Плазмиды и способ получения вирусных частиц

Изобретение относится к вирусологии и представляет собой способ получения вирусных частиц, включающий в себя следующие действия: а) трансфицируют клетки рыбы тремя экспрессионными векторами pTriex3, способными к экспрессии фрагментов полимеразы РНК последовательностей РВ2 SEQ ID No 7, РВ1 SEQ ID No 8 и PA SEQ ID No 9 вируса ISAV901_09, и экспрессионным вектором pCI-neo, способным к экспрессии нуклеопротеина NP SEQ ID No 10 вируса ISAV901_09; б) трансфицируют клетку из пункта (а) набором из восьми экспрессионных векторов, полученных из плазмиды pUC57, при этом каждый экспрессионный вектор содержит последовательности SEQ ID No 1, SEQ ID No 2, SEQ ID No 3, SEQ ID No 4 и SEQ ID No 5 и раздельно клонированную последовательность рекомбинантной РНК вируса ISAV901_09, полученную с использованием одной из пар праймеров, в) получают рекомбинантные вирусные частицы. Изобретение позволяет получать функциональные вирусные частицы из РНК отрицательной полярности. 2 н. и 14 з.п. ф-лы, 6 ил., 4 табл., 1 пр.

 

Область техники, к которой относится изобретение

Настоящее изобретение относится к области медицины, ветеринарии, молекулярной биологии, иммунологии и биотехнологии. В частности, оно относится к разработке вакцин и адъювантов для них, а также к лечению. Область применения этого изобретения в основном касается рыбоводства. Более конкретно, это изобретение относится к плазмиде для экспрессии вирусной РНК и способу получения вирусных частиц с применением таких плазмид.

Уровень техники

Инфекционная анемия лососевых (ISA) - заболевание, поражающее в основном атлантического лосося (Salmo salar) и приводящее к огромным потерям в лососевом хозяйстве во всем мире (1, 14). Клиническими признаками этого заболевания являются бледные жабры, асцит, геморрагический некроз печени, спленомегалия, застой в кишечнике и острая анемия (14). ISA впервые была обнаружена в Норвегии в 1984 году (28), позже она была диагностирована в Канаде (4), Шотландии (27), Соединенных Штатах (18), на Фарерских островах (18) и в Чили (16).

Этиологическим агентом этого заболевания является оболочечный плеоморфный вирус диаметром от 45 до 140 нм, называемый вирусом инфекционной анемии лососевых (ISAV), принадлежащий к семейству Orthomixoviridae (8). Его геном состоит из 8 однонитевых РНК (ssRNA) отрицательной полярности (ns-RNA), которые кодируют 10 белков и имеют нетранслируемые области (UTR) на обоих концах (26).

О функциях каждого белка ISAV известно немного. Биоинформатика свидетельствует о том, что сегменты 1, 2 и 4 могут кодировать зависимые субъединицы РНК-полимеразы (RpRd), аналогичные PB2, PB1 и PA вируса гриппа A, соответственно. Сегмент 3 кодирует белок NP, который, как сообщалось, обладает способностью связывать ssRNA (2). Что касается гриппа, было доказано, что эти четыре полипептида имеют отношение к каждому из восьми сегментов вирусной РНК при формировании комплексов рибонуклеопротеинов (RNP) (23). Эти восемь единиц RNP соответствуют минимальной инфекционной единице, необходимой для инициации клеточной инфекции (23). Сегмент 5 кодирует слитный белок (F), который, как известно, присутствует на поверхности вирусной мембраны, провоцируя на первых стадиях инфекции слияние мембраны вирусной частицы с клеточной эндосомой, с высвобождением RNP в клеточную цитоплазму (3). Сегмент 6 кодирует гемагглютинин-эстеразный белок (HE), который также присутствует на поверхности вируса и функция которого заключается в связывании остатка сиаловой кислоты, находящейся в клеточном рецепторе (15). Белок HE также обладает разрушающей рецептор активностью (разрушающий рецептор фермент, RDE), способствующей высвобождению новых вирусных частиц, возникающих из клеточной мембраны (21). В отличие от того, что наблюдается в гемагглютинине вируса гриппа А, чей стеблевый участок в значительной степени сохраняется, сообщалось, что HE-белок ISAV характеризуется сильно вариабельным участком в направлении к карбоксильному концу и прилегает к трансмембранной области, также известной как высокополиморфная область (HPR) (9). Эта область HPR кодирует 35 аминокислот, причем благодаря ее высокому полиморфизму 30 вариантов уже были описаны в Европе, Северной Америке и Чили (30, 31, 32). Одна из теорий объясняет эту изменчивость за счет явления делеции в наследственной линии самой длинной области HPR, которая называется HPR0 (33). Первый штамм HPR0 был идентифицирован в Шотландии у дикого лосося, который не проявлял каких-либо клинических признаков ISA и был классифицирован как авирулентный штамм (34). Напротив, те штаммы, которые имеют делеции в этой зоне, способны вызывать связанные с ISA вирулентные клинические признаки и смертность. Предполагается, что сегмент 7 кодирует неструктурные белки, аналогичные NS1 и NS2 вируса гриппа A (19). Наконец, сегмент 8 кодирует транскрипт, содержащий две перекрывающиеся открытые рамки считывания (ORF). ORF1 кодирует матричный белок (M), а ORF2 кодирует белок M2. Было показано, что белок M2 участвует в модуляции IFN-ответа типа I в сочетании с белком NS1 (12).

Что касается вируса гриппа, то детальное изучение этого вируса стало возможным в результате разработки обратной генетической системы, которая позволяет манипулировать геномом вируса, что дает возможность определить возможные причины вирулентности, а также осуществить детальное исследование каждой из функций вирусных белков (13). Наиболее широко используемой системой обратной генетики для вируса гриппа является система на основе плазмиды, которая позволяет получать рекомбинантные вирусы из клонированной кДНК. Вирус ISA имеет 8 геномных РНК, транскрибируемых под контролем РНК-полимеразы I, а белки, составляющие рибонуклеопротеиновый комплекс под контролем РНК-полимеразы II, подвергаются экспрессии (10, 24).

На сегодняшний день нет сообщений, описывающих работоспособную обратную генетическую систему для ISAV. Основная трудность в создании обратной генетической системы связана с определением промотора для РНК-полимеразы I, который пока не описан для атлантического лосося. Трудность заключается в том, что промоторы для РНК-полимеразы I строго видоспецифичны, они не имеют четкой генетической структуры и расположены в обширной области межгенного спейсера (IGS) рДНК (6). Идентификация последовательностей, соответствующих промотору для Pol I и его энхансеров, сложна, учитывая, что IGS рода Salmo варьируется от 15 до 23 т.п.н. в длину (5). По этой причине и ввиду необходимости иметь промотор с характеристиками РНК Pol I, необходимо оценить возможности области внутренней транскрибируемой последовательности ITS-1 длиной 571 п.н., как было описано ранее для Salmo salar (атлантического лосося) (25). Недавно анализ методами биоинформатики показал, что область ITS-1 нематод содержит мотивы промотора транскрипции и мотивы регулятора, причем их функция ранее не была продемонстрирована (29). В этом исследовании предполагается, что в области ITS-1 рДНК существуют мотивы, обладающие характеристиками промоторов и регуляторов транскрипции, которые были законсервированы в течение миллионов лет эволюции, различающиеся между видами одного рода, однако для подтверждения этого требуется проведение анализов транскрипции in vitro.

