Способы измерения или испытания, использующие ферменты или микроорганизмы и составы или индикаторная бумага для них и способы получения подобных составов и контроль за условиями в микробиологических или ферментативных процессах (C12Q)

Отслеживание патентов класса C12Q
C12Q              Способы измерения или испытания, использующие ферменты или микроорганизмы (иммунологический анализ G01N33/53); составы или индикаторная бумага для них; способы получения подобных составов; контроль за условиями в микробиологических или ферментативных процессах(2973)

Способ прогнозирования безрецидивной и общей выживаемости у впч16-позитивных больных раком шейки матки // 2694834
Изобретение относится к области медицины, в частности к онкологии, и предназначено для прогнозирования безрецидивной и общей выживаемости у ВПЧ 16-позитивных больных раком шейки матки.

Способ прогнозирования эффективности лечения тимололом первичной открытоугольной глаукомы // 2694744
Изобретение относится к области медицины, а именно к офтальмологии, и предназначено для прогнозирования эффективности лечения тимололом первичной открытоугольной глаукомы (ПОУГ).

Тест-система для выявления рнк вируса болезни шмалленберга у сельскохозяйственных животных // 2694719
Изобретение относится к области биотехнологии. Для повышение точности диагностики тест-система для выявления РНК вируса болезни Шмалленберга у сельскохозяйственных животных включает буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящую из дезоксинуклеозидтрифосфатов, праймеров и флуоресцентных зондов, специфичных для возбудителя вируса болезни Шмалленберга и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE; буфер для разведения РНК, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, согласно изобретению для внутреннего контрольного образца используют суспензию бактериофага MS2 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома возбудителя вируса Шмалленберга и фрагмент генома бактериофага MS2, взятых в соотношении 1:1 со следующими нуклеотидными последовательностями:Изобретение позволяет повысить точность диагностики болезни Шмалленберга у сельскохозяйственных животных.

Способ идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах // 2694713
Изобретение относится к области биотехнологии. Изобретение представляет собой способ идентификации видовой принадлежности баранины и говядины в продовольственном сырье, кормах и пищевых продуктах, включающий выделение ДНК из баранины (Ovis) и говядины (Bos) сорбционным методом, постановку одноэтапной полимеразной цепной реакции, проведение 45 циклов амплификации с детекцией в реальном времени с использованием специфичных для участка генома ДНК баранины (Ovis) и говядины (Bos) олигонуклеотидных праймеров, зондов, красителей, внутреннего контрольного образца в виде суспензии бактериофага и положительных контрольных образцов - содержащих фрагменты геномов ДНК баранины (Ovis) и говядины (Bos), измерение специфических сигналов и сигнала контролей и интерпретацию результатов, где дополнительно исследуют продовольственное сырье и пищевые продукты, содержащие ДНК баранины (Ovis) и говядины (Bos), проводят полимеразную цепную реакцию с флуоресцентной детекцией с применением термоциклера типа Rotor-Gene Q и измеряют накопление флуоресцентных сигналов по каналам соответствующих флуоресцентных красителей: JOE/Yellow для специфического сигнала для баранины (Ovis); ROX/Orange - для говядины (Bos) и Cy5/Red - для внутреннего контрольного образца, интерпретацию результатов проводят на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный, при этом для внутреннего контрольного образца используют суспензию бактериофага Т4 с концентрацией 5×103 копий нуклеотидных последовательностей на 1 мкл, а для положительного контрольного образца - смесь содержащую фрагменты геномов баранины (Ovis), говядины (Bos) и бактериофага Т4 взятых в соотношении 1:1:1 со следующими нуклеотидными последовательностями:Ovis F GCCTCATCTCCCTCCAACAG прямой праймерOvis R CGGAAGCCTGTAATTACAGCTC обратный праймерOvis P R6G-CTCATGTCTGTCCTTTGGTGTTATGAATGC-BHQ1 зондBos F AACAGCATCATTCTACCCACTT прямой праймерBos R ACCTAAATTCCTATTCTAACACTG обратный праймерBos P ROX-ACGACTTACATACTCCACTGCACTCACG-BHQ2 зондT4F TACATATAAATCACGCAAAGCT4R TAGTATGGCTAATCTTATTGGT4P CY5 ACATTGGCACTGACCGAGTTC.Изобретение позволяет повысить точность идентификации видовой принадлежности говядины или баранины.

