Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-рнк



Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-рнк
Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-рнк
Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-рнк
Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-рнк
Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-рнк
C12N15/00 - Получение мутаций или генная инженерия; ДНК или РНК, связанные с генной инженерией, векторы, например плазмиды или их выделение, получение или очистка; использование их хозяев (мутанты или микроорганизмы, полученные генной инженерией C12N 1/00,C12N 5/00,C12N 7/00; новые виды растений A01H; разведение растений из тканевых культур A01H 4/00; новые виды животных A01K 67/00; использование лекарственных препаратов, содержащих генетический материал, который включен в клетки живого организма, для лечения генетических заболеваний, для генной терапии A61K 48/00 пептиды вообще C07K)

Владельцы патента RU 2709651:

федеральное государственное бюджетное учреждение "Ростовский научно-исследовательский онкологический институт" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к области биотехнологии и медицины. Предложен способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию, с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR, MSI1, PSMC4, ТВР, RPLO, и микро-РНК hsa-miR-92-1-5р, hsa-miR-126-5p, hsa-miR-7-5p, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е с использованием трех высокоспецифичных референсных генов: PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микро-РНК: hsa-miR-126-5р, hsa-miR-7-5p, сравнивают полученные значения Е в опухолевой ткани с контрольными и при значениях EEGFR<0,5 или EEGFR>1,5, EMSI1<0,5 или EMSI1>1,5, Ehsa-miR-92a-1-5p<0,5 или Ehsa-miR-92a-1-5p>1,5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности. Изобретение позволяет эффективно дифференцировать глиомы в медицине. 2 табл., 3 пр.

 

Изобретение относится к медицине, а именно, к молекулярной биологии, онкологии, и может найти применение для оперативного определения степени злокачественности глиальной опухоли головного мозга.

Глиомы - инвазивные опухоли мозга, характеризующиеся высокими уровнями рецидивирования и смертности. Морфологически глиомы подразделяют на астроцитомы, олигодендроглиомы и смешанные олиго-астроцитомы. Приблизительно 70% всех глиом относятся к злокачественным; на этом фоне лишь 20% пациентов с данным заболеванием преодолевают 5-летний рубеж выживаемости (Wen P.Y., Kesari S. Malignant gliomas in adults. N. Engl. J. Med. 2008; 359: 492-507). Согласно классификации ВОЗ, по степени злокачественности (I-IV) глиомы дифференцируют на следующие группы: I (пилоцитарные астроцитомы), II (глиомы низкой степени злокачественности), III (глиомы высокой степени степени злокачественности), IV (глиобластомы).

Классификация глиом базируется на данных цитологического и гистологического исследования биоптата опухоли, полученного после хирургического удаления или стереотаксической биопсии. В целом диагностика достаточно трудоемкая, требующая высокого профессионализма врача-патогистолога и занимает продолжительное время (6-7 суток). Во многих случаях в силу труднодоступной локализации и разнородности структуры глиом затруднительно точно установить степень злокачественности опухоли. В последние десятилетия достижения молекулярной генетики широко внедряются в онкологическую практику, в том числе для диагностических и прогностических целей. Вводимая в широкую клиническую практику молекулярная классификация глиом, также как разрабатываемые панели биомаркеров повышают прогностическую и предиктивную способность традиционной гистопатологической шкалы. Учитывая быстро меняющийся ландшафт омиксных технологий, следует ожидать транслирование полногеномных данных в улучшенные виды терапии и прогностических средств для пациентов со злокачественными опухолями мозга (см. Кит ОИ., Водолажский Д.И., Расторгуев Э.Е., Франциянц Е.М., Поркшеян Д.Х., Панина С.Б. Мультиформная глиобластома: патогенез и молекулярные маркеры // Вопросы онкологии. 2017. Т. 63. №5. С. 694-701).