Настоящее изобретение показывает, что область ITS-1 рДНК атлантического лосося, которая была законсервирована в течение миллионов лет, демонстрирует активность промотора транскрипции; для подтверждения этого предположения потребовалось исследование транскрипции in vitro.

В Чили и во всех других фермерских лососевых хозяйствах необходимо срочно выяснить факторы вирулентности, механизмы патогенеза вируса ISA и найти эффективную вакцину против единственного представителя рода ISA-вируса. Также следует реализовать плазмидную обратную генетическую систему, позволяющую генерировать рекомбинантный ISA-вирус (ISAVr). В связи с этим встает задача разработки обратной генетической системы для ISAV на основе плазмид с использованием инновационных элементов, таких как использование области ITS-1 лосося, которая никогда ранее не описывалась как элемент-промотор. Выбор, который оказался ключевым для создания работоспособной системы, описан ниже.

Раскрытие изобретения

Несмотря на то, что данная методология была изначально разработана для получения вирусных частиц вируса ISA, было также подтверждено, что эта система экспрессии оказалась работоспособной для выработки молекул РНК других видов высших позвоночных без каких-либо дополнительных нуклеотидов на концах, что значительно расширяет применимость этого способа. Таким образом, с помощью этой системы экспрессии можно получить любой желаемый белок или РНК в бесчисленном количестве различных типов клеток. К примеру, эта система позволяет транскрибировать вирусную РНК через 12 ч после инфицирования в клеточной линии KEK 293 человека, а также клеточной линии ST свиньи, инкубированной при 37°C (98,6°F).

Таким образом, настоящее изобретение направлено на решение технической задачи обеспечения молекулярно-генетической системы, позволяющей получать функциональные вирусные частицы из РНК отрицательной полярности. Другой целью настоящего изобретения является обеспечение способа экспрессии аутогенных или экзогенных белков используемой вирусной частицы, а также экспрессии нуклеиновых кислот интерференционного ARN-типа.

Краткое описание чертежей

Фиг. 1: получение плазмид для транскрипции 8 вРНК из ISAV901_09: (1) плазмиды pSS-URG и плазмиды, содержащие каждый из сегментов генома ISAV, расщепляют рестрикционным ферментом SapI. Продукты расщепления визуализируют в 1% агарозном геле, а затем очищают; (2) расщепленный продукт, соответствующий сегменту генома ISAV, и линейную плазмиду pSS-URG лигируют лигазой T4, а затем это лигирование используют для трансформации хемокомпетентных бактерий; (3) клоны, содержащие ожидаемые рекомбинантные плазмиды, подвергают очистке для подтверждения правильной инсерции сегмента генома путем секвенирования.

Фиг. 2: схематическое изображение кассет pSS-URG, pSS-URG/S6-NotI и pSS-URG/S6-EGFP-HPR. Универсальный вектор содержит следующую последовательность: промотор S. salar (SS prom.); рибозим рыбы-молота (HH rib.); рибозим вируса гепатита δ (HDV rib.); терминатор транскрипции β-глобина кролика (Term.). Плазмиды pSS-URG/S6-Not и pSS-URG/S6-EGFP-HPR содержат кДНК антисмыслового инвертированного сегмента 6, который содержит 5' и 3' UTR и их модификации, сайт рестрикции NotI или последовательность, кодирующую EGFP.

Фиг. 3: ОТ-ПЦР сегмента 6-NotI-HPR из лососевых клеток ASK, трансфицированных плазмидами pSS-URG/S6-NotI-HPR. Электрофорез в агарозном геле продуктов ОТ-ПЦР сегмента 6 представлен в указанные сроки после трансфекции. Клетки ASK были трансфицированы с использованием Fugene 6 (Promega), а использованная плазмида представляла собой pSS-URG/сегмент 6.

Фиг. 4: Обратная генетика для получения рекомбинантного вируса ISA: клетки ASK трансфицируют 8 плазмидами pSS-URG/S1-8, позволяющими осуществить транскрипцию 8 вРНК (геном ISAV), совместно с 4 плазмидами, обеспечивающими экспрессию белков, образующих cRNP (PB2, PB1, PA и NP). Совместная трансфекция этих 12 плазмид в одной и той же клетке обеспечивает образование 8 клеточных рибонуклеинпротеинов (cRNP) в ядре, которые составляют минимальную единицу, необходимую для формирования вирусной частицы ISAV. Эти cRNP способствуют транскрипции и репликации вРНК, позволяя синтезировать все белки, которые образуют вирус, и генерировать новые cRNP, таким образом, формируя рекомбинантные вирусные частицы.

Фиг. 5: ОТ-ПЦР сегмента 6-NotI-HPR из клеток ST тестикул свиньи (a) и клеток HEK-293 человека (b), трансфицированных плазмидой pSS-URG/S6-NotI-HPR с использованием Fugene 6 (Promega). Электрофорез в агарозном геле продуктов ОТ-ПЦР сегмента 6 представлен в указанные сроки после трансфекции.

Фиг. 6: Электронная микроскопия рекомбинантного ISAV из срезов инфицированных клеток ASK. Цитоплазматическая мембрана с частицами ISAV, полученная инфицированием: (A) диким ISAV901_09, (B) rISAVS6-EGFP-HPR и (C) rISAV901_09; (D) - эндосомный срез, показывающий частицы rISAV901_09 внутри эндосом, которые соответствуют начальным стадиям слияния вирусных и эндосомных мембран. Масштабная линейка: 200 нм.

Осуществление изобретения

Использованные клеточные линии

Клетки ASK (www.atcc.org, CRL 2747), полученные из почки атлантического лосося, культивировали в среде Лейбовица (L-15, Hyclone) с добавлением 50 мкг/мл гентамицина, 10% бычьей сыворотки (SFB, Corning cellgro®, Mediatech), 6 мМ L-глутамина (Corning cellgro®, Mediatech) и 40 мкМ β-меркаптоэтанола (Gibco®, Life Technologies). Клетки RTG-2 (http://www.phe-culturecollections.org.uk, ECACC 90102529), полученные из ткани гонады радужной форели, культивировали в минимальной питательной среде (MEM, Hyclone) с добавлением 50 мкг/мл гентамицина, 10% SFB (Corning cellgro®, Mediatech), 10 мМ L-глутамина (Corning cellgro®, Mediatech), 1% неосновных аминокислот (Hyclone) и 10 мМ HEPES (Hyclone). Клетки CSE-119, полученные из эмбрионов кижуча (http://www.phe-culturecollections.org.uk, ECACC 95122019), культивировали в минимальной питательной среде (MEM, Hyclone) с добавлением гентамицина 50 мкг/мл, 10% SFB (Corning cellgro®, Mediatech), 2 мМ L-глутамина (Corning cellgro®, Mediatech) и 1% неосновных аминокислот (Hyclone). Клеточные линии выращивали при 16°C (60,8°F), без доступа CO2, за исключением CSE-119.

Клетки HEK293 (АТСС CRL 1573), человеческие эмбриональные клетки почки, культивировали в минимальной питательной среде Игла (EMEM, Hyclone) с добавлением гентамицина 50 мкг/мл, 10% FBS (Corning cellgro®, Mediatech), 10 мМ L-глутамина (Corning cellgro®, Mediatech), 1% неосновных аминокислот (Hyclone) и 10 мМ HEPES (Hyclone). Клетки ST (www.atcc.org, CRL 1746), полученные из тестикул свиней, культивировали в минимальной питательной среде Игла (EMEM, Hyclone) с добавлением 50 мкг/мл гентамицина, 10% FBS (Corning cellgro®, Mediatech), 10 мМ L-глутамина (Corning cellgro®, Mediatech), 1% неосновных аминокислот (Hyclone) и 10 мМ HEPES (Hyclone).

