3 мкМ, менее 1,2 мкМ, менее 1,1 мкМ, менее 1 мкМ, менее 0,9 мкМ, менее 0,8 мкМ, менее 0,7 мкМ, менее 0,6 мкМ или менее 0,5 мкМ, менее 0,4 мкМ, менее 0,3 мкМ, менее 0,2 мкМ, менее 0,1 мкМ при испытании в клетках человека, например, в клеточных линиях HepG2 А431 или SH-SY5Y (см., например, примеры 6-11).

В некоторых вариантах реализации некоторые соединения, описанные в настоящем документе, являются более эффективными, чем соединения сравнения, поскольку могут ингибировать экспрессию SOD-1 in vivo. В некоторых вариантах реализации соединения ингибируют SOD-1 в поясничном отделе спинного мозга и в шейном отделе спинного мозга на по меньшей мере 60%, по меньшей мере 65%, по меньшей мере 70%, по меньшей мере 75%, по меньшей мере 80%, по меньшей мере 85%, по меньшей мере 90% или по меньшей мере 95%, например, в модели трансгенных животных.

В некоторых вариантах реализации некоторые соединения, описанные в настоящем документе, являются более переносимыми, чем соединения сравнения, поскольку обеспечивают сниженные уровни микроглиального маркера (например, IBA1), сниженные уровни астроцитарного маркера (например, GFAP) и/или оценки FOB у крыс, мышей и/или обезьян. См., например, примеры 14, 15, 18 и 19.

ISIS 666853

Например, как показано в примере 12 (ниже), ISIS 666853 обеспечивает достижение 81% ингибирования в поясничном отделе спинного мозга и 74% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс при введении дозы 30 мкл 16,67 мг/мо раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Например, как показано в примере 14 (ниже), ISIS 666853 обеспечивает достижение оценки FOB 0, тогда как ISIS 333611 обеспечивает достижение оценки FOB 4 у крыс Спрага-Доули через 3 часа после введения 3 мг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у крыс, которым вводили ISIS 666853, по сравнению с крысами, которым вводили ISIS 333611.

Например, как показано в примере 15 (ниже), ISIS 666853 обеспечивает ED50 81,3 и 242,6 в поясничной ткани и шейной ткани (соответственно) у SOD-1 трансгенных крыс, которым интратекально вводили 10, 30, 100, 300 или 3000 мкг олигонуклеотида. ED50 в поясничной и шейной тканях не может быть рассчитан у трансгенных крыс, которым вводили ISIS 333611, поскольку наивысшая испытанная концентрация (3000 мкг) ингибирует мРНК человеческой SOD-1 более чем на 55-65%.

Например, как показано в примере 16 (ниже), в дозах 1 мг и 3 мг ISIS 666853 обеспечивает оценки FOB через 3 часа 0,0 и 0,5 (соответственно), тогда как ISIS 333611 обеспечивает оценки FOB 3,0 и 4,9 (соответственно). В дозах 1 мг и 3 мг ISIS 666853 обеспечивает оценки FOB через 8 недель 0,0 и 0,0 (соответственно), тогда как ISIS 333611 обеспечивает оценки FOB 0,0 и 1,2 (соответственно).

Например, как показано в примере 17 (ниже), ISIS 666853 обеспечивает ED50 136 и 188 в поясничной ткани и корковой ткани (соответственно), тогда как ISIS 333611 обеспечивает ED50 401 и 786 в поясничной ткани и корковой ткани (соответственно) у SOD-1 трансгенных мышей при введении интрацеребровентрикулярного болюса 10, 30, 100, 300 или 700 мкг олигонуклеотида.

Например, как показано в примере 18 (ниже), ISIS 666853 обеспечивает оценку FOB 1,25, тогда как ISIS 333611 обеспечивает оценку FOB 6,5 у мышей C57bl6 через 3 часа после введения 700 мкг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у мышей, которым вводили ISIS 666853, по сравнению с мышами, которым вводили ISIS 333611.

ISIS 666859

Например, как показано в примере 12 (ниже), ISIS 666859 обеспечивает 79% ингибирование в поясничном отделе спинного мозга и 64% ингибирование в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Например, как показано в примере 14 (ниже), ISIS 666859 обеспечивает достижение оценки FOB 1, тогда как ISIS 333611 обеспечивает достижение оценки FOB 4 у крыс Спрага-Доули через 3 часа после введения 3 мг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у крыс, которым вводили ISIS 666859, по сравнению с крысами, которым вводили ISIS 333611.

Например, как показано в примере 15 (ниже), ISIS 666859 обеспечивает ED50 74,0 и 358,8 в поясничной ткани и шейной ткани (соответственно) у SOD-1 трансгенных крыс, которым интратекально вводили 10, 30, 100, 300 или 3000 мкг олигонуклеотида. ED50 в поясничной и шейной тканях не может быть рассчитан у трансгенных крыс, которым вводили ISIS 333611, поскольку наивысшая испытанная концентрация (3000 мкг) ингибирует мРНК человеческой SOD-1 более чем на 55-65%.

Например, как показано в примере 16 (ниже), в дозах 1 мг и 3 мг ISIS 666859 обеспечивает оценки FOB через 3 часа 0,0 и 2,1 (соответственно), тогда как ISIS 333611 обеспечивает оценки FOB 3,0 и 4,9 (соответственно). В дозах 1 мг и 3 мг ISIS 666859 обеспечивает оценки FOB через 8 недель 0,0 и 0,3 (соответственно), тогда как ISIS 333611 обеспечивает оценки FOB 0,0 и 1,2 (соответственно).

Например, как показано в примере 17 (ниже), ISIS 666859 обеспечивает ED50 106 и 206 в поясничной ткани и корковой ткани (соответственно), тогда как ISIS 333611 обеспечивает ED50 401 и 786 в поясничной ткани и корковой ткани (соответственно) у SOD-1 трансгенных мышей при введении интрацеребровентрикулярного болюса 10, 30, 100, 300 или 700 мкг олигонуклеотида.

Например, как показано в примере 18 (ниже), ISIS 666859 обеспечивает оценку FOB 1,75, тогда как ISIS 333611 обеспечивает оценку FOB 6,5 у мышей C57bl6 через 3 часа после введения 700 мкг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у мышей, которым вводили ISIS 666859, по сравнению с мышами, которым вводили ISIS 333611.

ISIS 666919

Например, как показано в примере 12 (ниже), ISIS 666919 обеспечивает 76% ингибирование в поясничном отделе спинного мозга и 68% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Например, как показано в примере 14 (ниже), ISIS 666919 обеспечивает достижение оценки FOB 2, тогда как ISIS 333611 обеспечивает достижение оценки FOB 4 у крыс Спрага-Доули через 3 часа после введения 3 мг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у крыс, которым вводили ISIS 666919, по сравнению с крысами, которым вводили ISIS 333611.

Например, как показано в примере 15 (ниже), ISIS 666919 обеспечивает ED50 104,1 и 613,5 в поясничной ткани и шейной ткани (соответственно) у SOD-1 трансгенных крыс, которым интратекально вводили 10, 30, 100, 300 или 3000 мкг олигонуклеотида. ED50 в поясничной и шейной тканях не может быть рассчитан у трансгенных крыс, которым вводили ISIS 333611, поскольку наивысшая испытанная концентрация (3000 мкг) ингибирует мРНК человеческой SOD-1 более чем на 55-65%.

Например, как показано в примере 16 (ниже), в дозах 1 мг и 3 мг ISIS 666919 обеспечивает оценки FOB через 3 часа 1,3 и 3,5 (соответственно), тогда как ISIS 333611 обеспечивает оценки FOB 3,0 и 4,9 (соответственно). В дозах 1 мг и 3 мг ISIS 666919 обеспечивает оценки FOB через 8 недель 0,0 и 0,1 (соответственно), тогда как ISIS 333611 обеспечивает оценки FOB 0,0 и 1,2 (соответственно).