Способы идентификации вариантных сайтов распознавания для редкощепящих сконструированных средств для индукции двунитевого разрыва, и композиции с ними, и их применения // 2694686
Изобретение относится к области биохимии, в частности к способам идентификации вариантного сайта распознавания для нуклеазы для индукции двунитевого разрыва.

Способ диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции // 2694617
Изобретение относится к области биотехнологии, молекулярной генетики и ветеринарии. Предложен способ диагностики лейкоза крупного рогатого скота методом полимеразной цепной реакции в режиме реального времени в формате мультиплекс, включающий наборы генно-инженерных конструкций (олигонуклеотидные праймеры и флюоресцентные зонды) для одновременного раннего выявления фрагментов провирусного генома.
Способ прогнозирования успешности в интеллектуальной деятельности // 2694604
Изобретение относится к биотехнологии, а именно к области изучения формирования и развития мультифакторных психологических признаков, в частности, уровня интеллектуального развития на основе определения индивидуального генетического профиля.

Способ выявления генома возбудителя коронавирусной инфекции у крупного рогатого скота // 2694558
Изобретение относится к области биотехнологии. Описан способ выявления генома возбудителя коронавирусной инфекции у крупного рогатого скота.

Тест-система для обнаружения генома возбудителя ротовируса типа а у сельскохозяйственных животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени // 2694501
Изобретение относится к области биотехнологии. Описана тест-система для обнаружения генома возбудителя ротовируса типа А у сельскохозяйственных животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени.

Тест-система для обнаружения генома возбудителя коронавирусной инфекции у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени // 2694499
Изобретение относится к области биотехнологии. Описана тест-система для обнаружения генома возбудителя коронавирусной инфекции у крупного рогатого скота при помощи мультиплексной полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в реальном времени.
Способ определения предрасположенности к онкопатологии // 2694231
Изобретение относится к области медицинской генетики. Предложен способ обнаружения предрасположенности к различным типам рака, включающий выделение тотальной нативной ДНК из периферической крови и проведение полимеразной цепной реакции.

Способ выделения и идентификации бактерий групп pseudomonas putida и pseudomonas fluorescens // 2693892
Изобретение относится к биотехнологии. Предлагается способ выделения и идентификации бактерий групп Pseudomonas putida и Pseudomonas fluorescens.

Способы и композиции для лечения болезни хантингтона // 2693891
Изобретение относится к области биохимии, в частности к способу увеличения уровней по меньшей мере двух из PDE10a, DARPP-32, DRD1 и DRD2 в срединных шипиковых нейронах (MSN) субъекта-человека или субъекта-мыши.

Способ диагностики ранних проявлений респираторного аллергоза у детей в условиях избыточной контаминации алюминием // 2693471
Изобретение относится к области медицины, в частности к педиатрии и аллергологии. Предложен способ диагностики ранних проявлений респираторного аллергоза у детей в условиях избыточной контаминации алюминием.

Способ прогнозирования риска развития у мужчин эссенциальной гипертензии, ассоциированной с ожирением // 2693469
Изобретение относится к области медицины. Предложен способ прогнозирования риска развития у мужчин эссенциальной гипертензии, ассоциированной с ожирением.