Очистка вирусных частиц ISAV

Очистку вируса проводили из 40 мл супернатанта клеток ASK, инфицированных штаммом ISAV901_09. Через 14 дней после инфицирования супернатант клеток отбирали и осветляли при 1000g в течение 20 минут при 4°C (39,2°F). Супернатант затем ультрацентрифугировали при 133200g в течение 2 часов при 4°C (39,2°F), и полученный осадок суспендировали в 100 мкл буфера TNE в течение ночи при 4°C (39,2°F). Затем суспензию загружали в 4 мл 20% масс./об. сахарозы в буфере TNE и ультрацентрифугировали при 124200g в течение 2 ч при 4°С (39,2°F) и, наконец, полученный осадок повторно суспендировали в 50 мкл буфера TNE.

Экстракция вирусной РНК

Экстракция вирусной РНК (вРНК) выполнялась из 50 мкл очищенного вируса ISAV901_09 с использованием коммерчески доступного набора E.Z.N.A. Total RNA Kit II (Omega, Bio-Tek, Inc.) в соответствии с указаниями производителя. Затем количество очищенной РНК определяли путем измерения поглощения на 260 нм с помощью оборудования Nanoquant Infinite M200 pro (TECAN, Австрия), полученная концентрация вРНК составила 2,7 мкг/мкл. Препарат вРНК до использования хранили при -80°С (-112°F).

Амплификация полных 8 геномных сегментов IASV901_09, анализ биоинформатики и разработка праймеров

Были собраны последовательности, содержащие некодирующие концы 5' и 3' UTR восьми геномных сегментов, упомянутых в публикациях Fourrier et al., Kulshreshtha et al. и Merour et al. (11, 17, 20). Эти последовательности соответствуют двум шотландским изолятам (390/98 и 982/08), одному норвежскому изоляту (Glesvaer/2/90), двум канадским изолятам (NBISA01 и RPC NB 98-049) и чилийскому изоляту (ADL-PM 3205 ISAV). Множественное выравнивание было выполнено с использованием программы ClustalW2. На основе анализа выравниваний были разработаны универсальные праймеры для амплификации 8 полных сегментов, включая области 5' и 3' UTR любого штамма ISAV (таблица 1).

ОТ-ПЦР

Вирусная РНК ISAV901_09 (7) была получена экстракцией из очищенного вируса, кДНК восьми геномных сегментов были получены с помощью ОТ-ПЦР. Для этого была применена одноступенчатая система SuperScript™ One-Step RT-PCR System с набором Taq Platinum DNA Polymerase (Invitrogen), использованная в соответствии с указаниями производителя. Для получения кДНК каждого сегмента в реакции ОТ-ПЦР использовали праймер F (прямой) (10 мкМ) и соответствующий праймер R (обратный) (таблица 1) и 50 нг вирусной РНК.

Таблица 1: Праймеры для амплификации 8 полных сегментов ISAV

Праймер 5' к 3' праймер F (прямой) 5' к 3' праймер R (обратный)
1a AGCTAAGAATGGACTTTATATCAGAAAACACG AACCTTCGAAGCCAAACAGATAG
1b CAATATCAAGTCCGTTCGACGTGG AGTAAAAAATGGACATTTTATTGATTAAAAGTATCGTC
2 AGCAAAGAACGCTCTTTAATAACC AGTAAAAAATGCTCTTTTACTTATTAAAAAT
3 AGCAAAGATTGCTCAAATCCC AGTTAAAATTGCTCTTTTCTTTATTTG
4 AGCTAAGATTGGCTGTTTCAAGA AGTAAAAATTGGCTTTTTGGAAAA
5 AGTTAAAGATGGCTTTTCTAACAATTTT AGTAAAAATTGGCTATTTATACAATTAATAATG
6 AGCAAAGATGGCACGATTCA AGTAAAAAATGCACTTTTCTGTAAACG
7 AGCTAAGATTCTCCTTCTACAATGGA AGTAAAAATTCTCCTTTTCGTTTTAAA
8 AGCAAAGATTGGCTATCTACCA AGTAAAAAAAGGCTTTTTATCTTTTG

Секвенирование

Образцы кДНК геномных сегментов ISAV были клонированы в векторе pGEMT-easy (Promega) в соответствии с указаниями производителя. Три клона каждой плазмиды секвенировали с использованием универсальных праймеров для промотора Т7 и SP6 в дополнение к внутренним праймерам для каждого сегмента, как описано в Cottet et al. (7).

Результаты секвенирования анализировались с использованием программы BioEdit Sequence Alignment Editor 7.1.3, а для подтверждения идентичности последовательностей было выполнено локальное выравнивание с использованием сервера BLAST. Кроме того, с использованием сервера ClustalW2 было выполнено множественное выравнивание последовательностей всех сегментов ISAV901_09, полученных с концами 3' и 5' UTR. Полученные полные последовательности 8 сегментов ISAV901_09 (с концами 3' и 5' UTR) были использованы для синтеза генома ISAV901_09 (Genscript Co., США), при этом в их концы внедрялись сайты расщепления для фермента SapI, избегая, таким образом, ошибок при последующем клонировании в векторе pSS-URG.

Разработка универсальной векторной плазмиды pSS-URG

Для получения плазмиды, допускающей транскрипцию вРНК ISAV, с использованием достижений в синтетической биологии (Genscript Co.) была синтезирована кассета и внедрена в плазмиду pUC57. Новый сформированный вектор был назван pSS-URG (плазмида для универсальной обратной генетики атлантического лосося). На фиг. 1с показана схема всех элементов, необходимых для правильной транскрипции вРНК. В направлении слева направо следуют: ITS-1 область атлантического лосося в качестве промотора; последовательность рибозима рыбы-молота; рибозим вируса гепатита Дельта (δ); между последовательностями двух рибозимов расположены участки рестрикции для фермента удаленной рестрикции SapI (New England Biolabs) и, наконец, терминатор транскрипции β-глобина кролика. Эта инновационная конфигурация позволяет внедрять любой геномный сегмент ISAV или любую другую нуклеотидную последовательность без включения других последовательностей в оба конца вРНК. Затем каждая из 8 кДНК полных сегментов ISAV была клонирована в плазмиду pSS-URG. Таким образом, был получен набор плазмид, называемых pSS-URG/1, pSS-URG/2, pSS-URG/3, pSS-URG/4, pSS-URG/5, pSS-URG/6, pSS-URG/7 и PSS-URG/8 (фиг. 1е).

Векторы PSS-UGR/S6-NotI-HPR и pSS-UGR/S6-EGFP-HPR

На основе вектора pSS-URG была сформирована конструкция, содержащая полную последовательность (включая концы 3' и 5' UTR) антисмыслового инвертированного сегмента 6 ISAV901_09. В качестве маркера вектор имеет дополнения в рамке внутри области HPR сегмента 6 в виде девяти нуклеотидов, содержащих сайт рестрикции для фермента NotI nt 1,015 5'-gtagca[GCGGCCGCA]acatct-3' nt 1,036 (фиг. 2). Разработанный вектор, называемый pSS-UGR/S6-NotI-HPR, был синтезирован на GenScript Co. с использованием pUC57 в качестве основы. Для генерации вектора pSS-URG/S6-EGFP-HPR последовательность, кодирующую усиленный зеленый флуоресцентный белок (EGFP), клонировали в вектор pSS-UGR/S6-NotI-HPR с использованием рестрикционного сайта NotI в области HPR (фиг. 2).