Одним из значимых сигнальных путей в развитии глиобластом является путь EGFR - рецептора эпидермального фактора роста из семейства рецепторных тирозинкиназ. Аберрантная экспрессия гена EGFR приводит к конститутивной активации одноименного каскада, что, в последствии, инициирует процессы злокачественнной трансформации в большинстве опухолей (Afif S.H., Pandith А.А., Bhat A.R. et al. EGFR and PTEN gene mutation status in glioblastoma patients and their prognostic impact on patient's survival // J. Carcinog. Mutagen. - 2015. - Vol. 6. - P. 218.). Это позволяет использовать показатель изменения экспрессии гена EGFR как молекулярный маркер степени злокачественности опухоли. MSI1 - это маркер нейрональных стволовых клеток, регулирующий баланс между самообновлением и терминальной дифференцировкой клеток. Изменение экспрессии этого гена ассоциируется с развитием опухолей головного мозга (Glazer RI, Vo DT, Penalva LO (2012). Musashil: an RBP with versatile functions in normal and cancer stem cells. Frontiers in Bioscience. 17: 54-64.). Hsa-miR-92a-1-5p - микроРНК, регулирующая экспрессию гена MSI1 на посттранскрипционном этапе (targetscan.com).

Анализ патентных источников показал наличие следующих изобретений близких по тематике к заявленному:

1) «Способ диагностики, прогнозирования и лечения глиомы» (см. заявка на изобретение 2008129028/14, опубл. 27.01.2010). Авторами предложено проводить иммуно-гистологическое исследование на послеоперационном опухолевом материале, в результате которого оценивается степень злокачественности глиомы. Согласно классификации глиом 2016 года (см. Louis D.N. et al. WHO Classification of Tumors of the Central Nervous System. 2016 //IARC: Lyon.) иммуно-гистологическое исследование злокачественных новообразований мозга должно войти в рутинную практику гистологической верификации окончательного диагноза ЗНО мозга. Тем не менее, возможность оперативного, менее дорогого способа G-дифференциации глиом с помощью маркеров экспрессии генов может стать эффективным скрининговым методом, в т.ч. на стадии стереотаксической биопсии. Однако на фоне менее затратного подхода продолжительность заявленного способа занимает 5-7 дней, что не дает преимуществ в оперативности получаемых результатов.

2) «Способ дифференциальной диагностики глиом головного мозга человека» (см. заявка на изобретение 2015108718/10, опубл. 10.05.2016). Авторами предложено проводить молекулярно-генетическое исследование относительной экспрессии 10-ти микроРНК на послеоперационном опухолевом материале, в результате которого оценивается степень злокачественности глиомы. Отметим, что предложенный авторами показатель относительной экспрессии рассчитывался с использованием Только одного референсного гена, подобранного по литературным данным, без валидации для конкретных условий. Референсные гены - маркеры внутреннего контроля, необходимые для нормализации данных исследуемых локусов с целью нивелирования влияния биологических различий. Во многих исследованиях было продемонстрировано, что не существует единого гена внутреннего контроля, поэтому для нормализации результатов RT-PCR рекомендуется использовать более одного эталонного гена, а обеспечение точных и надежных результатов требует предварительной проверки выбранных референсных генов (см. Hellemans J., Vandesompele J. Selection of Reliable Reference Genes for RT-qPCR Analysis. In: Biassoni R., Raso A. (eds) Quantitative Real-Time PCR. Methods in Molecular Biology (Methods and Protocols), vol 1160. 2014; см. Humana Press, New York, NY; Wang X., Fu Y., Ban L., Wang Z., Feng G., Li J., Gao H. Selection of reliable reference genes for quantitative real-time RT-PCR in alfalfa // Genes Genet. Syst., 2015, 90, p. 175-180).

Определяющими отличиями заявляемого способа, по сравнению с прототипом, являются:

- метод основан на сравнении относительной экспрессии экспериментально подобранной комбинации двух генов EGFR, MSI1 и одной микроРНК hsa-miR-92a-1-5p, которая таргетирует уровень мРНК гена MSI1 в клетке, что позволяет удешевить, упростить и значительно ускорить процедуру тестирования, а также провести анализ на небольшом количестве биопсийного материала;

- определение уровня экспрессии в образцах ткани проводят методом RT-PCR в реальном времени с использованием двух референсных микроРНК (hsa-miR-126-5p и hsa-miR-7-5p) и трех референсных генов (PSMC, ТВР, RPLO), подобранных с использованием программного обеспечения «GENorm», genorm.cmgg.be), с последующим геометрическим усреднением, что повышает точность и чувствительность тестирования;

- заключение о типе глиальной опухоли делают на основании тестирования образцов условно нормальной контрольной ткани (перифокальная зона) и опухолевой ткани головного мозга, что позволяет учитывать индивидуальные различия и гетерогенность глиом.