Направляемое антисмысловым олигонуклеотидом удаление сайтов протеолитического расщепления, мутации hchwa-d и увеличенного числа тринуклеотидных повторов // 2692634
Изобретение относится к биотехнологии, в частности средствам и способам удаления сайта протеолитического расщепления, мутации HCHWA-D или аминокислот, кодируемых увеличенным числом тринуклеотидных повторов, из белка, включающим обеспечение клетки, которая экспрессирует пре-мРНК, кодирующую указанный белок, антисмысловым олигонуклеотидом, который индуцирует пропуск экзонной последовательности, которая содержит указанный сайт протеолитического расщепления, мутацию HCHWA-D или увеличенное число тринуклеотидных повторов соответственно.

Способ диагностики колоректального рака из образца кала человека с помощью количественной пцр, праймеров и набора // 2692555
Настоящее изобретение относится к биотехнологии. В частности, настоящее изобретение относится к способам раннего обнаружения, скрининга риска развития и мониторинга CRC и/или аденоматозных полипов у субъекта-человека на основе количественного определения одной или нескольких последовательностей бактериального гена 16S рДНК в кале.

Способ одновременной генодиагностики четырех мутантных аллелей каппа-казеина у крупного рогатого скота и тест-система для его осуществления // 2691995
Группа изобретений относится к области молекулярной генетики и может быть использована в ветеринарной практике и зоотехнике для диагностики четырех аллелей каппа-казеина.

Способ герметизации вещества // 2691694
Изобретение относится к области биотехнологии. Предложен способ герметизации вещества в выполненном на субстрате множестве ячеек.

Способы ухода за полостью рта с использованием сахарида в качестве пребиотика // 2691408
Группа изобретений относится к композиции для ухода за полостью рта и способу ее применения. Предлагаемая композиция для ухода за полостью рта содержит эффективное количество пребиотика сахарида для избирательной стимуляции роста, метаболической активности или колонизации бактерий, благоприятно влияющих на здоровье полости рта, выбранных из группы, состоящей из Streptococcus mitis, Streptococcus salivarius, Streptococcus sanguinis, Actinomyces viscosus, Veillonella parvula, Streptococcus gordonii, Actinomyces naeslundii, предпочтительных по отношению к росту, метаболической активности или колонизации патогенных бактерий полости рта, где пребиотик сахарид представляет собой N-ацетил-D-маннозамин, взятый в количестве от 0,1 до 5 мас.% от общей массы композиции.

Биомаркеры для ревматоидного артрита и их применение // 2691375
Предложен способ определения вероятности ревматоидного артрита (РА) у пациента, предусматривающий получение доступных последовательностей ДНК, выделенных из образца, который отобран у пациента; расчет относительной распространённости биомаркера на основании последовательностей ДНК, где биомаркер содержит последовательность ДНК в геноме Lactobacillus salivarius; и определение вероятности РА у пациента на основании относительной распространённости, сравнением относительной распространённости с предварительно определенным пороговым значением для принятия решения, что пациент имеет риск РА, если относительная распространённость биомаркера выше, чем предварительно определенное пороговое значение.

Способ формирования индивидуальных диетических рекомендаций на основе днк анализа // 2691145
Изобретение относится к области медицины, в частности к персонализированной диетотерапии. Предложен способ формирования индивидуальных диетических рекомендаций на основе ДНК анализа, включающий выявление причин избыточного веса и/или пищевой непереносимости путем анализа участков генов.

Способы и препараты для трансфекции клеток // 2691027
Настоящее изобретение относится к биотехнологии, в частности к терапевтической композиции. Описаны способы индукции экспрессии белков клетками, а также перепрограммирования и генного редактирования клеток при помощи РНК.
Способ повышения безопасности применения лекарственных средств при лечении пациентов с синдромом отмены алкоголя // 2690522
Изобретение относится к области медицины, в частности к фармакогенетике. Предложен способ повышения безопасности применения лекарственных средств при лечении пациентов с синдромом отмены алкоголя по результатам генотипирования по полиморфным маркерам генов CYP3A5*3, CYP2C9*3 и АВСВ1 3435C>Т.