Векторы для экспрессии белков PB2, PB1, PA и NP ISAV901_09

Из открытых рамок считывания (ORF) сегментов 1, 2, 3 и 4 вируса ISA901_09 было выполнено кодирование для PB2, PB1, PA и NP, соответственно, (SEQ ID No 7, 8, 9, 10), которые были клонированы в pGemT-свободный вектор (7), и с Pfx Platinum (Invitrogen) выполнена ПЦР высокой точности. Праймеры, использованные для амплификации каждого из генов, показаны в таблице 2, которая содержит сайты рестрикции для ферментов NcoI, SmaI и XhoI (New England biolabs). Клонирование ORF PB2 и PA проводили с рестрикционными ферментами NcoI и XhoI, клонирование ORF из PB1 осуществляли с помощью рестрикционных ферментов SmaI и XhoI, а клонирование ORF, кодирующей NP, - с помощью рестрикционных ферментов MluI и XbaI. Для экспрессии PB2, PB1 и PA ORF сегментов 1, 2 и 3 были клонированы в векторе pTriex3 (Novagen). С другой стороны, для экспрессии NP-белка ORF сегмента 3 была клонирована в векторе pCI-neo (Promega).

Таблица 2: Праймеры для амплификации ORF PB2, PB1, PA и NP ISAV901_09 для клонирования векторов CMV.

ORF 5' к 3' праймер F 5' к 3' праймер R
PB2 NcoI-ATGCCATGGACTTTATATCAGAA
AACACGATCAGCG
XhoI-CCGCTCGAGAACACCATATTCATC
CATAGG
PB1 SmaI-TCCCCCGGGAAACTCTAGTAGGTG XhoI-CCGCTCGAGAACACGCTTTTTCTTCTT AATCAC
NP MluI-CGACGCGTCATGGCCGATAAAGGT ATGAC XbaI-CGCTCTAGATCAAATGTCAGTGTCTTC CTC
PA NcoI-CATGCCATGGATAACCTCCGTGAA TGCATAAACC XhoI-CCGCTCGAGTTGGGTACTGACTGCAA TTTTC

Эксперимент транскрипции ex vivo, кинетика трансфекции клеток ASK вектором pSS-URG/Seg6-NotI

Для проверки функциональности базового вектора pSS-URG клетки ASK высевали с плотностью 2,5×104 клеток/см2 на лунку в 24-луночном планшете (SPL) в среде Лейбовица (L-15, Hyclone) с добавлением гентамицина (50 мкг/мл) и 10% фетальной бычьей сыворотки (SFB, Hyclone), и культивировали при 18°C (64,4°F) до достижения 80% конфлюэнтности. Клетки трансфицировали вектором pSS-URG/S6-NotI-HPR с использованием Fugene 6 (Promega) в соотношении 1:6 в соответствии с указаниями производителя. Клетки инкубировали при 16°С (60,8°F) в течение 3 часов, затем в точках кинетики трансфекции 0, 3, 6, 9, 12 и 15 часов смесь удаляли и клетки дважды промывали фосфатно-солевым буферным раствором (PBS). Из клеток каждой лунки в каждой точке кинетики с использованием E.Z.N.A. Total RNA Kit II (Omega, Bio-Tek) элиминировали ДНК с помощью обработки RQ-ДНКазой (Promega). Полученную РНК подвергали ОТ-ПЦР с использованием праймеров для сайта рестрикции NotI и конца 5' UTR вирусного сегмента 6 (таблица 3).

Таблица 3: Праймеры для амплификации вРНК в S6-NotI

Праймер Последовательности 5' к 3'
F S6-NotI GTAGCAGCGGCCGCA
R S6-5'UTR AGTAAAAAATGCACTTTTCTGAAACG

Посредством обратной транскрипции (RT) с использованием фермента обратной транскриптазы M-MuLV (обратной транскриптазы вируса мышиного лейкоза Молони, 200 ед./мкл, New England BioLabs) была получена кДНК. Смесь для обратной транскрипции была приготовлена в конечном объеме 25 мкл в соответствии с указаниями производителя. Затем кДНК использовали для проведения ПЦР-реакции с ДНК-полимеразой Paq5000 (Agilent Technologies). Продукты ПЦР визуализировали электрофорезом при 90 В в течение 1 часа на 2% окрашенном бромистым этидием (10 мг/мл) агарозном геле (фиг. 3).

Формирование рекомбинантного ISAV (ISAVr) посредством системы обратной генетики на основе плазмиды

Клетки ASK высевали с плотностью 2,5×104 клеток/см2 на планшетах Nunc™ Lab-Tek™ II Chamber Slide™ System, а затем инкубировали в течение 72 часов при 18°C (64,4°F). Клетки трансфицировали с помощью Fugene 6 (Promega) 1:6 в соответствии с указаниями производителя. Что касается формирования ISAVr901_09, то в общей сложности использовалось 250 нг смеси векторов pTriex-3-PB2, pTriex-3-PB1, pTriex-3-PA и pCI-neo-NP и 1 мкг общего количества восьми pSS-URG (PSS-URG/1-8) векторов. Восстановление rISAVS6-NotI-HPR и rISAVS6-EGFP-HPR вирусов осуществляли путем замены pSS-URG/6 на pSS-UGR/S6-NotI-HPR и pSS-URG/S6-EGFP-HPR, соответственно. Клетки затем инкубировали в 1 мл среды L-15 в течение 7 дней при 16°C (60,8°F) (фиг. 4).

Инфицирование клеток ASK с помощью ISAVrS6-EGFP-HPR

Клетки ASK высевали при плотности 2,5×104 клеток/см2 на лунку в 8-луночных планшетах Nunc™ Lab-Tek™ II Chamber Slide™ System и культивировали при 16°C (60,8°F) до достижения 90% конфлюэнтности. Затем клетки дважды промывали с помощью PBS и осуществляли слепые пассажи в 100 мкл раствора 1:10 супернатанта либо из пассажа 0 (P0) через 7 дней после трансфекции, либо из других пассажей через 7 дней после инфицирования ISAVrS6-EGFP-HPR в среде L-15 без SFB с гентамицином (50 мкг/мл). Клетки инкубировали в течение 4 часов при 16°C (60,8°F), затем дважды промывали с помощью PBS и добавляли 500 мкл среды L-15 с 10% SFB и гентамицином (50 мкг/мл), затем инкубировали в течение 7 дней при 16°C (60,8°F). В ходе данной процедуры в дополнение к P0 каждые 7 дней получали другие вирусные пассажи до четвертого пассажа ISAVrS6-EGFP-HPR. Супернатант каждого пассажа до его дальнейшего анализа хранился при -20°C (фиг. 4).

Обнаружение ISAVrS6-EGFP-HPR

Экстракция РНК, ОТ-ПЦР и ПЦР в реальном времени (РВ-ПЦР)

Для определения ISAVrS6-EGFP-HPR экстрагировали в общей сложности 350 мкл РНК из клеточного супернатанта клеток ASK, трансфицированных 12 плазмидами, на 7 день после трансфекции (P0 ISAVrS6-EGFP-HPR) или из супернатантов слепых пассажей с 1-го по 4-й, в экстрагированной РНК посредством ОТ-ПЦР обнаруживали вРНК сегмента 6, EGFP, и сегмента 6-EGFP.

Перед реакцией ОТ-ПЦР РНК обрабатывали ДНКазой (Promega), не содержащей РНКазы.