В предварительных исследованиях был выявлен широкий диапазон варьирования уровня экспрессии как онко-ассоциированных генов, так и таргетирующих их микроРНК. Данные относительной экспрессии двух генов и одной микроРНК оптимально дифференцировали глиомы II, III и IV степени злокачественности.

Техническим результатом заявляемого изобретения является создание нового, эффективного, специфичного способа дифференциальной диагностики глиом низкой степени злокачественности II и глиом высокой степени злокачественности III, IV согласно гистологическим критериям.

Технический результат достигается тем, что на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR, MSI1, PSMC4, ТВР, RPLO и микроРНК hsa-miR-92-1-5p, hsa-miR-126-5p, -hsa-miR-7-5p, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е для генов EGFR, MSI1 и микроРНК hsa-miR-92-1-5p с использованием трех высокоспецифичных референсных генов PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микроРНК hsa-miR-126-5p, hsa-miR-7-5p и при значениях EEGFR<0.5 или EEGFR>1.5, EMSI1<0.5 или EMSI1>1.5, Ehsa.miR-92a-1-5p<0.5 или Ehsa.miR-92a-1-5p>1.5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности; коэффициент Е рассчитывают по формуле: где ΔCt (опухоль) - относительная экспрессия генов и микро-РНК в ткани глиом, где ΔCt(контроль) - относительная экспрессия генов и микро-РНК в ткани перифокальной зоны; при этом относительную экспрессию генетических локусов рассчитывают по формуле ΔCt = 2-(Ct целевого гена-Ct референсных генов), где Сtцелевого гена - среднее по трем повторам для целевых локусов EGFR или MSI1 и где Сtреференсных генов - среднее геометрическое значение референсных генов PSMC4, ТВР, RPLO; относительную экспрессию микро-РНК рассчитывают по формуле ΔCt = 2-(Ct целевой микроРНК-Ct референсных микроРНК), где Ct целевой микроРНК - среднее по трем повторам для микроРНК hsa-miR-92-1-5р и где Сtреференсных микроРНК - среднее геометрическое значение референсных микроРНК hsa-miR-126-5p, hsa-miR-7-5p.

Способ основан на патогенетическом факторе канцерогенеза - аберрантной экспрессии генов, ассоциированных с инициацией и развитием злокачественного процесса, что приводит к прогрессированию опухоли.

Заявленный способ включает следующие этапы: отбор биоматериала интраоперационно, выделение тотальной РНК из тканевых проб; проведение обратной транскрипции для наработки кДНК, RT-PCR полученной кДНК в присутствии специфичных праймеров; обработку данных для оценки изменения относительной экспрессии в опухолевых образцах, относительно контрольных.

Заявляемый способ осуществляется следующим образом.

У пациента производят отбор биоматериала интраоперационно. Образцы опухолевой ткани и перифокальной зоны замораживают в жидком азоте или фиксируют в РНК-среде для транспортировки в лабораторию и дальнейшего хранения.

Выделение тотальной РНК из ткани проводят подходящим методом экстракции. Выделенную РНК подвергают обратной транскрипции. Обратная транскрипция микроРНК проводится одновременно с полиаденилированием РНК, с использованием специфичных RT-праймеров. Последовательности RT-праймеров микроРНК, подобранные по литературным источникам (Balcells I., Cirera S., Busk P.K. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers //BMC biotechnology. - 2011. - Т. 11. - №.1. - C. 70; MirBase (http://www.mirbase.org/)), указаны в таблице 1.

Анализируемые последовательности генетических локусов амплифицируют в 20 мкл PCR-смеси, содержащей 1х PCR-буфер, 0,25 mM dNTPs, 2 мМ MgCl2, 1 ед.акт. Taq-DNA-полимеразы, по 0,5 мкМ прямого и обратного праймеров. Оптимизированные условия амплификации и последовательности PCR-праймеров собственного дизайна, подобранные с использованием баз данных MirBase, NCBI GenBank и программы Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, приведены в таблице

2. Постановку RT-PCR каждого образца проводят в трех повторах.

