Способы измерения или испытания, использующие ферменты или микроорганизмы и составы для них и способы получения подобных составов (C12Q1)

Отслеживание патентов класса C12Q1
C12Q     Способы измерения или испытания, использующие ферменты или микроорганизмы (иммунологический анализ G01N33/53); составы или индикаторная бумага для них; способы получения подобных составов; контроль за условиями в микробиологических или ферментативных процессах (2973)
C12Q1                 Способы измерения или испытания, использующие ферменты или микроорганизмы (устройства для измерения или испытания при работе с ферментами или микроорганизмами, например счетчики колоний C12M1/34); составы для них; способы получения подобных составов(2771)
C12Q1/10 - Enterobacteria(19)
C12Q1/28 - Пероксидазу(23)
C12Q1/30 - Каталазу(6)
C12Q1/40 - Амилазу(10)
C12Q1/42 - Фосфатазу(21)
C12Q1/44 - Эстеразу(10)
C12Q1/52 - Трансаминазу(3)

Описание характеристик микроорганизмов с помощью maldi-tof // 2698139
Группа изобретений относится к области биотехнологии. Предложен способ получения зоны характеризации аналитической пластины для проведения характеризации популяции микроорганизма в присутствии антимикробного агента методом MALDI, способ характеризации популяции микроорганизма (варианты), аналитическая пластина и средство для характеризации популяции микроорганизма, представляющее собой указанную пластину.

Способ амплификации нуклеиновых кислот с использованием фосфорилгуанидиновых олигонуклеотидов // 2698134
Изобретение относится к биотехнологии. Изобретение может быть использовано в разработке и оптимизации ПЦР и ОТ-ПЦР систем, применяемых для выявления нуклеиновых кислот, в том числе при диагностике генетических, вирусных и других заболеваний.

Библиотеки для секвенирования нового поколения // 2698125
Изобретение относится к области биотехнологии и молекулярной биологии. Предложен способ определения нуклеотидной последовательности-мишени, включающий создание библиотеки для секвенирования нового поколения, что включает амплификацию нуклеотидной последовательности-мишени с использованием праймера, содержащего специфичную в отношении мишени последовательность и последовательность A, с получением ампликона, где указанный ампликон может быть одноцепочечным или двуцепочечным, при этом указанная последовательность А представляет собой известную последовательность, которая является одинаковой среди множества праймеров, при этом со всеми праймерами, содержащими указанную последовательность А, можно проводить манипуляции и/или амплификацию, идентификацию, секвенирование или выделение одинаковым или сходным образом; лигирование первого адаптерного олигонуклеотида, содержащего последовательность B, с указанным ампликоном для образования адаптера-ампликона, при этом указанная последовательность В представляет собой известную последовательность, которая является одинаковой среди множества праймеров, при этом со всеми праймерами, содержащими указанную последовательность В, можно проводить манипуляции и/или амплификацию, идентификацию, секвенирование или выделение одинаковым или сходным образом; и создание библиотеки, представляющей собой «лестницу» фрагментов, содержащей множество фрагментов для применения в качестве библиотеки для секвенирования нового поколения; и секвенирование фрагмента указанной библиотеки, представляющей собой «лестницу» фрагментов, где нуклеотидная последовательность, определенная в результате секвенирования, содержит нуклеотидную субпоследовательность нуклеотидной последовательности-мишени.
Способ выявления предрасположенности к заболеванию атеросклерозом на основе определения экспрессии генов, вовлеченных в накопление холестерина // 2698092
Изобретение относится к области медицины, в частности к медицинской генетике и кардиологии, и предназначено для выявления предрасположенности пациента к атеросклерозу или наличия доклинических признаков этой патологии.

Прибор для анализа биологических образцов и реагентов // 2697877
Прибор для обработки биологического образца содержит шасси. С шасси соединен лентопротяжный тракт, вдоль которого лента с матрицей лунок может автоматически продвигаться через прибор, дозирующий узел для дозирования биологического образца и реагента в матрицу лунок на ленте для образования смеси биологического образца и реагента, узел герметизации для герметизации смеси биологического образца и реагента в ленте и узел амплификации и детектирования для детектирования сигнала от смеси биологического образца и реагента в матрице лунок в ленте.

Композиции и способы обнаружения и анализа микобактерии туберкулеза (mycobacterium tuberculosis) // 2697502
Изобретение относится к биотехнологии, в частности предложены композиции и способы, подходящие для обнаружения МБТ.