Для реакции обратной транскрипции (RT) использовали праймеры F-UTR-S6 (таблица 1), праймеры F-S6 (таблица 3) или праймеры EGFP (таблица 4) с применением фермента RT M-MLV (200 ед./мкл, Promega) в соответствии с указаниями производителя.

Таблица 4: Праймеры для обнаружения вРНК в S6-EGFP-HPR

Праймер 5' к 3' праймер F 5' к 3' праймер R
S6 TGAGGGAGGTAGCATTGCAT AAGCAACAGACAGGCTCGAT
EGFP CTGGAAGTTCATCTGCACCAC TGCTCAGGTAGTGGTTGTC
S8 GAAGAGTCAGGATGCCAAGACG GAAGTCGATGAACTGCAGCGA

Для ПЦР использовали праймеры из набора GoTaq® Green Master Mix (Promega), а также прямые (S6 или EGFP) и обратные (S6 или EGFP) праймеры. Использовалась следующая термическая программа: 95°C в течение 2 минут, 35 циклов при 95°C в течение 30 секунд, 59,1°C для EGFP или 54°C для S6 или S6-EGFP в течение 30 секунд, 72°C в течение 30 секунд и конечное удлинение при 72°С в течение 5 минут. Во всех случаях проводили повторную амплификацию продуктов ПЦР с использованием тех же праймеров. Продукты повторной амплификации ПЦР визуализировали путем электрофореза в 1% (масс./об.) агарозном геле, выдерживали при 90°В в течение 45 минут и окрашивали этидиумбромидом (10 мг/мл).

Чтобы определить количество копий вРНК, проводили РВ-ПЦР с использованием абсолютного метода, описанного в Munir and Kibenge (22), причем стандартная кривая была сформированаа из плазмиды pSS-URG/S8. ОТ-ПЦР анализ в реальном времени проводился на оборудовании Eco Real-Time PCR System (Illumina) с использованием SensiMix™ SYBR® Hi-ROX Kit (Bioline) в соответствии с указаниями производителя и с использованием F-S8 и R-S8-праймеров (таблица 4). Термический профиль, использованный для амплификации области сегмента 8, содержал начальный цикл денатурации в течение 10 минут при 95°С и последующие 40 циклов амплификации (15 секунд при 95°C, 15 секунд при 60°C и 15 секунд при 72°С). После циклов амплификации был проведен цикл диссоциации (30 секунд при 95°C, 30 секунд при 55°C и 30 секунд при 95°C). Данную процедуру проводили для пассажа 4 рекомбинантного вируса. Полученные результаты были проанализированы с помощью программного обеспечения EcoStudy.

Конфокальная микроскопия

На 7-й день после инфицирования клетки ASK, зараженные rISAVS6-EGFP-HPR, были проанализированы в каждом пассаже рекомбинантного вируса с помощью конфокальной микроскопии с использованием процедуры, описанной в Rivas-Aravena et al. (45). За фиксированными клетками наблюдали, используя конфокальный микроскоп LSM 510 (Zeiss) с использованием программного обеспечения LSM image Browser для обнаружения rISAVS6-EGFP-HPR путем визуализации флуоресценции EGFP. Кроме того, rISAV детектировали с использованием анти-НЕ моноклонального антитела (BiosChile), как уже было описано (45).

Мечение методом лизиса

Клетки ASK высевали при плотности 2,5×104 клеток/см2 на лунку в 12-луночном планшете (SPL) и инкубировали при 16°C до достижения 100% конфлюэнтности. Вариант ISAVrS6-EGFP-HPR в пассаже 4 был помечен. Процедуру выполняли в соответствии с Castillo-Cerda et al (35).

Количественное определение флуоресценции ISAVrS6-EGFP-HPR

Клетки ASK высевали с плотностью 2,5×104 клеток/см2 на лунку в 48-луночном планшете (SPL) и инкубировали при 16°C до достижения 100% конфлюэнтности. Пассаж 4 ISAVrS6-EGFP-HPR был помечен. С этой целью серийные разведения каждого вирусного инокулята выполняли от 10-1 до 10-6 с шагом разбавления 10 в среде L-15 без FBS. Затем культуральную среду удаляли и в каждую лунку добавляли 400 мкл вирусного инокулята и инкубировали при 16°С в течение 4 часов для обеспечения абсорбции вируса. Затем инокулят был удален из каждой лунки, клетки промыли дважды с помощью PBS, а затем добавили среду L-15 с содержанием 10% SFB, 6 мМ L-глутамина (Corning cellgro®, Mediatech), 40 мкМ Β-меркаптоэтанола (Gibco®, Life Technologies) и 50 мкг/мл гентамицина. Планшеты инкубировали в течение 7 дней при 16°C. По окончании заражения супернатанты из каждой лунки анализировали, при этом флуоресценцию количественно определяли с использованием оборудования Nanoquant Infinite M200 pro (TECAN, Австрия), с возбуждением на 485 нм и с детектированием излучения на 535 нм. Эти супернатанты также использовали для экстракции полной РНК и проведения последующей ПЦР в реальном времени для количественного определения вРНК в сегменте 8 ISAV и для определения, таким образом, числа копий клеточной культуры из сегмента 8, как описано выше.

Кинетика заражения ISAV901_09, ISAVr901_09, ISAVrS6/EGFP-HPR

Заражение клеток ASK проводили четвертым пассажем ISAVrS6/EGFP-HPR, используя четвертый пассаж ISAVr901_09 в качестве контроля, в дополнение к дикому ISAV901_09. Для каждого изолята вируса было проведено заражение при показателе множественности заражения (MOI) 0,01. Кинетику инфекции оценивали путем сбора образцов в 0, 2, 4 и 7 дни после инфицирования, затем проводили экстракцию РНК, обработку ДНКазой, после чего проводили РВ-ПЦР для количественного определения вРНК сегмента 8 ISAV каждого супернатанта клеточной культуры (22).

Визуализация частиц

Клетки ASK высевали, как указано выше, и культивировали при 16°С до достижения 90% конфлюэнтности. Затем клетки инфицировали 400 мкл раствора 1:10 вируса ISAVrS6/EGFP-HPR пассажа 4, или rISAV901_09 пассажа 4, или дикого штамма ISAV901_09 в качестве контроля. Через четыре дня после инфицирования клетки фиксировали 2,5% глутаральдегидом в какодилатном буфере 0,1 М при pH 7,2 в течение 6 часов при комнатной температуре и затем промывали буфером какодилата натрия 0,1 M при pH 7,2 в течение 18 часов при 4°C. После этого образцы фиксировали 1% водным тетроксидом осмия в течение 90 минут, а затем промывали дистиллированной водой и окрашивали водным раствором 1% уранилацетата в течение 60 минут. Далее образцы дегидратировали промыванием по 20 минут в последовательности буферов, содержащих ацетон 50%, 70%, 2×95% и 3×100%. В конце образцы выдерживали в смеси эпоксидной смолы epon и ацетона в соотношении 1:1 в течение ночи и затем помещали в чистую эпоксидную смолу epon, которую полимеризовали при 60°C в течение 24 часов. Тонкие срезы (60-70 нм) были получены в ультрамикротоме Sorvall MT-5000 и затем установлены на медные сетки, окрашены 4% уранилацетатом в метаноле в течение 2 мин и затем обработаны цитратом в течение 5 мин. За образцами велось наблюдение с помощью электронного микроскопа Philips Tecnai при напряжении от 12 кВ до 80 кВ (фиг. 6).

ПРИМЕРЫ

Геном штамма ISAV901_09, адаптированного к клеточной культуре

Был выстроен полный геном вирусного изолята ISAV901_09 (HPR 1c), адаптированного к культуре клеток.