Для оценки изменения относительной экспрессии в опухолевой ткани по сравнению с условно нормальной контрольной тканью для каждого локуса рассчитывают коэффициент Е по формуле где ΔCt(опухоль) - относительная экспрессия генов и микро-РНК в ткани глиом, где ΔCt(контроль) - относительная экспрессия генов и микро-РНК в ткани перифокальной зоны; при этом относительную экспрессию генетических локусов рассчитывают по формуле ΔCt=2-(Сtцелевого гена-Ct референсных генов) - где Сtцелевого гена - среднее по трем повторам для целевых локусов EGFR или MSI1 и где Сtреференсных генов - среднее геометрическое значение референсных генов PSMC4, ТВР, RPLO; относительную экспрессию микро-РНК рассчитывают по формуле ΔCt = 2-(Сtцелевой микроРНК-Сtреференсных микроРНК), где Сtцелевой микроРНК - среднее по трем повторам для микроРНК hsa-miR-92-1-5р и где Сtреференсных микроРНК - среднее геометрическое значение референсных микроРНК hsa-miR-126-5p, hsa-miR-7-5p.

При значениях EEGFR<0.5 или EEGFR>1.5, EMSI1<0.5 или EMSI1>1.5, Ehsa-miR-92a-1-5p<0.5 или Ehsa-miR-92a-1-5p>1.5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности.

В целях оценки потенциальной значимости выбранных маркеров была рассчитана их чувствительность и специфичность. Показано, что для дифференциации случаев глиом низкой и высокой степени злокачественности, маркер EGFR имеет чувствительность 85% и специфичность 50%, MSI1 чувствительность 100% и специфичность 45%, микроРНК hsa-miR-92a-1-5p чувствительность 100% и специфичность 40%. В то же время система из трех маркеров обладает чувствительностью 84% и специфичностью 99%. Предложенная система маркеров открыта и возможно увеличить ее чувствительность и/или дифференцирующую специфичность при расширении паттерна генетических локусов для оценки изменения относительной экспрессии в опухолевой ткани.

Для доказательства прогностической ценности предложенного способа приводится 3 выписки из историй болезни.

Пример №1.

Больная Г. обратилась в ФГБУ «РНИОИ» Минздрава России с жалобами на дезориентацию в пространстве.

Считает себя больной с мая 2018 г, когда появились вышеуказанные симптомы. Обратилась за медицинской помощью по месту жительства, где Выполнила МРТ с последующим выявлением объемного образования, направлена в ФГБУ «РНИОИ» Минздрава России. По решению врачебной комиссии по отбору пациентов для оказания высокотехнологичной Медицинской помощи больная госпитализирована в отделение нейроонкологии ФГБУ «РНИОИ» Минздрава России на хирургическое лечение.

Дата и вид операции: краниоэктомия от 28.06.2018: циторедуктивное удаление глиальной опухоли мозолистого тела с вовлечением лобных долей, поясных извилин с применением интраоперационной навигации.

Выполнение молекулярно-генетического исследования опухолевой и контрольной ткани от 29.06.2018: исследование экспрессии генов EGFR, MSI1 и микроРНК hsa-92a-1-5p не выявило значимых изменений экспрессии исследуемых локусов, что соответствует степени злокачественности G2.

Гистологическое исследование биоптата от 04.07.2018 - G2 олигодендроглиома.

Пример №2

Пациент Г. обратился в ФГБУ «РНИОИ» Минздрава России 24.04.2018 с жалобами на онемения в левой руке, слабость в левой ноге.

Начало заболевания отмечает около двух месяцев назад с онемением в левой руке, слабость в левой ноге. Консультирован неврологом по месту жительства, назначена консервативная терапия, без положительного эффекта. Далее рекомендовано выполнение МРТ головного мозга, где выявлено образование левой теменной доли головного мозга. Направлен в ФГБУ «РНИОИ» Минздрава России. По решению врачебной комиссии по отбору пациентов для оказания высокотехнологичной медицинской помощи больной госпитализирован в отделение нейроонкологии РНИОИ на хирургическое лечение.

Дата и вид операции: костно-пластическая краниотомия 25.04.2018, циторедуктивное удаление глйальной опухоли правой лобной и теменной долей головного мозга с применением интраоперационной навигации.

Выполнение молекулярно-генетического исследования опухолевой и контрольной ткани от 26.04.2018: исследование экспрессии генов EGFR, MSI1 и микроРНК hsa-92a-1-5p выявило значимое изменение экспрессии всех исследуемых локусов более чем в 1,5 раза, что соответствует степени злокачественности G3-G4.

Гистологическое исследование биоптата от 04.05.2018 - G4 глиобластома с обширными очагами некроза и кровоизлияний.

Пример №3

Пациентка С., 52 года, обратилась в ФГБУ «РНИОИ» Минздрава России 03.04.2018 с жалобами на легкие нарушения речи, головокружение, головные боли.