Экспресс-тест на основе пцр, позволяющий предсказывать чувствительность опухоли головного мозга конкретного пациента к онколитическим вирусам // 2697412
Изобретение относится к области медицины и молекулярной биологии. Предложен экспресс-тест на основе ПЦР для прогнозирования чувствительности образца опухоли головного мозга конкретного пациента к онколитическим вирусам.

Способ преимплантационной генетической диагностики анемии фанкони // 2697398
Изобретение относится к области медицины. Предложен способ преимплантационной генетической диагностики анемии Фанкони у эмбриона, предусматривающий определение мутаций с.731Т>А (p.L244X), c.1844dupC и делеции 1-3 экзонов гена FANCA путем проведения прямой и косвенной диагностики.

Способ идентификации генетических полиморфизмов, влияющих на метаболизм противоопухолевых препаратов, с использованием биологических микрочипов // 2697096
Изобретение относится к биотехнологии и может быть использовано в медицине. Изобретение касается способа выявления нуклеотидных замен в генах, влияющих на метаболизм химиотерапевтических препаратов.

1,20-дибром-3,6,9,12,15,18-гексаоксаперфтор-4,7,10,11,14,17-гексаметилэйкозан в качестве исходного соединения для эмульсий медико-биологического назначения и способ его получения // 2696874
Изобретение относится к области фармацевтической химии и технологии, а именно к синтезу 1,20-дибром-3,6,9,12,15,18-гексаоксаперфтор-4,7,10,11,14,17-гексаметилэйкозана, используемого для получения оксигенирующих прямых эмульсий медицинского и биотехнологического назначения, например для лечения ожогов.

Способ оценки цитотоксичности аптамера // 2696849
Изобретение относится к биотехнологии и может быть использовано в фармакологии и медицине для оценки цитотоксичности новых синтезированных веществ, в частности аптамеров противоопухолевого действия.

Способ определения атерогенной активности пищевых продуктов // 2696569
Изобретение относится к области профилактической медицины, а именно к способу определения атерогенной активности пищевых продуктов, предусматривающему использование клеточной модели моноцитов-макрофагов, выделенных из крови здорового человека, для введения в нее сыворотки крови, взятой у добровольцев, получавших исследуемый пищевой продукт в течение определенного времени, с последующим измерением накопления холестерина в моноцитах-макрофагах модели под действием сыворотки крови и определением ее способности статистически достоверно повышать содержание холестерина в культивируемых клетках.

Полиметиновые соединения и их применение в качестве флуоресцентных меток // 2696562
Настоящее изобретение относится соединению формулы (I) или его мезомерным формам:где mCat+ или mAn- представляет собой органический или неорганический положительно/отрицательно заряженный противоион, и m представляет собой целое число, составляющее от 0 до 2; р представляет собой целое число, составляющее от 1 до 2; q представляет собой целое число, составляющее от 1 до 5; alk представляет собой углеродную цепочку, содержащую от 1 до 5 атомов углерода; Y представляет собой О или СН2; Z представляет собой ОН; n представляет собой 0 или 1; X представляет собой ОН или О-; Ra1 представляет собой SO3- или дополнительный С6-цикл, сконденсированный с соседним атомом углерода, где дополнительный цикл содержит SO3-; Ra2 представляет собой Н; Rc1 представляет собой С1-С6 алкил; Rc2 представляет собой С1-С6 алкил или группу С1-С6 алкилсульфоновой кислоты.

Применение акампросата для модулирования активации erk1/2 в животных моделях fxs и asd и людей с диагностированными fxs и asd // 2696481
Предложенная группа изобретений относится к области медицины. Предложены способы лечения больного с диагностированным расстройством аутистического спектра (ASD) или синдромом ломкой X-хромосомы (FXS), включающие стадии приведения в контакт образца крови больного с антителом, которое селективно связывается с ERK 1 или ERK 2, введения акампросата или фармацевтически приемлемой соли акампросата больному, определения, имеется ли изменение уровней ERK 1 или ERK 2 в крови больного и увеличения количества акампросата или фармацевтически приемлемой соли акампросата таким образом, чтобы снизился уровень по меньшей мере одного из ERK 1 и ERK 2 в периферической крови больного.

Способ прогнозирования риска развития ожирения в детском возрасте // 2696446
Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования риска развития ожирения в детском возрасте.