Например, как показано в примере 17 (ниже), ISIS 666919 обеспечивает ED50 168 в поясничной ткани, тогда как ISIS 333611 обеспечивает ED50 401 в поясничной ткани у SOD-1 трансгенных мышей при введении интрацеребровентрикулярного болюса 10, 30, 100, 300 или 700 мкг олигонуклеотида.

Например, как показано в примере 18 (ниже), ISIS 666919 обеспечивает оценку FOB 0,0, тогда как ISIS 333611 обеспечивает оценку FOB 6,5 у мышей C57bl6 через 3 часа после введения 700 мкг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у мышей, которым вводили ISIS 666919, по сравнению с мышами, которым вводили ISIS 333611.

ISIS 666921

Например, как показано в примере 12 (ниже), ISIS 66621 обеспечивает 71% ингибирование в поясничном отделе спинного мозга и 65% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Например, как показано в примере 14 (ниже), ISIS 66621 обеспечивает достижение оценки FOB 2, тогда как ISIS 333611 обеспечивает достижение оценки FOB 4 у крыс Спрага-Доули через 3 часа после введения 3 мг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у крыс, которым вводили ISIS 666919, по сравнению с крысами, которым вводили ISIS 333611.

ISIS 666922

Например, как показано в примере 12 (ниже), ISIS 666922 обеспечивает 67% ингибирование в поясничном отделе спинного мозга и 62% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Например, как показано в примере 14 (ниже), ISIS 666922 обеспечивает достижение оценки FOB 3, тогда как ISIS 333611 обеспечивает достижение оценки FOB 4 у крыс Спрага-Доули через 3 часа после введения 3 мг олигонуклеотида. Уровни микроглиального маркера (IBA1) и уровни астроцитарного маркера (GFAP) также снижены у крыс, которым вводили ISIS 666919, по сравнению с крысами, которым вводили ISIS 333611.

ISIS 666869

Например, как показано в примере 12 (ниже), ISIS 666869 обеспечивает 82% ингибирование в поясничном отделе спинного мозга и 81% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

ISIS 666870

Например, как показано в примере 12 (ниже), ISIS 666870 обеспечивает 76% ингибирование в поясничном отделе спинного мозга и 68% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Например, как показано в примере 15 (ниже), ISIS 666870 обеспечивает ED50 139,4 и 1111 в поясничной ткани и шейной ткани (соответственно) у SOD-1 трансгенных крыс, которым интратекально вводили 10, 30, 100, 300 или 3000 мкг олигонуклеотида. ED50 в поясничной и шейной тканях не может быть рассчитан у трансгенных крыс, которым вводили ISIS 333611, поскольку наивысшая испытанная концентрация (3000 мкг) ингибирует мРНК человеческой SOD-1 более чем на 55-65%.

Например, как показано в примере 17 (ниже), ISIS 666870 обеспечивает ED50 148 и 409 в поясничной ткани и корковой ткани (соответственно), тогда как ISIS 333611 обеспечивает ED50 401 и 786 в поясничной ткани и корковой ткани (соответственно) у SOD-1 трансгенных мышей при введении интрацеребровентрикулярного болюса 10, 30, 100, 300 или 700 мкг олигонуклеотида.

Например, как показано в примере 18 (ниже), ISIS 666870 обеспечивает оценку FOB 4,75, тогда как ISIS 333611 обеспечивает оценку FOB 6,5 у мышей C57bl6 через 3 часа после введения 700 мкг олигонуклеотида.

ISIS 666867

Например, как показано в примере 12 (ниже), ISIS 666867 обеспечивает 59% ингибирование в поясничном отделе спинного мозга и 48% в шейном отделе спинного мозга в модели SOD-1 трансгенных крыс после введения дозы 30 мкл 16,67 мг/мл раствора олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг), тогда как ISIS 333611 обеспечивает 51% ингибирование в поясничном отделе спинного мозга и 47% ингибирование в шейном отделе спинного мозга.

Некоторые композиции

1. ISIS 666853

В некоторых вариантах реализации ISIS 666853 охарактеризован как 5-10-5 МОЕ гэпмер, имеющий последовательность (от 5' к 3') CAGGATACATTTCTACAGCT (включенную в настоящий документ как SEQ ID NO: 725), где каждый из нуклеозидов 1-5 и 16-20 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, и каждый из нуклеозидов 6-15 представляет собой 2'-дезоксинуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 4-5, 16-17 и 18-19 представляют собой фосфодиэфирные связи, а межнуклеозидные связи между нуклеозидами 1-2, 3-4, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 17-18 и 19-20 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666853 описан следующей химической записью: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Те; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666853 описан следующей химической структурой:

2. ISIS 666859

В некоторых вариантах реализации ISIS 666859 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') TTAATGTTTATCAGGAT (включенную в настоящий документ как SEQ ID NO: 1351), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1-4 и 15-17 представляет собой 2'-O-метоксиэтилрибозный нуклеозид, где каждый из нуклеозидов 13 и 14 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 5-12 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 13-14, 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1 -2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666859 описан следующей химической записью: Tes Тео Aeo Aes Tds Gds Tds Tds Tds Ads Tds mCds Ako Gko Ges Aes Те; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666859 описан следующей химической структурой:

3. ISIS 666919

В некоторых вариантах реализации ISIS 666919 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') GGATACATTTCTACAGC (включенную в настоящий документ как SEQ ID NO: 1342), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1-4 и 16-17 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, где каждый из нуклеозидов 14 и 15 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 5-13 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 4-5 и 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1-2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666919 описан следующей химической записью: Ges Geo Aeo Тео Ads mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666919 описан следующей химической структурой:

4. ISIS 666921

В некоторых вариантах реализации ISIS 666921 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') GGATACATTTCTACAGC (включенную в настоящий документ как SEQ ID NO: 1342), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1-5 и 16-17 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, где каждый из нуклеозидов 14-15 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 6-13 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 4-5 и 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1 -2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666921 описан следующей химической записью: Ges Geo Aeo Тео Aes mCds Ads Tds Tds Tds mCds Tds Ads mCko Aks Ges mCe; где

А = аденин,

mC = 5'-метилцитозин

G = гуанин,

Т = тимин,

е = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666921 описан следующей химической структурой:

5. ISIS 666922

В некоторых вариантах реализации ISIS 666922 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') GGATACATTTCTACAGC (включенную в настоящий документ как SEQ ID NO: 1342), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1-4 и 15-17 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, где каждый из нуклеозидов 5 и 14 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 6-13 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 4-5 и 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1 -2, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666922 описан следующей химической записью: Ges Geo Aeo Тео Aks mCds Ads Tds Tds Tds mCds Tds Ads mCko Aes Ges mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666922 описан следующей химической структурой:

6. ISIS 666869

В некоторых вариантах реализации ISIS 666869 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') AGTGTTTAATGTTTATC (включенную в настоящий документ как SEQ ID NO: 1173), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1, 3, 14 и 16-17 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, где каждый из нуклеозидов 2, 4, 13 и 15 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 5-12 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 13-14 и 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1-2,4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11 -12, 12-13, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666869 описан следующей химической записью: Aes Gko Тео Gks Tds Tds Tds Ads Ads Tds Gds Tds Tko Teo Aks Tes mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар,

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666869 описан следующей химической структурой:

7. ISIS 666870

В некоторых вариантах реализации ISIS 666870 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') AGTGTTTAATGTTTATC (включенную в настоящий документ как SEQ ID NO: 1173), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1, 3, 13-17 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, где каждый из нуклеозидов 2 и 4 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 5-12 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 13-14 и 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1 -2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666870 описан следующей химической записью: Aes Gko Тео Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар.