Выравнивание между некодирующими областями (UTR) 5' и 3' концов полных последовательностей шести изолятов ISAV - двух шотландских (390/98 и 982/08), одного норвежского (Glesvaer/2/90), двух канадских (NBISA01 и RPC NB 98-049), и одного чилийского (ADL-PM 3205 ISAV) - показало высокий консерватизм на концах каждого сегмента вирусного генома, что позволило разработать универсальные праймеры, описанные в таблице 1. Праймеры использовали для амплификации генома чилийского штамма ISAV901_09. Результат секвенирования восьми сегментов вирусного генома показан в таблице 4. Размеры восьми вирусных сегментов варьируются от 2267 до 906 п.н. для сегментов 1 и 8, соответственно.

Последовательность областей 3' UTR варьировалась от 7 нуклеотидов в сегменте 6 до 48 нуклеотидов в сегменте 3 и различий в размере каждого конца 3' UTR, ранее описанных для 6 проанализированных геномов, не наблюдалось, за исключением добавления нуклеотида на конце 3' UTR сегмента 7. Последовательности концов 5' UTR ISAV901_09 варьировались от 67 нуклеотидов в сегменте 4 до 147 нуклеотидов в сегменте 3. Выравнивание областей UTR также указывает, что ISAV901_09 имеет высокое сходство со штаммом ISAV Glesvaer/2/90 (от 97% до 98% идентичности).

Разработка универсального вектора для обратной генетики ISAV

Для получения вектора, экспрессирующего сегменты полноразмерной вирусной РНК без дополнительных нуклеотидов, с использованием преимущества синтетической биологии была разработана инновационная конфигурация, включающая элементы, ранее использованные в обратной генетике РНК вирусов, такие как рибозимы рыбы-молота и вируса гепатита дельта (δ), а также элементы генома вида Salmo salar. Разработанный вектор был назван pSS-URG (плазмида для универсальной обратной генетики атлантического лосося). Вектор содержит правильно связанные компоненты, упорядоченные в направлении слева направо следующим образом: ITS-1 область Salmo salar в качестве промотора, последовательность рибозима рыбы-молота, рибозим вируса гепатита дельта (δ), причем последовательности двух рибозимов включают в себя два рестрикционных участка для фермента SapI (New England Biolabs), и терминатор β-глобина кролика в качестве терминатора транскрипции (фиг. 2). Этот вектор позволяет клонировать любой вирусный сегмент без включения дополнительных последовательностей, используя фермент удаленной рестрикции, такой как SapI. Таким образом, это исследование представляет вектор, являющийся основой системы обратной генетики для вируса ISA.

После синтеза плазмиды pSS-URG было выполнено субклонирование восьми сегментов генома ISAV из синтетических геномов с использованием фермента SapI удаленной рестрикции (данные не показаны). В дополнение к клонированию восьми вирусных сегментов, в качестве генетического маркера и для доказательства того, что сгенерированные вирусы являются рекомбинантными агентами и не вызваны загрязнением процедуры, два генетических элемента были встроены в область HPR универсального вектора, содержащего сегмент 6. Первый генетический вариант соответствует встраиванию в область HPR последовательности из девяти нуклеотидов с сайтом рестрикции для фермента NotI, где этот новый вектор обозначен как pSS-URG/S6-NotI-HPR. Второй генетический вариант соответствует продукту клонирования последовательности, кодирующей EGFP, с использованием ранее созданного сайта NotI, таким образом, получается новый вектор, обозначенный как pSS-URG/S6-EGFP-HPR.

Анализ функциональности вектора pSS-URG с помощью экперимента по транскрипции ex vivo

С целью определить, все ли внедренные в вектор элементы обеспечивают экспрессию вирусной РНК в клетках лосося, а также вследствие неопределенности относительно функциональности предполагаемого промотора в области ITS-1 Salmo salar, клетки ASK трансфицировали pSS-URG/S6-NotI-HPR-плазмидой в эксперименте по транскрипции ex vivo. Чтобы определить наличие процесса транскрипции, анализ функциональности проводился путем обнаружения RNAV в моменты времени 0, 3, 6, 9, 12 и 15 часов после трансфекции посредством ОТ-ПЦР. Реакцию обратной транскрипции осуществляли с использованием единственного комплементарного сайта рестрикции NotI. Неожиданно результат анализа показал наличие продукта ПЦР, начиная с трех часов после трансфекции с ростом интенсивности до 15 часов после трансфекции (фиг. 3). Этот результат указывает на то, что из трансфицированной плазмиды pSS-URG/S6-NotI-HPR клетка продуцирует РНК, имеющую сайт рестрикции NotI, и, следовательно, область ITS-1 Salmo salar соответствует промоторному элементу. Для доказательства генерации вирусной РНК без дополнительных нуклеотидов проводили ОТ-ПЦР со специфическими праймерами для каждого рибозима и результаты показали невозможность получения в любой точке кинетики продукта амплификации с праймерами, распознающими последовательности рибозимов, и это указывает на то, что сгенерированная РНК не имеет дополнительных областей, таких как, например, рибозимы (данные не показаны).

Эти результаты указывают на возможность использования области ITS-1 и внедрения в вектор pSS-URG для экспрессии РНК любого типа внутри клеток. Например, РНК может быть экспрессирована как интерферирующая РНК, заглушающая РНК или микро-РНК.

Получение рекомбинантного вируса ISA (ISAVr)

Как сообщалось, для вируса гриппа функциональная минимальная единица вируса соответствует комплексу рибонуклеопротеида (RNP), который состоит из вирусной РНК, связанной множественными копиями NP и вирусной полимеразой, включая субъединицы PB1, PB2 и PA. Для образования комплексов RNP в лососевых клетках ORF сегментов 1-4 ISAV901_09 были клонированы в векторы экспрессии, управляемые промотором цитомегаловируса. Таким образом, ORF сегментов 1, 2 и 4 были клонированы с использованием вектора pTriEx-3 (Novagen), с получением векторов pTRiex3-PB2, pTRiex3-PB1, pTRiex3-PA. Кроме того, был клонирован сегмент 3 с использованием вектора pCI-neo (Promega), с формированием вектора pCI-neo-NP (данные не показаны). Трансфекция этих векторов в клетки лосося обеспечивает экспрессию рекомбинантных белков PB2, PB1, PA и NP, соответственно.

Формирование ISAVrS6-NotI-HPR

Для формирования ISAVrS6-NotI-HPR клетки ASK были котрансфицированы двенадцатью плазмидами, четыре из которых соответствуют экспрессирующим векторам pTRiex3-PB2, pTRiex3-PB1, pTRiex3-PA и pCI-neo-NP, а остальные восемь соответствуют плазмидам для обратной генетики pSS-URG с каждым из восьми сегментов генома ISAV901_09 в качестве ДНК, заменяя нативный сегмент 6 на Seg6-NotI-HPR. Для амплификации и определения присутствия рекомбинантного вируса, после трансфекции клеток было проведено два слепых пассажа в клетках ASK с инфицированием супернатантами, полученными от предыдущих трансфекций. С одной стороны, с помощью ОТ-ПЦР было обнаружено присутствие вРНК сегмента 6 (NotI/HPR) с получением продукта с ожидаемым размером 306 п.н., как в РНК, выделенной из супернатанта трансфекции, так и в двух последующих пассажах, что свидетельствует о наличии инфекционных вирусов. Супернатант второго пассажа использовали для инфицирования большего количества клеток ASK. В инфицированных клетках, которые демонстрировали очевидный цитопатический эффект (данные не показаны), с помощью просвечивающей электронной микроскопии был визуализирован рекомбинантный вирус. На фиг. 6 показаны сферические частицы диаметром приблизительно 100 нм, подобные вирусам, что позволяет предположить их соответствие рекомбинантным вирусам. Таким образом, оказалось возможным обнаружить в инфицированных клетках рекомбинантный вирус ISAVrS6-NotI-HPR с репликативной активностью и воспроизводимым цитопатическим эффектом в пассажах после их формирования.