Способ выявления рнк вируса болезни шмалленберга у сельскохозяйственных животных // 2696306
Изобретение относится к области биотехнологии. Изобретение представляет собой способ выделения РНК из биологического материала по выбору: цельная кровь, сыворотка крови, фрагменты тканей и органов сорбционным методом, синтез кДНК на матрице РНК путем постановки одноэтапной с добавлением внутреннего и положительного контрольных образцов мультиплексной реакции обратной транскрипции и полимеразной цепной реакции - с проведением 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома возбудителя вируса Шмалленберга олигонуклеотидных праймеров флуоресцентно-меченого зонда и контрольных образцов, измерение накопления флуоресцентного сигнала по каналам соответствующих флуоресцентных красителей и интерпретацию результатов на основании наличия/отсутствия пересечения кривой флуоресценции с пороговой линией Threshold, согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя вируса Шмалленберга и фрагмент генома бактериофага MS2, взятых в соотношении 1:1, со следующими нуклеотидными последовательностями:при этом накопление флуоресцентного сигнала измеряют по каналам: JOE/Yellow для специфического сигнала возбудителя вируса Шмалленберга; Cy5/Red для сигнала внутреннего контроля, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считают положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный.

Растения дыни с повышенной урожайностью плодов // 2696201
Изобретение относится к области биохимии, в частности к растению Cucumis melo, способному производить более чем 12 плодов, где указанные плоды являются бессемянными, к части вышеуказанного растения, а также к пищевому продукту, содержащему вышеуказанное растение или его часть.

Способ скрининга противомикробного реагента // 2696200
Предложен способ скрининга противомикробного агента против микроорганизма, вызывающего неприятный запах в системе кондиционирования воздуха.

Способ выявления генома возбудителя вируса парагриппа 3 типа у крупного рогатого скота // 2696069
Изобретение относится к области биохимии. Описан способ выявления генома возбудителя вируса парагриппа 3 типа у крупного рогатого скота, включающий выделение РНК из биологического материала сорбционным методом, синтез кДНК на матрице РНК путем постановки одноэтапной с добавлением внутреннего и положительного контрольных образцов мультиплексной реакции обратной транскрипции и полимеразной цепной реакции - с проведением 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома вирусного возбудителя олигонуклеотидных праймеров флуоресцентно-меченного зонда и контрольных образцов.

Способ прогнозирования оценки эффективности терапии флуфеназином для лечения расстройств, сопровождающихся развитием психотической симптоматики // 2695821
Изобретение относится к медицине, а именно к фармакогенетике, клинической фармакологии, психиатрии, наркологии, и может быть использовано для подбора дозы антипсихотического лекарственного средства флуфеназина.

Способ прогнозирования оценки эффективности терапии трифлуоперазином для лечения расстройств, сопровождающихся развитием психотической симптоматики // 2695820
Изобретение относится к медицине, а именно к фармакогенетике, клинической фармакологии, психиатрии, наркологии, и может быть использовано для подбора дозы антипсихотического лекарственного средства трифлуоперазина у пациентов.

Способ определения полиморфных маркеров в генах slco1b1, apoe и abcb1 для определения индивидуальной чувствительности к статинам // 2695783
Изобретение относится к области фармакогенетики и персонализированной медицины. Предложен способ анализа полиморфных маркеров в генах SLCO1B1, АРОЕ и АВСВ1 для определения индивидуальной чувствительности к статинам, предусматривающий следующие стадии: амплификацию с помощью мультиплексной одноэтапной ПЦР, обеспечение биочипа, гибридизацию флуоресцентно меченного ПЦР-продукта на биочипе и регистрацию и интерпретацию результатов гибридизации.

Способ оценки вирулентности in vitro штаммов туляремийного микроба подвидов: francisella tularensis subsp tularensis, subsp. mediasiatica, subsp. holartica // 2695681
Изобретение относится к оценке вирулентности in vitro штаммов туляремийного микроба подвидов Francisella tularensis subsp. tularensis, subsp.

Способ прогнозирования оценки эффективности терапии промазином для лечения расстройств, сопровождающихся развитием психотической симптоматики // 2695659
Изобретение относится к области медицины, в частности к фармакогенетике, клинической фармакологии, психиатрии и наркологии.

Способ прогнозировании оценки эффективности терапии хлорпромазином для лечения расстройств, сопровождающихся развитием психотической симптоматики // 2695658
Изобретение относится к медицине, а именно к фармакогенетике, и может быть использовано для подбора дозы антипсихотического лекарственного средства хлорпромазина у пациентов с психотической симптоматикой.

Способ прогнозировании оценки эффективности терапии левомепромазином для лечения расстройств, сопровождающихся развитием психотической симптоматики // 2695657
Изобретение относится к медицине, а именно к фармакогенетике, клинической фармакологии, и может быть использовано для подбора дозы левомепромазина у пациентов с психотической симтоматикой.

Антисмысловые нуклеиновые кислоты // 2695430
Изобретение относится к биотехнологии. Описан антисмысловой олигомер длиной от 15 до 30 оснований для пропуска 44 экзона в гене дистрофина человека, содержащий нуклеотидную последовательность, выбранную из группы, состоящей из SEQ ID NO: 7, 55, 8, 9, 106 и 6.