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666870 описан следующей химической структурой:

8. ISIS 666867

В некоторых вариантах реализации ISIS 666867 охарактеризован как модифицированный олигонуклеотид, имеющий последовательность азотистых оснований (от 5' к 3') AGTGTTTAATGTTTATC (включенную в настоящий документ как SEQ ID NO: 1173), состоящую из семнадцати нуклеозидов, где каждый из нуклеозидов 1-2 и 13-17 представляет собой 2'-O-метоксиэтилрибозный модифицированный нуклеозид, где каждый из нуклеозидов 3 и 4 представляет собой cEt-модифицированный нуклеозид, где каждый из нуклеозидов 5-12 представляет собой 2'-дезоксирибонуклеозид, при этом межнуклеозидные связи между нуклеозидами 2-3, 3-4, 13-14 и 14-15 представляют собой фосфодиэфирные связи, а межнуклеозидные связи межу нуклеозидами 1-2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 15-16 и 16-17 представляют собой тиофосфатные связи, и при этом каждый цитозин представляет собой 5'-метилцитозин.

В некоторых вариантах реализации ISIS 666867 описан следующей химической записью: Aes Geo Tko Gks Tds Tds Tds Ads Ads Tds Gds Tds Teo Teo Aes Tes mCe; где

A = аденин,

mC = 5'-метилцитозин

G = гуанин,

T = тимин,

e = 2'-O-метоксиэтилрибозный модифицированный сахар,

k = cEt-модифицированный сахар,

d = 2'-дезоксирибозный сахар,

s = тиофосфатная межнуклеозидная связь, и

о = фосфодиэфирная межнуклеозидная связь.

В некоторых вариантах реализации ISIS 666867 описан следующей химической структурой:

ПРИМЕРЫ

Неограничивающее описание и включение посредством ссылки

Хотя некоторые соединения, композиции и способы, описанные в данном документе, были описаны в соответствии с некоторыми вариантами реализации изобретения, следующие примеры служат только для иллюстрации соединений, описанных в настоящем документе, и не подразумевают его ограничения. Каждая из ссылок, упоминаемых в настоящей заявке, включена в настоящий документ посредством ссылки в полном объеме.

Пример 1. Ингибирование человеческой растворимой супероксиддисмутазы 1 (SOD-1) в клетках HepG2 МОЕ гэпмерами

Были сконструированы модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту растворимой супероксиддисмутазы 1 (SOD-1), и были протестированы на их воздействие in vitro на мРНК SOD-1. В данный анализ включили также ISIS 146144, ISIS 146145, ISIS 150437, ISIS 150441, ISIS 150443, ISIS 150444, ISIS 150445, ISIS 150446, ISIS 150447, ISIS 150448, ISIS 150449, ISIS 150452, ISIS 150454, ISIS 150458, ISIS 150460, ISIS 150462-150467, ISIS 150470, ISIS 150472, ISIS 150474, ISIS 150475, ISIS 150476, ISIS 150479-150483, ISIS 150488, ISIS 150489, ISIS 150490, ISIS 150491-150493, ISIS 150495-150498, ISIS 150511, ISIS 333605, ISIS 333606, ISIS 333609-333617, ISIS 333619, ISIS 333620-333636, ISIS 333638 и ISIS 333640, описанные ранее в WO 2005/040180. ISIS 333611, описанный ранее в WO 2005/040180, также был выбран как эталон или олигонуклеотид сравнения. ISIS 333611 недавно был испытан в клинических испытаниях на людях. См. MILLER et al., "An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study" Lancet Neurol. (2013) 12(5): 435-442.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Культивированные клетки HepG2 с плотностью 20000 клеток на лунку трансфицировали с использованием электропорации с 7000 нМ модифицированного олигонуклеотида. После периода обработки длительностью около 24 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени.

Набор человеческих праймерных зондов RTS3898 (прямая последовательность CTCTCAGGAGACCATTGCATCA, обозначенная в настоящем документе как SEQ ID NO: 11; обратная последовательность TCCTGTCTTTGTACTTTCTTCATTTCC, обозначенная в настоящем документе как SEQ ID NO: 12; последовательность зонда CCGCACACTGGTGGTCCATGAAAA, обозначенная в настоящем документе как SEQ ID NO: 13) использовали для измерения уровней мРНК. Если олигонуклеотид перекрывался с ампликоном набора праймерных зондов, использовали альтернативный набор праймерных зондов, HTS90 (прямая последовательность CGTGGCCTAGCGAGTTATGG, обозначенная в настоящем документе как SEQ ID NO: 14; обратная последовательность GAAATTGATGATGCCCTGCA, обозначенная в настоящем документе как SEQ ID NO: 15; последовательность зонда ACGAAGGCCGTGTGCGTGCTGX, обозначенная в настоящем документе как SEQ ID NO: 16) для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток. «Н.д.» означает, что уровни ингибирования не были измерены с применением конкретного набора праймерных зондов.

Впервые сконструированные модифицированные олигонуклеотиды, указанные в представленных ниже таблицах, были сконструированы как 5-10-5 МОЕ гэпмеры. Гэпмеры 5-10-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из десяти 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Каждый нуклеозид сегмента 5' крыла и нуклеозид сегмента 3' крыла имеет 2'-МОЕ модификации. Межнуклеозидные связи в каждом гэпмере представляют собой тиофосфатные связи. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM 000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000). «н/д» означает, что модифицированный олигонуклеотид не направлен на указанную конкретную последовательность гена с 100% комплементарностью.

Пример 2: Ингибирование человеческого SOD-1 в HepG2 клетках МОЕ гэпмерами

Были сконструированы модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту растворимой супероксиддисмутазы 1 (SOD-1), и были протестированы на их воздействие in vitro на мРНК SOD-1. В данный анализ включили также ISIS 146143, ISIS 150438-150440, ISIS 150442, ISIS 150450, ISIS 150455-150457, ISIS 150459, ISIS 150461, ISIS 150469, ISIS 150473, ISIS 150478, ISIS 150484, ISIS 150486, ISIS 150494, ISIS 150508-150510, ISIS 333607, ISIS 333608, ISIS 333611, ISIS 333618, описанные ранее в WO 2005/040180. Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Культивированные клетки HepG2 с плотностью 20000 клеток на лунку трансфицировали с использованием электропорации с 5000 нМ модифицированного олигонуклеотида. После периода обработки длительностью около 24 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени.

Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Если олигонуклеотид перекрывался с ампликоном набора праймерных зондов, использовали альтернативный набор праймерных зондов, HTS90, для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток. «Н.д.» означает, что уровни ингибирования не были измерены с применением конкретного набора праймерных зондов.

Впервые сконструированные модифицированные олигонуклеотиды, указанные в представленных ниже таблицах, были сконструированы как 5-10-5 МОЕ гэпмеры. Гэпмеры 5-10-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из десяти 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Каждый нуклеозид сегмента 5' крыла и нуклеозид сегмента 3' крыла имеет 2'-МОЕ модификации. Межнуклеозидные связи в каждом гэпмере представляют собой тиофосфатные связи. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000). «н/д» означает, что модифицированный олигонуклеотид не направлен на указанную конкретную последовательность гена с 100% комплементарностью.

Пример 3: Ингибирование человеческого SOD-1 в HepG2 клетках дезокси, МОЕ и cEt гэпмерами

Были сконструированы модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту растворимой супероксиддисмутазы 1 (SOD-1), и были протестированы на их воздействие in vitro на мРНК SOD-1. ISIS 333611, описанный ранее в WO 2005/040180, также включили в испытание в качестве эталона. В данный анализ включили также ISIS 590067, ISIS 590074, ISIS 590082, ISIS 590130, ISIS 590138 и ISIS 590146, которые представляют собой 5-10-5 МОЕ гэпмеры, описанные выше в примере 1. В данное исследование включили также ISIS 590512, который имеет такую же последовательность, как ISIS 333611, но с дезокси, МОЕ и cEt модификациями сахара.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Культивированные клетки HepG2 с плотностью 20000 клеток на лунку трансфицировали с использованием электропорации с 3000 нМ модифицированного олигонуклеотида. После периода обработки длительностью около 24 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени.

Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток. «Н.д.» означает, что уровни ингибирования не были измерены.

Новые модифицированные олигонуклеотиды в представленных ниже таблицах были сконструированы как дезокси, МОЕ и cEt гэпмеры. Гэпмеры имеют 17 нуклеозидов в длину, где каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара в каждом олигонуклеотиде описана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар. Межнуклеозидные связи в каждом гэпмере представляют собой тиофосфатные связи. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000). «н/д» означает, что модифицированный олигонуклеотид не направлен на указанную конкретную последовательность гена с 100% комплементарностью.