Начало заболевания отмечает 25.03.2018, когда впервые возник генерализованный эпилептический приступ, вызвана бригада СМП, доставлена в БМСП №5 г. Таганрога, где после стабилизации состояния, отправлена домой. Далее самостоятельно записалась на МРТ головного мозга с контрастированием, где выявлена опухоль левой лобной доли головного мозга. После этого обратилась в ФГБУ «РНИОИ» Минздрава России. Консилиум от 02.04.2018: показано удаление опухоли. Госпитализирована в отделение нейроонкологии ФГБУ «РНИОИ» Минздрава России для хирургического лечения.

Дата и вид операции: 06.04.2018 - костно-пластическая краниотомия, циторедуктивное удаление глиальной опухоли левой лобной доли головного мозга с применением интраоперационной навигации.

Участок удаленной опухоли и контрольной ткани был направлен на исследование экспрессии генов EGFR, MSI1 и микроРНК hsa-92a-1-5p. Результат исследования от 09.04.2018 выявил значимое изменение экспрессии MSI1 и микроРНК hsa-92a-1-5p более чем в 2,5 раза, что соответствует степени злокачественности G3-G4.

Гистологическое исследование от 10.04.18 г: низкодифференцированная опухоль солидного строения. Рекомендовано ИГХ.

Иммуногистохимическое исследование от 28.04.18 г. - гистологическая картина и иммунофенатип опухоли характерны для анапластической астроцитомы WHO grade III: p53-позитивная ядерная реакция в единичных опухолевых клетках; ki67 маркер пролиферативной активности - положительная экспрессия в 10% ядер опухолевых клеток.

Анализ представленных клинических случаев свидетельствует о возможности проведения дифференциальной диагностики глиомы с использованием исследования экспрессии генов EGFR, MSI1 и микроРНК hsa-miR-92a-1-5р.

Предлагаемым способом было осуществлено определение степени злокачественности глиом у 25 больных, результаты молекулярно-генетических исследований в дальнейшем подтверждены данными гистологического анализа.

«Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК» позволяет диагностировать степень злокачественности глиом, что способствует уточнению диагноза и определению правильной тактики лечения, а также будет способствовать улучшению результатов лечения больных с глиальными опухолями. Заявляемый способ является экономически оправданным для уточнения диагноза и дает возможность скорректировать тактику лечения в послеоперационном периоде; обладает высокой чувствительностью (84%) и специфичностью (99%), его осуществление возможно на интраоперационном материале, способ занимает менее 8 часов.

Способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию, с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR - F: AGGACGGGGACCAGACAA, R: CTGCGTACTTCCAGACCAGG, MSI1 - F: GGCTGTGGTTCGAGGGAC, R: CTGGGAGTCGAACCTGGAG, PSMC4 - F: CGCTCACGCATTTCGAGC, R: CAGGTGGGCCATACATGAGG, ТВР - F: GTGCCCGAAACGCCGAA, R: GTGGTTCGTGGCTCTCTTATCC, RPLO - F: GAGGAAACTCTGCATTCTCGC, R: CTGCAGACAGACACTGGCA и микро-РНК hsa-miR-92-1-5р - F: GAGGTTGGGATCGGTTGGAA, R: AGGTCCAGT(15)AGCA, hsa-miR-126-5p - F: CGCAGCATTATTACTTTTGGTAC, R: GTCCAG15(T)GCGTA, hsa-miR-7-5p - F: CGCAGTGGAAGACTAGTGA, R: GTCCAGT(15)CAAC, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е с использованием трех высокоспецифичных референсных генов: PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микро-РНК: hsa-miR-126-5р, hsa-miR-7-5p, сравнивают полученные значения Е в опухолевой ткани с контрольными и при значениях EEGFR<0,5 или EEGFR>1,5, EMSI1<0,5 или EMSI1>1,5, Ehsa-miR-92a-1-5p<0,5 или Ehsa-miR-92a-1-5p>1,5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности; коэффициент Е рассчитывают по формуле: где ΔCt(опухоль) - относительная экспрессия генов и микро-РНК в ткани глиом, где ΔCt(контроль) - относительная экспрессия генов и микро-РНК в ткани перифокальной зоны; при этом относительную экспрессию генетических локусов рассчитывают по формуле ΔCt=2-(Сtцелевого гена-Ctреференсных генов), где Ctцелевого гена - по трем повторам для целевых локусов EGFR или MSI1 и где Сtреференсных генов - среднее геометрическое значение референсных генов PSMC4, ТВР, RPLO; относительную экспрессию микро-РНК рассчитывают по формуле ΔCt=2-(Сtцелевой микроРНК-Ctреференсных микроРНК), где Ctцелевой микроРНК - среднее по трем повторам для микро-РНК hsa-miR-92-1-5р и где Сtреференсных микроРНК - среднее геометрическое значение референсных микро-РНК hsa-miR-126-5р, hsa-miR-7-5p.