Способы избирательного лечения астмы с использованием антагонистов il-13 // 2694980
Изобретение относится к биотехнологии, конкретно к способам лечения пациента, страдающего астмой, посредством избирательного введения антагониста IL-13, на основании того, что пациент генетически предрасположен давать благоприятный ответ на лечение с помощью антагониста IL-13.

Определение нуклеиновых кислот путем амплификации, основанной на встраивании в цепь // 2694976
Изобретение относится к области биотехнологии и молекулярной биологии. Предложен способ определения целевой нуклеотидной последовательности в пробе в присутствии по меньшей мере одной рекомбиназы или акцессорного белка или кофактора рекомбиназы, способных связываться с одноцепочечной ДНК, включающий приведение в контакт указанной пробы по меньшей мере с одним олигонуклеотидным зондом, содержащим флуорофор, гаситель и область, комплементарную указанной целевой нуклеотидной последовательности, причем последовательность указанного олигонуклеотидного зонда содержит по меньшей мере 20% нуклеотидов РНК, модифицированных нуклеотидов РНК и/или нуклеотидов ПНК (пептидной нуклеиновой кислоты), при этом длина олигонуклеотидного зонда составляет по меньшей мере 8 нуклеотидов и менее 30 олигонуклеотидов, а также предложены набор и способ диагностики заболеваний.

Способ диагностики вируса лейкоза крупного рогатого скота // 2694966
Изобретение относится к области биотехнологии и ветеринарии и предназначено для диагностики вируса лейкоза крупного рогатого скота (ВЛКРС).

Способ прогнозирования безрецидивной и общей выживаемости у впч16-позитивных больных раком шейки матки // 2694834
Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования безрецидивной и общей выживаемости у ВПЧ 16-позитивных больных раком шейки матки.

Способ прогнозирования эффективности лечения тимололом первичной открытоугольной глаукомы // 2694744
Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования эффективности лечения тимололом первичной открытоугольной глаукомы (ПОУГ).

Тест-система для выявления рнк вируса болезни шмалленберга у сельскохозяйственных животных // 2694719
Изобретение относится к области биотехнологии. Для повышение точности диагностики тест-система для выявления РНК вируса болезни Шмалленберга у сельскохозяйственных животных включает буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для возбудителя вируса болезни Шмалленберга и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE; буфер для разведения РНК, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя вируса Шмалленберга и фрагмент генома бактериофага MS2, взятых в соотношении 1:1 со следующими нуклеотидными последовательностями:Изобретение позволяет повысить точность диагностики болезни Шмалленберга у сельскохозяйственных животных.

Способ идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах // 2694713
Изобретение относится к области биотехнологии. Изобретение представляет собой способ идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах, включающий выделение ДНК из баранины (Ovis) и говядины (Bos) сорбционным методом, постановку одноэтапной полимеразной цепной реакции, проведение 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, красителей, внутреннего контрольного образца в виде суспензии бактериофага и положительных контрольных образцов - содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos), измерение специфических сигналов и сигнала контролей и интерпретацию результатов, где дополнительно исследуют продовольственное сырье и пищевые продукты, содержащие ДНК баранины (Ovis) и говядины (Bos), проводят полимеразную цепную реакцию с флуоресцентной детекцией с применением термоциклера типа Rotor-Gene Q и измеряют накопление флуоресцентных сигналов по каналам соответствующих флуоресцентных красителей: JOE/Yellow для специфического сигнала для баранины (Ovis); ROX/Orange - для говядины (Bos) и Cy5/Red - для внутреннего контрольного образца, интерпретацию результатов проводят на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный, при этом для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца - смесь содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4 взятых в соотношении 1:1:1 со следующими нуклеотидными последовательностями:Ovis F GCCTCATCTCCCTCCAACAG прямой праймерOvis R CGGAAGCCTGTAATTACAGCTC обратный праймерOvis P R6G-CTCATGTCTGTCCTTTGGTGTTATGAATGC-BHQ1 зондBos F AACAGCATCATTCTACCCACTT прямой праймерBos R ACCTAAATTCCTATTCTAACACTG обратный праймерBos P ROX-ACGACTTACATACTCCACTGCACTCACG-BHQ2 зондT4F TACATATAAATCACGCAAAGCT4R TAGTATGGCTAATCTTATTGGT4P CY5 ACATTGGCACTGACCGAGTTC.Изобретение позволяет повысить точность идентификации видовой принадлежности говядины или баранины.