Формирование ISAVrS6-EGFP-HPR

Для получения рекомбинантного вируса ISA, содержащего ген-репортер, такой как EGFP, для облегчения мониторинга ex vivo и отсева результатов, представляющих собой артефактные результаты или контаминацию, клетки ASK одновременно были трансфицированы двенадцатью плазмидами: четыре из них соответствовали векторам экспрессии pTRiex3-PB2, pTRiex3-PB1, pTRiex3-PA и pCI-neo-NP, остальные восемь плазмид соответствовали векторам pSS-URG/1, pSS-URG/2, pSS-URG/3, pSS-URG/4, pSS-URG/5, pSS-URG/7 и pSS-URG/8, а также содержали сегмент 6 с вектором pSS-URG/S6-EGFP-HPR; вирус, содержащий EGFP в области HPR белка, назван ISAVrS6-EGFP-HPR.

Чтобы определить, были ли после трансфекции получены рекомбинантные вирусные частицы, супернатант культуры (пассаж 0, P0) анализировали через 7 дней после трансфекции. С этой целью с помощью ОТ-ПЦР первоначально была обнаружена РНК сегмента 6, далее - последовательность, кодирующая EGFP во втором продукте ПЦР и, наконец, область, содержащая как часть сегмента 6, так и EGFP. Результаты показали, что продукты ОТ-ПЦР для сегмента 6 имеют различное расстояние миграции продуктов ПЦР для нативного вируса (~300 п.н.) и рекомбинантного вируса, имеющего EGFP в белке HE (1000 п.н.). ОТ-ПЦР кодирующей последовательности EGFP дает продукт ~500 п.н., который не наблюдается при анализе нативного вируса. В случае ОТ-ПЦР S6-EGFP, для рекомбинантного вируса, как и ожидалось, был получен продукт амплификации ~800 п.н.

Инфекционность ISAVrS6-EGFP-HPR в клетках ASK

Чтобы определить, действительно ли супернатант клеток ASK, трансфицированных двенадцатью плазмидами, содержит вирусный вариант ISAVrS6-EGFP-HPR с характеристиками инфекционного агента, в качестве репортера использовали флуоресценцию EGFP. Клетки ASK, инфицированные супернатантом, предположительно содержащим первое потомство ISAVrS6-EGFP-HPR, анализировали в конфокальном микроскопе через 7 дней после заражения. Результаты показали возможность визуализации клеток, испускающих зеленую флуоресценцию, характерную для EGFP, соответствующую первому пассажу вируса ISAVrS6-EGFP-HPR. Распределение метки EGFP было обнаружено главным образом в цитоплазме в направлении к плазматической мембране, флуоресценция в ядре клетки не наблюдалась. Чтобы подтвердить, что супернатант трансфицированных клеток (пассаж 0) содержит вирус ISAVrS6-EGFP-HPR с литической способностью, на ASK-клетках провели исследование методом лизисных бляшек.

Результат этого исследования показал, что рекомбинантный вирус обладает способностью формировать лизисные бляшки подобно дикому вирусу, с получением титра вируса порядка 1×104 БОЕ/мл.

Стабильность ISAVrS6-EGFP-HPR

Затем была проведена оценка способности этого рекомбинантного вируса поддерживать инфекционность и флуоресценцию в культуре клеток. Четыре слепых пассажа инфекции в клетках ASK проводились с 7-дневными промежутками. Затем в каждом супернатанте рекомбинантных вирусных пассажей проводили ОТ-ПЦР для детектирования вРНК как сегмента 6, так и кодирующей последовательности EGFP, а также области гибридной последовательности EGFP-S6. Результат позволил визуализировать продукт ПЦР - EGFP длиной 500 п.н. и гибридные последовательности EGFP-S6 длиной 800 п.н., что указывает на присутствие сегмента 6, содержащего ген EGFP во всех проанализированных супернатантах. Продукт ПЦР сегмента 6 указывает на продукт длиной 300 п.н. в супернатанте клеток ASK, инфицированных диким вирусом ISAV901_09, в отличие от продукта ПЦР длиной 1000 п.н., полученного в каждом из четырех пассажей вируса ISAVrS6-EGFP-HPR, чей более крупный размер является результатом внедрения в сегмент 6 гена EGFP.

Чтобы определить, что каждый из четырех пассажей не только содержит вирус с инфекционностью, но также способен к флуоресценции, указывая на правильную складку HE с EGFP в области HPR, инфицированные клетки ASK былы подвергнуты анализу конфокальной микроскопией. Конфокальная микроскопия выявила клетки, имеющие зеленую флуоресценцию во всех анализируемых пассажах, при увеличении обилия флуоресцирующих клеток с каждым следующим пассажем. Эти результаты показывают, что область белка HE, выбранная для внедрения EGFP, не зависит от внедрения этой ORF, что позволяет сформировать химерный рекомбинантный вирус ISA, способный к репликации, заражению и распространению в многочисленных пассажах без потери способности к флуоресценции. Титрование четвертого слепого пассажа, выполненного для вируса ISAVrS6-EGFP-HPR, с помощью РВ-ПЦР, дало титр 3,63×106 копий Seg 8/мл и значение 6,5×105 БОЕ/мл, полученное исследованием методом лизисных бляшек, с размером лизисной бляшки, подобным тому, который наблюдается после проведения испытания методом бляшек дикого вируса ISAV901_09.

Инфекционность ISAVrS6-EGFP-HPR в клеточных линиях лососевых

Чтобы определить, приводит ли внедрение последовательности в область HPR вируса ISAVrS6-EGFP-HPR к приобретению способности инфицировать другие виды лососевых или к потере инфекционности в пермиссивных клетках (клетки ASK), кинетика инфекции была исследована на RTG -2, CSE-119 и ASK клетках. Эксперимент ex vivo проводился в течение 7 дней с использованием четвертого пассажа флуоресцентного рекомбинантного вируса в сравнении с диким вирусом ISAV901_09 и четвертым пассажем дикого рекомбинантного вируса rISAV901_09 (MOI 0,01), полученного для этого испытания. Анализ на 0, 2, 4 и 7 точках на дюйм с помощью РВ-ПЦР, количественно определяющий количество копий сегмента 8 в каждом супернатанте, показал, что ни один из трех проанализированных вирусов не обладал способностью реплицироваться в клетках RTG-2 или в клетках CSE-119.

Напротив, кинетика инфекции, полученная на клетках ASK, показала, что первоначально вирус ISAV901_09 имеет большее количество копий, чем рекомбинантные вирусы, rISAV901 и rISAVS6-EGFP-HPR. Однако на второй день после инфицирования происходит увеличение количества копий рекомбинантных вирусов, почти достигающих титра 1000 сегмента 8/мл, что близко к титру диких вирусов. Эти результаты показывают, что внедрение EGFP в область HPR белка HE не изменяет репликативное поведение флуоресцентного рекомбинантного вируса в клетках ASK и не расширяет круг хозяев, по меньшей мере, в экспериментах ex vivo в клетках RTG-2 или в клетках CSE-119.