Пример 4: Ингибирование человеческого SOD-1 в HepG2 клетках дезокси, МОЕ и cEt гэпмерами

Были сконструированы модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту растворимой супероксиддисмутазы 1 (SOD-1), и были протестированы на их воздействие in vitro на мРНК SOD-1. ISIS 333611, представляющий собой 5-10-5 МОЕ гэпмер, описанный ранее в WO 2005/040180, также включили в испытание в качестве эталона.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Культивированные клетки HepG2 с плотностью 20000 клеток на лунку трансфицировали с использованием электропорации с 4000 нМ модифицированного олигонуклеотида. После периода обработки длительностью около 24 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени.

Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью R.IBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток. «Н.д.» означает, что уровни ингибирования не были измерены.

Новые модифицированные олигонуклеотиды в представленных ниже таблицах были сконструированы как дезокси, МОЕ и cEt гэпмеры или 5-10-5 гэпмеры. Гэпмеры 5-10-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из десяти 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Каждый нуклеозид сегмента 5' крыла и нуклеозид сегмента 3' крыла имеет 2'-МОЕ модификации. Дезокси, МОЕ и cEt олигонуклеотиды имеют 17 нуклеозидов в длину, где каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара в каждом олигонуклеотиде описана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар. Межнуклеозидные связи в каждом гэпмере представляют собой тиофосфатные связи. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000). «н/д» означает, что модифицированный олигонуклеотид не направлен на указанную конкретную последовательность гена с 100% комплементарностью.

Пример 5: Ингибирование человеческого SOD-1 в HepG2 клетках дезокси, МОЕ и cEt гэпмерами

Были сконструированы модифицированные олигонуклеотиды, направленные на нуклеиновую кислоту SOD-1, и были протестированы на их воздействие in vitro на мРНК SOD-1. ISIS 333611, представляющий собой 5-10-5 МОЕ гэпмер, описанный ранее в WO 2005/040180, также включили в испытание в качестве эталона.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Культивированные клетки HepG2 с плотностью 20000 клеток на лунку трансфицировали с использованием электропорации с 5000 нМ модифицированного олигонуклеотида. После периода обработки длительностью около 24 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени.

Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток. «Н.д.» означает, что уровни ингибирования не были измерены.

Новые модифицированные олигонуклеотиды в представленных ниже таблицах были сконструированы как дезокси, МОЕ и cEt гэпмеры. Гэпмеры имеют 17 нуклеозидов в длину, где каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара в каждом олигонуклеотиде описана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар. Межнуклеозидные связи в каждом гэпмере представляют собой тиофосфатные связи. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000). «н/д» означает, что модифицированный олигонуклеотид не направлен на указанную конкретную последовательность гена с 100% комплементарностью.

Пример 6: Дозозависимое ингибирование человеческой SOD-1 модифицированными олигонуклеотидами в клетках HepG2

Гэпмеры из описанных выше исследований, демонстрирующие значительное ингибирование мРНК SOD-1 in vitro, были отобраны и протестированы в различных дозах на клетках HepG2. Испытывали также эталонное соединение ISIS 333611 и другие соединения, описанные ранее в WO 2005/040180, включая ISIS 146144, 146145, 150445, 150446, 150447, 150454, 150463, 150465, 333606, 333609 и 333611.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 20000 клеток на лунку и трансфицированы с использованием электропорации с концентрациями модифицированного олигонуклеотида, равными 0,813 мкМ, 1,625 мкМ, 3,250 мкМ, 6,500 мкМ и 13,000 мкМ, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Для каждого олигонуклеотида дополнительно приведена полумаксимальная ингибирующая концентрация (IC50). Уровни мРНК SOD-1 были существенно снижены дозозависимым образом в обработанных модифицированным олигонуклеотидом клетках.

Пример 7: Дозозависимое ингибирование человеческой SOD-1 модифицированными олигонуклеотидами в клетках HepG2

Гэпмеры из описанных выше исследований, демонстрирующие значительное ингибирование мРНК SOD-1 in vitro, были отобраны и протестированы в различных дозах на клетках HepG2. Испытывали также эталонное соединение ISIS 333611, и соединение ISIS 333625, которые были описаны ранее в WO 2005/040180.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 20000 клеток на лунку и трансфицированы с использованием электропорации с концентрациями модифицированного олигонуклеотида, равными 0,148 мкМ, 0,444 мкМ, 1,330 мкМ, 4,000 мкМ и 12,000 мкМ, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Наборы человеческих праймерных зондов RTS3898 или HTS90 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Для каждого олигонуклеотида дополнительно приведена полумаксимальная ингибирующая концентрация (IC50). Уровни мРНК SOD-1 были существенно снижены дозозависимым образом в обработанных модифицированным олигонуклеотидом клетках.

Пример 8: Дозозависимое ингибирование человеческой SOD-1 модифицированными олигонуклеотидами в клетках HepG2

Гэпмеры из описанных выше исследований, демонстрирующие значительное ингибирование мРНК SOD-1 in vitro, были отобраны и протестированы в различных дозах на клетках HepG2. Испытывали также эталонное соединение ISIS 333611, и дополнительные соединения, включая ISIS 146143, 150442, 195753, 333607 и 333608, которые были описаны ранее в WO 2005/040180.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 20000 клеток на лунку и трансфицированы с использованием электропорации с концентрациями модифицированного олигонуклеотида, равными 0,1875 мкМ, 0,7500 мкМ, 3,0000 мкМ и 12,0000 мкМ, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Для каждого олигонуклеотида дополнительно приведена полумаксимальная ингибирующая концентрация (IC50). Уровни мРНК SOD-1 были существенно снижены дозозависимым образом в обработанных модифицированным олигонуклеотидом клетках.

Пример 9: Дозозависимое ингибирование человеческой SOD-1 в клетках HepG2 гэпмерами со смешанным химическим составом остова

Были сконструированы дополнительные гэпмеры на основании последовательностей олигонуклеотидов, описанных в испытаниях, представленных выше. Олигонуклеотиды были сконструированы как 5-10-5 МОЕ, 5-8-5 МОЕ и дезокси, МОЕ и cEt олигонуклеотиды. Гэпмеры 5-10-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из десяти 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Гэпмеры 5-8-5 МОЕ имеют 18 нуклеозидов в длину, причем центральный сегмент гэп состоит из восьми 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Каждый нуклеозид сегмента 5' крыла и нуклеозид сегмента 3' крыла имеет 2'-МОЕ модификации. Дезокси, МОЕ и cEt олигонуклеотиды имеют 16 или 17 нуклеозидов в длину, где каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара в каждом олигонуклеотиде описана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар. Межнуклеозидные связи в каждом гэпмере представляют собой фосфодиэфирные или тиофосфатные связи. Межнуклеозидные связи каждого олигонуклеотида указаны в колонке «Химический состав остова», где «о» означает фосфодиэфирную связь, и «s» означает тиофосфатную связь. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000).

Новые сконструированные олигонуклеотиды испытывали в различных дозах в клетках HepG2. Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 20000 клеток на лунку и трансфицированы с использованием электропорации с концентрациями модифицированного олигонуклеотида, равными 0,222 мкМ, 0,667 мкМ, 2,000 мкМ и 6,000 мкМ, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Для каждого олигонуклеотида дополнительно приведена полумаксимальная ингибирующая концентрация (IC50). Уровни мРНК SOD-1 были существенно снижены дозозависимым образом в обработанных модифицированным олигонуклеотидом клетках.