Способы и наборы для молекулярного субтипирования опухолей // 2690241
Изобретение относится к области биотехнологии, конкретно к способу стратификации онкологических больных для лечения опухоли, и может быть использовано в медицине.

Способ детекции штаммов mycobacterium bovis bcg в формате реального времени // 2689801
Изобретение относится к области медицины, в частности к фтизиатрии, и предназначено для детекции штаммов Mycobacterium bovis BCG путем лабораторного выявления геномной делеции RD1.

Способ детекции изолятов mycobacterium tuberculosis beijing 94-32-кластера в формате реального времени // 2689800
Изобретение относится к области медицины, в частности к фтизиатрии, и предназначено для детекции изолятов Mycobacterium tuberculosis Beijing 94-32-кластера.

Способ анализа дифференциально метилированных геномных участков в биологических образцах костного мозга и крови детей с острым миелоидным лейкозом // 2689727
Изобретение относится к области биотехнологии. Представлен способ выявления и анализа аномально метилированных геномных участков в биологических материалах пациентов с острым миелоидным лейкозом.

Способ выявления генома возбудителя ротовирусной инфекции у сельскохозяйственных животных // 2689718
Изобретение относится к области биотехнологии и ветеринарной вирусологии. Предложен способ выявления генома возбудителя ротавируса типа А у сельскохозяйственных животных.

Лечение рака головного мозга онколитическим аденовирусом // 2689553
Изобретение относится к биотехнологии, в часности к композициям и способам лечения рака головного мозга, имеющих мутации в ретинобластомном (Rb) метаболическом пути, с использованием онколитического аденовируса, содержащего изменение связывающего Rb участка E1A и выделение мотива, вставленного в фибриллярный белок Ad.

Способ анализа полиморфных маркеров в генах vkorc1, cyp4f2, cyp2c9, cyp2c19, abcb1, itgb3 для определения индивидуальной чувствительности к противосвертывающим препаратам // 2689400
Предложенная группа изобретений относится к области фармакогенетики и персонализированной медицины. Предложен способ анализа полиморфных маркеров в генах VKORC1, CYP4F2, CYP2C9, CYP2C19, АВСВ1, ITGB3 для определения индивидуальной чувствительности к противосвертывающим препаратам и набор олигонуклеотидных зондов, используемый в данном способе.

Способ определения бактерицидных свойств материалов // 2689359
Изобретение относится к биоизмерительным технологиям. Предложен способ определения бактерицидных свойств материалов.

Системы и способы с использованием поворотного клапана для по меньшей мере одного из приготовления образца или анализа образца // 2688746
Группа изобретений относятся к системам и способам создания образцов для биохимического анализа и/или проведения биохимических реакций.

Способ определения токсичности проб // 2688745
Изобретение относится к биотехнологии и микробиологии. Предложен способ определения токсичности проб, содержащих нефтепродукты.

Рекомбинантная плазмидная днк pfuse-marx-29-prad-f2a/bche-14, содержащая ген модифицированной бутирилхолинэстеразы человека, предназначенная для экспрессии гена бутирилхолинэстеразы в клетках млекопитающих для терапии отравлений фосфорорганическими токсинами // 2688729
Изобретение относится к биотехнологии, а именно: к технологии получения рекомбинантной бутирилхолинэстеразы человека (БуХЭ), и может быть использовано в медицине в терапии отравлений фосфорорганическими токсинами, для терапии отравлений наркотическими веществами типа кокаин, для терапии последствий анестезии у людей с дефицитом эндогенной БуХЭ.

Способы получения библиотек двухцепочечных днк и способы секвенирования для идентификации метилированных цитозинов // 2688485
Изобретение относится к области биотехнологии, молекулярной биологии и биохимии. Предложен способ идентификации метилированных цитозинов в популяции молекул двухцепочечных ДНК.