 

Похожие патенты:
Изобретение относится к медицине. На прегравидарном этапе у пациенток группы риска, которая выделена по анамнестическим данным, определяют полиморфизмы генов фолатного цикла и PAI-1.

Изобретение относится к области биотехнологии. Сущность изобретения заключается в том, что из ДНК исследуемого штамма L.

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ проведения ПЦР в режиме реального времени для генотипирования крупного рогатого скота по аллелям 337C/G гена fshr (rs43745234), состоит в том, что используются:прямой праймер прямой праймер 5'-GAATTGAAAAGGCCAACAACC-3',обратный праймер 5'-CACCAGAATACAGAAGTTCTTACAGA-3',FSHR337C - аллель-специфичный флуоресцентно-меченый зонд-5'-FAM-CATCGACCCTGATGCC BHQ1-3',FSHR337G - аллель-специфичный флуоресцентно-меченый зонд5'-VIC-CATCGACGCTGATGC-BHQ1-3'.Изобретение позволяет повысить надежность детекции аллелей 337C/G (rs43745234) гена fshr, упростить анализ и сократить время его проведения до 1,5 часов.

Изобретение относится к биотехнологии. Описано множество праймеров для использования в конструировании профиля ДНК человека, содержащее два набора праймеров.
Изобретение относится к биотехнологии, а именно к офтальмологии и фармакогенетике, и может быть использовано при подборе терапии у пациентов с экссудативной («влажной») и «сухой» формах возрастной макулярной дегенерации (ВМД).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ, заключающийся в применении специфичных олигонуклеотидных последовательностей с регистрацией результатов ЦПР в режиме реального времени с использованием метода анализа кривых плавления (HRM).

Изобретение относится к области биотехнологии. Изобретение представляет собой способ проведения ПЦР в режиме реального времени для генотипирования крупного рогатого скота по аллелям 337C/G гена fshr (rs43745234), состоит в том, что используются:прямой праймер прямой праймер 5'-GAATTGAAAAGGCCAACAACC-3',обратный праймер 5'-CACCAGAATACAGAAGTTCTTACAGA-3',FSHR337C - аллель-специфичный флуоресцентно-меченый зонд-5'-FAM-CATCGACCCTGATGCC BHQ1-3',FSHR337G - аллель-специфичный флуоресцентно-меченый зонд5'-VIC-CATCGACGCTGATGC-BHQ1-3'.Изобретение позволяет повысить надежность детекции аллелей 337C/G (rs43745234) гена fshr, упростить анализ и сократить время его проведения до 1,5 часов.

Изобретение относится к биотехнологии, в частности к генетической инженерии, и представляет собой сконструированную in vitro рекомбинантную плазмидную ДНК, содержащую две копии синтетического гена гранулоцитарно-макрофагального колониестимулирующего фактора (ГМ-КСФ) человека, штамм Escherichia coli SG20050/p280_2GM - продуцент указанного полипептида и способ получения полипептида со свойствами ГМ-КСФ.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена частица рекомбинантного аденоассоциированного вируса (rAAV) для применения в лечении мукополисахаридоза I типа (MPS I), имеющая AAV-капсид и имеющая упакованный в него 5’ инвертированный концевой повтор (ITR), ген альфа-L-идуронидазы человека (hIDUA) под контролем регуляторных последовательностей, которые контролируют его экспрессию, и 3’ ITR AAV, где упомянутый ген hIDUA имеет последовательность, показанную в SEQ ID NO: 1, которая кодирует функциональную альфа-L-идуронидазу человека, а также композиция и применение.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена рекомбинантная молекула нуклеиновой кислоты для получения аланина в рекомбинантном микроорганизме Е.

Изобретение относится к области биотехнологии. Изобретение представляет собой генетическую конструкцию, несущую оптимизированный по представленности кодонов, GC-составу, наличию полиА участков и структуре образуемой мРНК ген консенсусного гликопротеина (белка G) вируса бешенства.