Пример 10: Дозозависимое ингибирование человеческой SOD-1 гэпмерами со смешанным химическим составом остова

Были сконструированы дополнительные гэпмеры на основании последовательностей олигонуклеотидов, описанных в испытаниях, представленных выше. Олигонуклеотиды были сконструированы как дезокси, МОЕ и cEt олигонуклеотиды. Дезокси, МОЕ и cEt олигонуклеотиды имеют 16 или 17 нуклеозидов в длину, где каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара в каждом олигонуклеотиде описана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар. Межнуклеозидные связи в каждом гэпмере представляют собой фосфодиэфирные или тиофосфатные связи. Межнуклеозидные связи каждого олигонуклеотида указаны в колонке «Химический состав остова», где «о» означает фосфодиэфирную связь, и «s» означает тиофосфатную связь. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000).

Новые сконструированные олигонуклеотиды испытывали в различных дозах в клетках А431. Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 5000 клеток на лунку, и к указанной среде добавляли модифицированные олигонуклеотиды в концентрациях 0,12 мкМ, 0,60 мкМ, 3,00 мкМ и 15,00 мкМ модифицированного олигонуклеотида для свободного поглощения клетками, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Пример 11: Дозозависимое ингибирование человеческой SOD-1 гэпмерами со смешанным химическим составом остова

Были сконструированы дополнительные гэпмеры на основании последовательностей олигонуклеотидов, описанных в испытаниях, представленных выше. Олигонуклеотиды были сконструированы как 5-10-5 МОЕ, 4-8-5 МОЕ гэпмеры, 5-8-5 МОЕ гэпмеры, 5-8-7 МОЕ гэпмеры, 6-8-6 МОЕ гэпмеры, 6-9-5 МОЕ гэпмеры или дезокси, МОЕ и cEt олигонуклеотиды.

Гэпмеры 5-10-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из десяти 2'-дезоксинуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Гэпмеры 4-8-5 МОЕ имеют 17 нуклеозидов в длину, причем центральный гэп состоит из восьми 2'-дезоксирибонуклеозидов и окружен крыльями с 5' конца и в 3' конца, содержащими четыре и пять нуклеозидов соответственно. Гэпмеры 5-8-5 МОЕ имеют 18 нуклеозидов в длину, причем центральный сегмент гэп состоит из восьми 2'-дезоксинуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Гэпмеры 5-8-7 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из восьми 2'-дезоксинуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими пять и семь нуклеозидов, соответственно. Гэпмеры 6-8-6 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из восьми 2'-дезоксинуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по шесть нуклеозидов каждый. Гэпмеры 6-9-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из девяти 2'-дезоксинуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими шесть и пять нуклеозидов, соответственно. Каждый нуклеозид сегмента 5' крыла и нуклеозид сегмента 3' крыла имеет 2'-МОЕ модификации.

Дезокси, МОЕ и cEt олигонуклеотиды имеют 17 нуклеозидов в длину, где каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара в каждом олигонуклеотиде описана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар.

Межнуклеозидные связи в каждом гэпмере представляют собой фосфодиэфирные или тиофосфатные связи. Межнуклеозидные связи каждого олигонуклеотида указаны в колонке «Химический состав остова», где «о» означает фосфодиэфирную связь, и «s» означает тиофосфатную связь. Все остатки цитозина в каждом гэпмере представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленных ниже таблицах, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000).

Новые сконструированные олигонуклеотиды испытывали в различных дозах в клетках А431. Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 5000 клеток на лунку, и к указанной среде добавляли модифицированные олигонуклеотиды в концентрациях 0,062 мкМ, 0,185 мкМ, 0,556 мкМ, 1,667 мкМ, 5,000 мкМ и 15,000 мкМ модифицированного олигонуклеотида для свободного поглощения клетками, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Новые сконструированные олигонуклеотиды испытывали также в различных дозах в клетках SH-SY5Y. Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия культивирования. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Клетки были высеяны с плотностью 20000 клеток на лунку и трансфицированы модифицированными олигонуклеотидами с использованием электропорации с концентрациями модифицированного олигонуклеотида, равными 0,062 мкМ, 0,185 мкМ, 0,556 мкМ, 1,667 мкМ, 5,000 мкМ и 15,000 мкМ, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов, РНК выделяли из клеток и уровни мРНК SOD-1 измеряли методом количественной ПЦР в реальном времени. Набор человеческих праймерных зондов RTS3898 использовали для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток.

Пример 12: Ингибирование человеческой SOD-1 в модели трансгенных крыс

Гэпмеры из описанных выше исследований, включая эталонное соединение ISIS 333611, которое описано ранее в WO 2005/040180, испытывали в модели SOD-1 трансгенных крыс (Taconic, кат. №2148-F и 2148-М). Указанные гемизиготные крысы экспрессируют мутантную человеческую SOD-1 в спинном мозге.

Были сконструированы дополнительные гэпмеры на основании последовательностей олигонуклеотидов, описанных в испытаниях, представленных выше. Олигонуклеотиды были сконструированы как 5-9-5 МОЕ, 5-10-5 МОЕ гэпмеры или дезокси, МОЕ и cEt олигонуклеотиды. Гэпмеры 5-9-5 МОЕ имеют 19 нуклеозидов в длину, причем центральный сегмент гэп состоит из девяти 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Гэпмеры 5-10-5 МОЕ имеют 20 нуклеозидов в длину, причем центральный сегмент гэп состоит из десяти 2'-дезоксирибонуклеозидов и окружен сегментами крыльев с 5' конца и с 3' конца, содержащими по пять нуклеозидов каждый. Каждый нуклеозид сегмента 5' крыла и нуклеозид сегмента 3' крыла имеет 2'-МОЕ модификации. Дезокси, МОЕ и cEt олигонуклеотиды имеют 17 нуклеозидов в длину, причем каждый нуклеозид имеет МОЕ модификацию сахара, cEt модификацию сахара или дезокси-фрагмент. Химический состав сахара каждого олигонуклеотида указана в разделе «Химический состав», где «k» означает cEt-модифицированный сахар; «d» означает 2'-дезоксирибозу; и «е» означает 2'-МОЕ модифицированный сахар. Межнуклеозидные связи в каждом гэпмере представляют собой фосфодиэфирные или тиофосфатные связи. Межнуклеозидные связи каждого олигонуклеотида указаны в колонке «Химический состав остова», где «о» означает фосфодиэфирную связь, и «s» означает тиофосфатную связь. Все остатки цитозина в каждом олигонуклеотиде представляют собой 5-метилцитозины. «Сайт инициации» обозначает самый крайний 5' нуклеозид, на который направлен гэпмер в последовательности гена человека. «Сайт терминации» обозначает самый крайний 3' нуклеозид, на который направлен гэпмер в последовательности гена человека. Каждый гэпмер, перечисленный в представленной ниже таблице, нацелен на мРНК SOD-1 человека, обозначенную в данном описании как SEQ ID NO: 1 (с номером доступа GENBANK NM_000454.4) или на геномную последовательность SOD-1 человека, обозначенную в настоящем документе как SEQ ID NO: 2 (с номером доступа GENBANK NT_011512.10, усеченную с нуклеотида 18693000 по 18704000).

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия. Результаты каждого эксперимента представлены в отдельных таблицах, показанных ниже. Крысам интратекально вводили инъекции 30 мкл раствора с концентрацией 16,67 мг/мл модифицированного олигонуклеотида, разбавленного в PBS (конечная доза 500 мкг). Контрольной группе крыс интратекально вводили инъекции PBS. Оценивали ингибирование уровней SOD-1 в поясничном отделе спинного мозга, в грудном отделе спинного мозга и в шейном отделе спинного мозга. Данные представлены ниже и указывают, что некоторые модифицированные олигонуклеотиды обеспечивают ингибирование уровней человеческой SOD-1 в указанной модели.

Пример 13: Дозозависимое ингибирование человеческой SOD-1 модифицированными олигонуклеотидами в клетках LLC-MK2

Гэпмеры из описанных выше исследований, включая эталонное соединение ISIS 333611, демонстрирующие значительное ингибирование мРНК SOD-1 in vitro, были отобраны и протестированы в различных дозах на клетках LLC-MK2. Перекрестная реактивность человеческих модифицированных олигонуклеотидов, испытанных в данном исследовании, с геномной последовательностью резус-макак (комплемент последовательности с номером доступа GENBANK NW_001114168.1, усеченной с нуклеотида 2258000 по 2271000, обозначенной в настоящем документе как SEQ ID NO: 3), представлена в следующей таблице.