Способы идентификации вариантных сайтов распознавания для редкощепящих сконструированных средств для индукции двунитевого разрыва, и композиции с ними, и их применения // 2694686
Изобретение относится к области биохимии, в частности к способам идентификации вариантного сайта распознавания для нуклеазы для индукции двунитевого разрыва.

Способ диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции // 2694617
Изобретение относится к области биотехнологии, молекулярной генетики и ветеринарии. Предложен способ диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени в формате мультиплекс, включающий наборы генно-инженерных конструкций (олигонуклеотидные праймеры и флюоресцентные зонды) для одновременного раннего выявления фрагментов провирусного генома.
Способ прогнозирования успешности в интеллектуальной деятельности // 2694604
Изобретение относится к биотехнологии, а именно к области изучения формирования и развития мультифакторных психологических признаков, в частности, уровня интеллектуального развития на основе определения индивидуального генетического профиля.

Способ выявления генома возбудителя коронавирусной инфекции у крупного рогатого скота // 2694558
Изобретение относится к области биотехнологии. Описан способ выявления генома возбудителя коронавирусной инфекции у крупного рогатого скота.

Тест-система для обнаружения генома возбудителя ротовируса типа а у сельскохозяйственных животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени // 2694501
Изобретение относится к области биотехнологии. Описана тест-система для обнаружения генома возбудителя ротовируса типа А у сельскохозяйственных животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени.

Тест-система для обнаружения генома возбудителя коронавирусной инфекции у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени // 2694499
Изобретение относится к области биотехнологии. Описана тест-система для обнаружения генома возбудителя коронавирусной инфекции у крупного рогатого скота при помощи мультиплексной полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в реальном времени.
Способ определения предрасположенности к онкопатологии // 2694231
Изобретение относится к области медицинской генетики. Предложен способ обнаружения предрасположенности к различным типам рака, включающий выделение тотальной нативной ДНК из периферической крови и проведение полимеразной цепной реакции.

Способ выделения и идентификации бактерий групп pseudomonas putida и pseudomonas fluorescens // 2693892
Изобретение относится к биотехнологии. Предлагается способ выделения и идентификации бактерий групп Pseudomonas putida и Pseudomonas fluorescens.

Способы и композиции для лечения болезни хантингтона // 2693891
Изобретение относится к области биохимии, в частности к способу увеличения уровней по меньшей мере двух из PDE10a, DARPP-32, DRD1 и DRD2 в срединных шипиковых нейронах (MSN) субъекта-человека или субъекта-мыши.

Способ диагностики ранних проявлений респираторного аллергоза у детей в условиях избыточной контаминации алюминием // 2693471
Изобретение относится к области медицины, в частности к педиатрии и аллергологии. Предложен способ диагностики ранних проявлений респираторного аллергоза у детей в условиях избыточной контаминации алюминием.

Способ прогнозирования риска развития у мужчин эссенциальной гипертензии, ассоциированной с ожирением // 2693469
Изобретение относится к области медицины. Предложен способ прогнозирования риска развития у мужчин эссенциальной гипертензии, ассоциированной с ожирением.

Направляемое антисмысловым олигонуклеотидом удаление сайтов протеолитического расщепления, мутации hchwa-d и увеличенного числа тринуклеотидных повторов // 2692634
Изобретение относится к биотехнологии, в частности средствам и способам удаления сайта протеолитического расщепления, мутации HCHWA-D или аминокислот, кодируемых увеличенным числом тринуклеотидных повторов, из белка, включающим обеспечение клетки, которая экспрессирует пре-мРНК, кодирующую указанный белок, антисмысловым олигонуклеотидом, который индуцирует пропуск экзонной последовательности, которая содержит указанный сайт протеолитического расщепления, мутацию HCHWA-D или увеличенное число тринуклеотидных повторов соответственно.

Способ диагностики колоректального рака из образца кала человека с помощью количественной пцр, праймеров и набора // 2692555
Настоящее изобретение относится к биотехнологии. В частности, настоящее изобретение относится к способам раннего обнаружения, скрининга риска развития и мониторинга CRC и/или аденоматозных полипов у субъекта-человека на основе количественного определения одной или нескольких последовательностей бактериального гена 16S рДНК в кале.

Способ одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота и тест-система для его осуществления // 2691995
Группа изобретений относится к области молекулярной генетики и может быть использована в ветеринарной практике и зоотехнике для диагностики четырех аллелей каппа-казеина.

Способ герметизации вещества // 2691694
Изобретение относится к области биотехнологии. Предложен способ герметизации вещества в выполненном на субстрате множестве ячеек.
 
.
Наверх