Набор для получения реакционной смеси для синтеза 3′-o-пропаргил-модифицированной нуклеиновой кислоты // 2688435
Изобретение относится к биотехнологии и к области молекулярной диагностики. Предложен набор для получения реакционной смеси для синтеза 3'-O-пропаргил-модифицированной нуклеиновой кислоты.

Способ дифференциации штаммов helicobacter pylori путем молекулярно-генетического типирования // 2688434
Изобретение относится к области медицинской микробиологии, а именно к способам молекулярно-генетического типирования штаммов возбудителей инфекционных заболеваний, которые используются при микробиологическом и молекулярно-генетическом мониторинге штаммов H.pylori, циркулирующих на различных территориях, с целью их дифференциации.

Способ определения специфической активности антирабического иммуноглобулина на клеточной культуре с применением атомно-силовой микроскопии // 2688334
Изобретение относится к биотехнологии и вирусологии. Изобретение раскрывает способ определения специфической активности антирабического иммуноглобулина.

Способ определения бактерицидных свойств веществ // 2688328
Изобретение относится к биотехнологии и микробиологии. Предложен способ определения бактерицидных свойств веществ.
Способ оценки состава биопленок грамположительных бактерий // 2688215
Изобретение относится к медицине, а именно к микробиологии, инфекционным болезням, дезинфектологии, и может быть использовано для изучения действия факторов на биопленку и биопленкообразующую способность грамположительных микроорганизмов.

Панель последовательностей олигонуклеотидов для определения мутации q61r гена nras в опухолевых образованиях щитовидной железы // 2688189
Предложенная группа изобретений относится к области медицины. Предложены способ и набор для обнаружения мутации Q61R в белке NRAS в образце опухолевой ткани человека.

Способ выявления мутаций гена gjb2, обуславливающих аутосомно-рецессивную глухоту 1а типа // 2688180
Изобретение относится к области медицины, в частности к медицинской генетике и оториноларингологии, и предназначено для выявления мутаций гена GJB2, обуславливающих аутосомно-рецессивную глухоту 1А типа.

Количественная оценка has-mir-16-5p, has-mir-425-5p, has-mir-17-5p, has-mir-20a-5p, has-mir-101-3p, has-mir-30d-5p и has-mir-93-5p в плазме периферической крови женщин как способ неинвазивной диагностики серозных пограничных цистаденом и цистаденокарценом яичника // 2688169
Изобретение относится к области медицины, в частности к онкогинекологии, и предназначено для неинвазивной диагностики серозных пограничных цистаденом и высокой степени злокачественности цистаденокарцином яичников.

Способ оценки эффективности лечения лепры с помощью полимеразной цепной реакции // 2688156
Изобретение относится к области медицины и предназначено для оценки эффективности лечения лепры на основе идентификации жизнеспособных Mycobacterium leprae.

Способ определения антибиотических свойств материалов // 2688119
Изобретение относится к биоизмерительным технологиям. Предложен способ определения антибиотических свойств материалов.

Способ оценки про- и антимикробных свойств проб // 2688117
Изобретение относится к биоизмерительным технологиям. Предложен способ оценки про- и антимикробных свойств проб.

Способ получения лекарственного средства коллализин&αχιρχ;, лиофилизата для приготовления раствора для местного и парентерального применения для лечения фибропролиферативных заболеваний // 2687973
Изобретение относится к биотехнологии и медицине, в частности к промышленной технологии получения ферментного препарата Коллализин® для использования в медицинских целях.

Биодатчик, содержащий волновод // 2687847
Группа изобретений относится к оптическому устройству, устройству детектирования и способу, использующему волновод, которые можно использовать в областях биозондирования и секвенирования нуклеиновых кислот.

Способ диагностики у детей астено-вегетативного синдрома в условиях экспозиции алюминием // 2687731
Изобретение относится к области медицины. Предложен способ диагностики у детей астено-вегетативного синдрома в условиях экспозиции алюминием.
 
.
Наверх