Клетки были высеяны с плотностью 20000 клеток на лунку и трансфицированы с использованием электропорации с концентрациями модифицированного олигонуклеотида, равными 0,078 мкМ, 0,156 мкМ, 0,313 мкМ, 0,625 мкМ, 1,25 мкМ, 2,50 мкМ, 5,00 мкМ и 10,00 мкМ, как указано в представленных ниже таблицах. После периода обработки длительностью около 16 часов РНК выделяли из клеток и измеряли уровни мРНК SOD-1 с помощью количественной ПЦР в реальном времени, используя набор праймерных зондов RTS3121 (прямая последовательность TGGAGATAATACACAAGGCTGTACCA, обозначенная в настоящем документе как SEQ ID NO: 17; обратная последовательность CAACATGCCTCTCTTCATCCTTT, обозначенная в настоящем документе как SEQ ID NO: 18; последовательность зонда ATCCTCTATCCAGACAACACGGTGGGC, обозначенная в настоящем документе как SEQ ID NO: 19) для измерения уровней мРНК. Уровни мРНК SOD-1 были скорректированы в соответствии с содержанием суммарной РНК, измеренным с помощью RIBOGREEN®. Результаты представлены как процентное ингибирование SOD-1 относительно необработанных контрольных клеток. Для каждого олигонуклеотида дополнительно приведена полумаксимальная ингибирующая концентрация (IC50). Как показано в таблице, некоторые из новых сконструированных олигонуклеотидов были более эффективными, чем эталон, ISIS 336611.

Пример 14: Переносимость модифицированных олигонуклеотидов, направленных на SOD-1, в крысиной модели

Гэпмеры из описанных выше исследований, включая эталонное соединение ISIS 333611, которое описано ранее в WO 2005/040180, испытывали на переносимость на крысах Спрага-Доули.

Модифицированные олигонуклеотиды были протестированы в серии экспериментов, которые имели аналогичные условия. Крысам интратекально вводили инъекции однократной дозы 3 мг олигонуклеотида ISIS. Контрольной группе крыс интратекально вводили инъекции PBS. Острую толерантность оценивали через 3 часа после введения дозы, используя батарею стандартных тестов (FOB). Указанную оценку используют для определения острой толерантности соединения, при этом более низкие значения означают соединения с лучшей переносимостью. Контрольные животные обычно имеют оценку «0» или «1». Через 3 часа после инъекции крыс изучали, помещая каждую крысу на крышку клетки и оценивая различные функции, присваивая значение «0» или «1» в зависимости от того, проявляет ли крыса нормальную функцию в рассматриваемой области (0) или нет (1) для каждой функции, а затем суммируя общие оценки. Оценивали семь областей, включая хвост, задние лапы, задние конечности, заднюю часть тела, положение груди и передних конечностей, передние лапы и голову. Результаты оценок представлены в следующей таблице. Как показано в таблице, некоторые из новых сконструированных олигонуклеотидов демонстрировали улучшенную острую толерантность по сравнению с эталоном, ISIS 333611.

Переносимость оценивали также через 8 недель после введения дозы, измеряя уровни IBA1, микроглиального маркера, и GFAP, астроцитарного маркера, в поясничном отделе спинного мозга. IBA1 и GFAP представляют собой маркеры воспаления ЦНС (Frank, MG, Brain Behav. Immun. 2007, 21, 47-59), следовательно, чем выше уровень любого маркера, тем менее переносимым является антисмысловый олигонуклеотид в указанной крысиной модели.

Уровни мРНК IBA1 измеряли с помощью набора праймерных зондов rAIF1_LTS00219 (прямая последовательность AGGAGAAAAACAAAGAACACCAGAA, обозначенная в настоящем документе как SEQ ID NO: 5; обратная последовательность CAATTAGGGCAACTCAGAAATAGCT, обозначенная в настоящем документе как SEQ ID NO: 6; последовательность зонда CCAACTGGTCCCCCAGCCAAGA, обозначенная в настоящем документе как SEQ ID NO: 7). Уровни мРНК GFAP измеряли с помощью набора праймерных зондов mGFAP_LTS00370 (прямая последовательность GAAACCAGCCTGGACACCAA, обозначенная в настоящем документе как SEQ ID NO: 8; обратная последовательность TCCACAGTCTTTACCACGATGTTC, обозначенная в настоящем документе как SEQ ID NO: 9; последовательность зонда TCCGTGTCAGAAGGCCACCTCAAGA, обозначенная в настоящем документе как SEQ ID NO: 10).

Результаты представлены в следующей таблице. Как показано в таблице, некоторые из новых сконструированных олигонуклеотидов были более переносимыми, чем эталон, ISIS 333611.

Пример 15: Дозозависимое ингибирование человеческой SOD-1 в модели трансгенных крыс

Гэпмеры из описанных выше исследований, включая эталонное соединение ISIS 333611, испытывали в модели SOD-1 трансгенных крыс (Taconic, кат. №2148-F и 2148-М). Указанные гемизиготные крысы экспрессируют мутантную человеческую SOD-1 в спинном мозге, во многих областях головного мозга и в периферических органах.

Крысам вводили интратекальные инъекции 10, 30, 100, 300, 1000 или 3000 мкг гэпмера, перечисленного в следующей таблице, или только PBS. Через две недели животных усыпили. Ингибирование мРНК SOD1 в поясничном отделе спинного мозга, в шейном отделе спинного мозга, в ростральном отделе коры в каудальном отделе коры головного мозга оценивали с помощью ПЦР в реальном времени, используя набор праймерных зондов RTS3898, описанный в примере 1. Данные представлены ниже как значения ED50 и демонстрируют, что указанные олигонуклеотиды ингибируют мРНК SOD-1 во многих тканях ЦНС более эффективно, чем Isis 333611. Действительно, значения ED50 для Isis №333611 даже не могут быть рассчитаны, как показано записью «н.д.», поскольку даже в максимальной испытанной концентрации (3000 мкг) оно не ингибирует мРНК SOD-1 более 55-65%. «Н.д.» означает, что для указанного образца нет доступных данных.

Пример 16: Переносимость модифицированных олигонуклеотидов, направленных на SOD-1, у крыс

Гэпмеры из описанных выше исследований, включая эталонное соединение ISIS 333611, испытывали на переносимость на крысах Спрага-Доули. Группам по 4-6 крыс вводили интратекальные инъекции однократной дозы 1 мг или 3 мг олигонуклеотида ISIS. Контрольной группе крыс интратекально вводили инъекции PBS. Острую толерантность оценивали через 3 часа после введения дозы, как описано в примере 14. Результаты для дозы 1 мг представляют собой средние значения для каждой группы после одного эксперимента. Результаты для дозы 3 мг представляют собой средние значения для каждой группы между двумя повторными экспериментами. Результаты исследования, представленные в следующей таблице, указывают, что некоторые из новых сконструированных олигонуклеотидов были более переносимыми, чем эталон, ISIS 333611.

Пример 17: Дозозависимое ингибирование человеческой SOD-1 в модели трансгенных мышей

Для подтверждения результатов, полученных у трансгенных крыс, на других видах, гэпмеры из описанных выше исследований испытывали в модели SOD-1 трансгенных мышей, которые экспрессируют такой же SOD1 мутантный ген человека G93A, как экспрессируют трансгенные крысы (см. примеры 12 и 15).

Мышам вводили интрацеребровентрикулярный болюс (ICVB) 10, 30, 100, 300 или 700 мкг гэпмера, перечисленного в следующей таблице, или PBS. Через две недели животных усыпили. Ингибирование мРНК SOD-1 в поясничном отделе спинного мозга и в коре головного мозга оценивали с помощью ПЦР в реальном времени, используя набор праймерных зондов RTS3898, описанный в примере 1. Данные представлены ниже как значения ED50 и демонстрируют, что указанные олигонуклеотиды ингибируют мРНК SOD-1 более эффективно, чем Isis 333611, и у крыс, и у мышей.