Изобретение относится к биотехнологии. Описан способ модификации целевого геномного локуса в клетке млекопитающего, включающий в себя: введение в клетку нуклеазного агента, который осуществляет одно- или двухцепочечный разрыв в пределах целевого геномного локуса; введение в клетку первого большого нацеливающего вектора (LTVEC), который имеет длину по меньшей мере 10 т.п.н.

Изобретение относится к области биотехнологии, конкретно к рекомбинантному получению мутантных белков человека, и может быть использовано для получения мутеинов липокалина 2 человека (hLcn2, hNGAL) по положению 100 аминокислотной последовательности hLcn2, связывающихся с определенными мишенями.

Изобретение относится к области биотехнологии, конкретно к модифицированному олигонуклеотиду, способному специфично ингибировать экспрессию ангиопоэтин-подобного белка 3 (ANGPTL3), и может быть использовано в медицине.

Данное изобретение относится к области геномной инженерии. Предложен способ мультиплексирования инсерций экзогенных последовательностей нуклеиновых кислот в ДНК клетки, экспрессирующей РНК-направляемый ДНК-связывающий белок из системы CRISPR II типа, включающий введение в клетку нескольких гидРНК, комплементарных различным сайтам ДНК, и нескольких экзогенных последовательностей донорных нуклеиновых кислот, получая несколько изменений ДНК клетки, и повторение указанной стадии множество раз.

Изобретение относится к биотехнологии, иммунологии и вирусологии. Описано иммунобиологическое средство на основе рекомбинантного аденовируса человека 5-го серотипа или рекомбинантного аденовируса человека 26-го серотипа, содержащее оптимизированную под экспрессию в клетках млекопитающих консенсусную последовательность полного протективного антигена S вируса БВРС на основании последовательностей генов белка S современных штаммов вируса БВРС 2015-2017 гг. с последовательностью SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 или SEQ ID NO: 5. Способ использования иммунобиологического средства для индукции специфического иммунитета к БВРС-КоВ. При этом способ использования иммунобиологического средства заключается в последовательном введении в организм млекопитающих двух различных иммунобиологических средств на основе рекомбинантного аденовируса человека 5-го серотипа или двух различных иммунобиологических средств на основе рекомбинантного аденовируса человека 26-го серотипа с интервалом более чем в 1 неделю, для индукции специфического иммунитета к БВРС-КоВ. Также разработан способ использования иммунобиологического средства, заключающийся в последовательном введении в организм млекопитающих любого из иммунобиологических средств на основе рекомбинантного аденовируса человека 5-го серотипа и любого из иммунобиологических средств на основе рекомбинантного аденовируса человека 26-го серотипа с интервалом более чем в 1 неделю, для индукции специфического иммунитета к БВРС-КоВ, или в последовательном введении в организм млекопитающих любого из иммунобиологических средств на основе рекомбинантного аденовируса человека 26-го серотипа и любого из иммунобиологических средств на основе рекомбинантного аденовируса человека 5-го серотипа с интервалом более чем в 1 неделю, для индукции специфического иммунитета к БВРС-КоВ. Также разработан способ использования иммунобиологического средства, заключающийся в одновременном введении в организм млекопитающих любых двух иммунобиологических средств на основе рекомбинантного аденовируса человека 5-го серотипа для индукции специфического иммунитета к БВРС-КоВ. Представленное средство может применяться для профилактики ближневосточного респираторного синдрома. 9 н.п. ф-лы, 7 ил., 8 табл., 13 пр.

Изобретение относится к области биотехнологии и медицины. Предложен способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию, с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR, MSI1, PSMC4, ТВР, RPLO, и микро-РНК hsa-miR-92-1-5р, hsa-miR-126-5p, hsa-miR-7-5p, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е с использованием трех высокоспецифичных референсных генов: PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микро-РНК: hsa-miR-126-5р, hsa-miR-7-5p, сравнивают полученные значения Е в опухолевой ткани с контрольными и при значениях EEGFR<0,5 или EEGFR>1,5, EMSI1<0,5 или EMSI1>1,5, Ehsa-miR-92a-1-5p<0,5 или Ehsa-miR-92a-1-5p>1,5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности. Изобретение позволяет эффективно дифференцировать глиомы в медицине. 2 табл., 3 пр.

Наверх