Пример 18: Переносимость модифицированных олигонуклеотидов, направленных на SOD-1, у мышей

Гэпмеры из описанных выше исследований, включая эталонное соединение ISIS 333611, испытывали на переносимость на мышах C57bl6. В желудочек мозга мышей стереотаксически вводили инъекцию однократной дозы 700 мкг олигонуклеотида ISIS. Контрольной группе мышей в желудочек мозга вводили инъекцию PBS. Острую толерантность оценивали через 3 часа после инъекции, используя батарею стандартных тестов (FOB), отличную от батареи, использованной для крыс. Каждую мышь оценивали в соответствии с 7 различными критериями. 7 критериев представляют собой: (1) мышь была бодрой, бдительной и отзывчивой; (2) мышь стояла или сгибалась без раздражителя; (3) мышь выполняет любое движение без раздражителя; (4) мышь демонстрирует движение вперед после того, как ее подняли; (5) мышь демонстрирует любое движение после того, как ее подняли; (6) мышь реагирует на щипок за хвост; (7) ровное дыхание. Для каждого из 7 различных критериев, каждой мыши начисляли балл 0, если она отвечала критерию, или 1 если она не отвечала ему. После оценки всех 7 критериев суммировали промежуточные оценки для каждой мыши, а затем усредняли для каждой группы. Например, если мышь была бодрой, бдительной и отзывчивой через 3 часа после ICV введения дозы 700 мкг, и соответствовала всем остальным критериям, она получала суммарный балл 0. Если другая мышь не была бодрой, бдительной и отзывчивой через 3 часа после ICV введения дозы 700 мкг, но соответствовала всем остальным критериям, она получала суммарный балл 1. Мыши, которым вводили физраствор, как правило, получали 0 баллов. Очки в верхней части диапазона будут свидетельствовать об острой токсичности.

Массу тела измеряли в течение всего исследования, и значения представлены ниже как процентное изменение через 8 недель относительно исходного значения. Долгосрочную толерантность оценивали через 8 недель после введения дозы, измеряя уровни IBA1 и GFAP, как описано в примере 14. Уровни мРНК IBA1 и GFAP записаны относительно животных, которым вводили PBS. Результаты исследования, представленные в следующих таблицах, демонстрируют, что некоторые из новых разработанных олигонуклеотидов были более переносимыми у крыс и мышей по сравнению с эталоном, ISIS 333611.

Пример 19: Дозозависимое ингибирование обезьяньей SOD-1 у яванских макак

Isis №666853 испытывали на яванских макаках. Существует одно рассогласование между Isis №666853 и SOD-1 яванских макак, и существует 17 последовательных оснований в Isis №666853, которые на 100% комплементарны SOD-1 яванских макак.

Группам по 6-10 самцов и самок обезьян вводили интратекальный болюс в поясничном отделе PBS или 4, 12 или 35 мг Isis №666853 на 1, 14, 28, 56 и 84 день исследования. Каждой группе вводили одинаковую дозу в каждый из пяти дней введения доз. На 91 день животных усыпили. Ингибирование мРНК SOD-1 в поясничном отделе, в грудном отделе и в шейном отделе спинного мозга, а также в лобной доле, двигательной зоне коры головного мозга, в гиппокампе, в варолиевом мосте и мозжечке оценивали с помощью ПЦР в реальном времени, используя набор праймерных зондов RTS3898. Данные представлены ниже как среднее процентное ингибирование для каждой экспериментальной группы относительно группы, обработанной PBS. Результаты демонстрируют, что Isis №666853 обеспечивал ингибирование мРНК SOD-1 в многочисленных тканях-мишенях яванских макак.

Лечение с применением 666853 хорошо переносилось в течение 13 недель исследования и не вызывало клинических признаков неблагоприятных реакций у обезьян.

1. Соль антисмыслового соединения для снижения экспрессии супероксиддисмутазы 1 (SOD-1), где анион антисмыслового соединения имеет следующую формулу:

2. Соль антисмыслового соединения по п.1, при этом соль представляет собой соль натрия.

3. Антисмысловое соединение для снижения экспрессии супероксиддисмутазы 1 (SOD-1), где антисмысловое соединение имеет следующую формулу:

mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Те (последовательность азотистых оснований SEQ ID NO: 725); где

A=аденин,

mC=5-метилцитозин,

G=гуанин,

T=тимин,

е=2'-O-метоксиэтилрибозный модифицированный сахар,

d=2'-дезоксирибозный сахар,

s=тиофосфатная межнуклеозидная связь и

о=фосфодиэфирная межнуклеозидная связь

или его фармацевтически приемлемая соль.

4. Антисмысловое соединение для снижения экспрессии супероксиддисмутазы 1 (SOD-1), где антисмысловое соединение имеет следующую формулу:

или его фармацевтически приемлемая соль.

5. Антисмысловое соединение по п. 3 или 4.

6. Фармацевтически приемлемая соль антисмыслового соединения по п. 3 или 4.

7. Фармацевтическая композиция для снижения экспрессии супероксиддисмутазы 1 (SOD-1), содержащая соль антисмыслового соединения по п.1 или 2, антисмысловое соединение или фармацевтически приемлемую соль по п. 3 или 4, антисмысловое соединение по п. 5 или фармацевтически приемлемую соль по п. 6 и по меньшей мере один из фармацевтически приемлемого носителя или разбавителя.

8. Фармацевтическая композиция по п. 7, при этом фармацевтически приемлемый разбавитель представляет собой фосфатно-солевой буферный раствор (PBS).

9. Фармацевтическая композиция по п. 7 или 8, которая составлена для интратекального введения.

10. Применение соли по п. 1 или 2, антисмыслового соединения или фармацевтически приемлемой соли по п. 3 или 4, антисмыслового соединения по п. 5, фармацевтически приемлемой соли по п. 6 или фармацевтической композиции по пп. 7, 8 или 9 для изготовления лекарственного средства для лечения или предупреждения нейродегенеративного расстройста, связанного с SOD-1.

11. Применение соли по п. 1 или 2, антисмыслового соединения или фармацевтически приемлемой соли по п. 3 или 4, антисмыслового соединения по п. 5, фармацевтически приемлемой соли по п.6 или фармацевтической композиции по пп. 7, 8 или 9 для изготовления лекарственного средства для лечения связанного с SOD-1 амиотрофического латерального склероза (ALS).

12. Применение соли по п. 1 или 2, антисмыслового соединения или фармацевтически приемлемой соли по п. 3 или 4, антисмыслового соединения по п. 5, фармацевтически приемлемой соли по п.6 или фармацевтической композиции по пп. 7, 8 или 9 для изготовления лекарственного средства для предупреждения связанного с SOD-1 ALS.

13. Применение по любому из пп. 10-12, где лекарственное средство вводят интратекально.

14. Способ лечения или предупреждения нейродегенеративного расстройста, связанного с SOD-1, включающий введение, нуждающемуся в этом человеческому субъекту, терапевтически эффективного количества соли по п. 1 или 2, антисмыслового соединения или фармацевтически приемлемой соли по п. 3 или 4, антисмыслового соединения по п. 5, фармацевтически приемлемой соли по п.6 или фармацевтической композиции по пп. 7, 8 или 9.

15. Способ лечения связанного с SOD-1 ALS, включающий введение, нуждающемуся в этом человеческому субъекту, терапевтически эффективного количества соли по п. 1 или 2, антисмыслового соединения или фармацевтически приемлемой соли по п. 3 или 4, антисмыслового соединения по п. 5, фармацевтически приемлемой соли по п. 6 или фармацевтической композиции по пп. 7, 8 или 9.

16. Способ предупреждения связанного с SOD-1 ALS, включающий введение, нуждающемуся в этом человеческому субъекту, терапевтически эффективного количества соли по п. 1 или 2, антисмыслового соединения или фармацевтически приемлемой соли по п. 3 или 4, антисмыслового соединения по п. 5, фармацевтически приемлемой соли по п.6 или фармацевтической композиции по пп. 7, 8 или 9.

17. Способ по любому из пп. 14-16, где антисмысловое соединение, фармацевтически приемлемую соль или фармацевтическую композицию вводят интратекально.



 

Похожие патенты:

Изобретение относится к медицине и предназначено для лечения заболеваний нервной системы. Раскрыто использование водорастворимых производных фуллерена С60 в производстве лекарственных препаратов нейропротекторного действия.

Группа изобретений относится к фармацевтической комбинации с анксиолитическим действием. Комбинация с анксиолитическим действием для лечения невротических и психических расстройств включает феназепам, витамин В6 и магний и представляет собой набор лекарственных форм, включающих феназепам, витамин В6 и магний в эффективных количествах, либо представляет собой единую лекарственную форму, причем в лекарственной форме, содержащей феназепам, содержится 0,1-10 мг феназепама, в лекарственной форме, содержащей витамин В6, содержится 0,1-600 мг витамина В6, в лекарственной форме, содержащей магний, содержится 10-1200 мг магния.

Изобретение относится к химико-фармацевтической промышленности и медицине и касается новой жидкой лекарственной формы для перорального введения, обладающей ноотропной активностью, содержащей в качестве активного компонента кальциевую соль гопантеновой кислоты в количестве 5-20 мас.%, парабен в количестве 0,1-0,5 мас.%, а также вспомогательные вещества – остальное до 100%.

Изобретение относится к новому производному пиримидина общей формулы (1), обладающему свойствами модулятора глутаматного ионотропного рецептора АМРА-типа. Соединения могут найти применение для лечения нейродегенеративных и психоневрологических заболеваний, опосредованных активностью глутаматного ионотропного рецептора АМРА-типа.

Изобретение относится к медицине, а именно к кардиологии, и к фармацевтической промышленности. Предложен способ лечения когнитивных нарушений больных острым инфарктом миокарда, включающий введение эффективного количества полипренолов формулы (1) в течение 48 часов от начала заболевания.

Изобретение относится к новым производным 1,4-бензодиазепин-2-она формулы I, ограниченным следующими вариантами структуры 1-6: Технический результат: получены новые соединения формулы I, обладающие наряду с выраженными анальгетическими свойствами анорексигенными и анксиолитическими.

Группа изобретений относится к медицине. Предложены: применение ботулинического токсина для лечения паратонии у пациента пожилого возраста с когнитивным нарушением в результате болезни Альцгеймера или деменции и соответствующий способ лечения паратонии у данных групп пациентов.

Изобретение относится к медицине, в частности к составу, обладающему ноотропной активностью, фармацевтической композиции и лекарственному средству. Предложенный состав, содержащий N-карбамоилметил-4-фенил-2-пирролидон и, по меньшей мере, одно дополнительное соединение, выбранное из группы, включающей 4-фенилпирролидон-2, 2-(2-оксо-4-фенилпирролидин-1-ил)уксусную кислоту, этил-2-(2-оксо-4-фенилпирролидин-1-ил)ацетат и их оптические изомеры.

Группа изобретений (варианты) относится к фармакологии и медицине. Предложено применение лиганда транслокаторного белка (TSPO) N-бензил-N-метил-1-фенилпирроло[1,2-а]пиразин-3-карбоксамида (ГМЛ-1) в качестве антидепрессантного и ноотропного средства.

Изобретение относится к фармацевтической промышленности, а именно к способу лечения и/или профилактики нейродегенеративного расстройства или заболевания у страдающего от него субъекта.

Изобретение относится к биохимии и медицине. Предложено соединение для применения в трансмембранной доставке лекарственного средства, имеющее структуру (VI), (VII), (VIIa), (VIII), (IX) или (IXa), как указано в формуле.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложено применение вириона рекомбинантного аденоассоциированного вируса (rAAV), который содержит полинуклеотид, который кодирует растворимый белок, который содержит домен VEGFR-1 (Flt-1), способный модулировать активность VEGF, при получении композиции для лечения дегенерации желтого пятна у субъекта-человека посредством доставки не более 2×109 вирионов rAAV в глаз страдающего указанным заболеванием субъекта.

Настоящее изобретение относится к биотехнологии. Предложены композиции и системы, содержащие векторы, включающие полинуклеотидные последовательности, кодирующие компоненты комплекса CRISPR-Cas типа II, а также набор, содержащий одну из таких композиций или систем.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение для ингибирования экспрессии фактора комплемента В (CFB) (варианты), фармацевтическую композицию для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, способ лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента у субъекта, применение вышеуказанного соединения или композиции для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента, применение вышеуказанного соединения или композиции при изготовлении лекарственного средства для лечения заболевания, связанного с дисрегуляцией альтернативного пути комплемента.

Изобретение относится к области биотехнологии, конкретно к иммуногенным эпитопам URLC10, и может быть использовано в медицине для лечения пациента, страдающего раком.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая соединение, специфически ингибирующее экспрессию нуклеиновой кислоты аро(а) и/или белка аро(а), композиция для лечения, предупреждения или замедления прогрессирования заболевания, связанного с повышенной экспрессией аро(а) и/или повышенной экспрессией Lp(a), содержащая терапевтически эффективное количество соединения, cпособ предупреждения, лечения, облегчения или замедления прогрессирования заболевания, связанного с повышенной экспрессией аро(а) и/или повышенной экспрессией Lp(a), включающий введение животному вышеуказанного соединения или композиции.

Изобретение относится к эпитопным пептидам, полученным из CDCA1, со способностью индуцировать цитотоксические T-клетки. Настоящее изобретение дополнительно относится к полинуклеотидам, кодирующим пептиды, антигенпрезентирующим клеткам, презентирующим пептиды, и цитотоксическим T-клеткам, нацеленным на пептиды, а также к способам индуцирования антигенпрезентирующих клеток или ЦТЛ.

Изобретение относится к эпитопным пептидам, полученным из KOC1, со способностью индуцировать цитотоксические T-клетки. Настоящее изобретение дополнительно относится к полинуклеотидам, кодирующим пептиды, антигенпрезентирующим клеткам, презентирующим пептиды, и цитотоксическим T-клеткам, нацеленным на пептиды, а также к способам индуцирования антигенпрезентирующих клеток или ЦТЛ.
Изобретение относится к области медицины, кардиологии и генной терапии. Предложено средство для лечения атеросклероза, представляющее собой композицию для подавления экспрессии генов IL7R, IL7, TIGIT, CXCL8, F2RL1, EIF2AK3, TSPYL2, ANXA1, DUSP1 и IL15, тесно связанных с накоплением холестерина макрофагами человека.

Изобретение относится к области биотехнологии, конкретно к векторам на основе серотипа AAV-Rh74 аденоассоциированного вируса (AAV), содержащим полинуклеотидную последовательность, кодирующую фактор IX человека, и может быть использовано в медицине.

Изобретение относится к области биохимии. Описан ДНК-аптамер, обладающий способностью связываться с протромбином, характеризующийся следующей нуклеотидной последовательностью: где X в восьмой позиции представляет собой нуклеотид G, или С, или Т; а в 24 и 25 позиции – А, или С, или Т.

Группа изобретений относится к медицине и касается антисмыслового соединения для снижения экспрессии супероксиддисмутазы 1, где антисмысловое соединение имеет следующую формулу: mCes Aeo Ges Geo Aes Tds Ads mCds Ads Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Те или его фармацевтически приемлемой соли. Группа изобретений также касается фармацевтической композиции для снижения экспрессии супероксиддисмутазы 1, содержащей указанное антисмысловое соединение или его фармацевтически приемлемую соль; способа лечения или предупреждения связанного с SOD-1 нейродегенеративного расстройства или связанного с SOD-1 ALS, включающего введение указанного антисмыслового соединения или его фармацевтически приемлемой соли. Группа изобретений обеспечивает лечение или предупреждение связанного с SOD-1 нейродегенеративного расстройства или связанного с SOD-1 ALS. 12 н. и 5 з.п. ф-лы, 19 пр., 71 табл.

Наверх