Исходя из этих результатов, можно сделать вывод, что в плазмиду pSS-URG можно внедрять последовательность, кодирующую как вирусный белок, так и экзогенный или химерный белок, таким образом, обеспечивая получение модифицированного или химерного рекомбинантного вируса ISA, при этом такие модификации не будут влиять на его инфекционные характеристики или характеристики распространения.

Функциональность плазмиды pSS-URG в линиях клеток лосося, свиньи и человека

Для определения способности вектора pSS-URG/S6-NotI-HPR транскрибировать сегмент 6 в виде вРНК, его трансфицировали в клетки ASK с использованием Fugene 6 (Promega) в соотношении 1:6 в соответствии с указаниями производителя. Точка 0 часов после трансфекции рассматривается как время добавления трансфекционной смеси в клетки. Начальная инкубация происходила в течение 3 часов при 16°C. После истечения времени инкубации трансфекционную смесь удалили и клетки промыли дважды с помощью PBS, это соответствует времени 3 часов после трансфекции. В каждой точке трансфекционной кинетики (0, 3, 6, 9, 12 и 15 часов после трансфекции) клетки удаляли для извлечения полной РНК, а возможную загрязняющую ДНК удаляли ДНКазой I. После получения РНК, вРНК сегмента 6 NotI детектировали с помощью ОТ-ПЦР с использованием специфических праймеров для сегмента 6 NotI. Такой анализ позволил наблюдать продукт ПЦР ожидаемого размера 306 п.н., начиная с 3 часа после трансфекции с ростом интенсивности до 15 часа после трансфекции (фиг. 3). Таким образом, было доказано, что плазмида pSS-URG является функциональной.

Неожиданно способность транскрибировать вирусную РНК оказалась не ограниченной клетками лосося, культивированными при 16°С. При использовании той же методики (с инкубациями при 37°C), но выполненной только на 12 час после трансфекции, функциональность наблюдалась в клеточной линии HEK 293 человека и клеточной линии ST свиней, инкубированных при 37°C (фиг. 5). Это отражено в получении продукта ОТ-ПЦР ожидаемого размера, что позволяет сделать вывод о функциональности вектора как в линиях клеток лосося, инкубированных при 16°C, так и клеточных линиях млекопитающих, инкубированных при 37°C. Этот продукт является инструментом, обеспечивающим экспрессию любой РНК в клетках или тканях хладнокровных или теплокровных позвоночных животных.

ISAVrS6-EGFP-HPR: корреляция между количеством вирусных копий и измеренной флуоресценцией

Поскольку вирус ISAVrS6-EGFP-HPR при заражении клеток ASK имеет характеристики, сходные с диким вирусом, а также имеет преимущество, обеспечивая возможность мониторинга инфекции путем внедрения EGFP в качестве репортера, была поставлена цель определить, существует ли корреляция между вирусной нагрузкой и флуоресценцией в супернатанте инфекции, вызванной этим рекомбинантным вирусом. Анализ с помощью РВ-ПЦР и количественного определения флуоресценции, проведенный на последовательных разведениях флуоресцентного рекомбинантного вируса, показал, что существует прямая зависимость между увеличением флуоресценции и увеличением вирусного титра раствора, с интенсивностью флуоресценции 500 ед./мл для титра 2×106 копий/мл.

ССЫЛОЧНЫЕ ДОКУМЕНТЫ

1. Asche, F., H. Hansen, R. Tveteras, and S. Tveterås. 2009. The salmon disease crisis in Chile. Marine Resource Economics 24:405-411.

2. Aspehaug, V., K. Falk, B. Krossoy, J. Thevarajan, L. Sanders, L. Moore, C. Endresen, and E. Biering. 2004. Infectious salmon anemia virus (ISAV) genomic segment 3 encodes the viral nucleoprotein (NP), an RNA-binding protein with two monopartite nuclear localization signals (NLS). Virus Res 106:51-60.

3. Aspehaug, V., A. B. Mikalsen, M. Snow, E. Biering, and S. Villoing. 2005. Characterization of the infectious salmon anemia virus fusion protein. J Virol 79:12544-12553.

4. Bouchard, D., W. Keleher, H. M. Opitz, S. Blake, K. C. Edwards, and B. L. Nicholson. 1999. Isolation of infectious salmon anemia virus (ISAV) from Atlantic salmon in New Brunswick, Canada. Dis Aquat Organ 35:131-137.

5. Castro, J., L. Sanchez, P. Martinez, S. D. Lucchini, and I. Nardi. 1997. Molecular analysis of a NOR site polymorphism in brown trout (Salmo trutta): organization of rDNA intergenic spacers. Genome / National Research Council Canada = Genome / Conseil national de recherches Canada 40:916-922.

6. Comai, L. 2004. Mechanism of RNA Polymerase I Transcription, p. 123-155. In C. C. Ronald and C. Joan Weliky (ed.), Advances in Protein Chemistry, vol. Volume 67. Academic Press.

7. Cottet, L., M. Cortez-San Martin, M. Tello, E. Olivares, A. Rivas-Aravena, E. Vallejos, A. M. Sandino, and E. Spencer. 2010. Bioinformatic analysis of the genome of infectious salmon anemia virus associated with outbreaks with high mortality in Chile. J Virol 84:11916-11928.

8. Dannevig, B. H., K. Falk, and E. Namork. 1995. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol 76 (Pt 6):1353-1359.

9. Devold, M., K. Falk, B. Dale, B. Krossoy, E. Biering, V. Aspehaug, F. Nilsen, and A. Nylund. 2001. Strain variation, based on the hemagglutinin gene, in Norwegian ISA virus isolates collected from 1987 to 2001: indications of recombination. Dis Aquat Organ 47:119-128.

10. Fodor, E., L. Devenish, O. G. Engelhardt, P. Palese, G. G. Brownlee, and A. Garcia-Sastre. 1999. Rescue of influenza A virus from recombinant DNA. J Virol 73:9679-9682.

11. Fourrier, M., S. Heuser, E. Munro, and M. Snow. 2011. Characterization and comparison of the full 3' and 5' untranslated genomic regions of diverse isolates of infectious salmon anaemia virus by using a rapid and universal method. J Virol Methods 174:136-143.

12. Garcia-Rosado, E., T. Markussen, O. Kileng, E. S. Baekkevold, B. Robertsen, S. Mjaaland, and E. Rimstad. 2008. Molecular and functional characterization of two infectious salmon anaemia virus (ISAV) proteins with type I interferon antagonizing activity. Virus Res 133:228-238.

13. Garcia-Sastre, A., and P. Palese. 1993. Genetic manipulation of negative-strand RNA virus genomes. Annu Rev Microbiol 47:765-790.

14. Godoy, M. G., A. Aedo, M. J. Kibenge, D. B. Groman, C. V. Yason, H. Grothusen, A. Lisperguer, M. Calbucura, F. Avendano, M. Imilan, M. Jarpa, and F. S. Kibenge. 2008. First detection, isolation and molecular characterization of infectious salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) in Chile. BMC Vet Res 4:28.

15. Hellebo, A., U. Vilas, K. Falk, and R. Vlasak. 2004. Infectious salmon anemia virus specifically binds to and hydrolyzes 4-O-acetylated sialic acids. J Virol 78:3055-3062.

16. Kibenge, F. S., O. N. Garate, G. Johnson, R. Arriagada, M. J. Kibenge, and D. Wadowska. 2001. Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Dis Aquat Organ 45:9-18.

17. Kulshreshtha, V., M. Kibenge, K. Salonius, N. Simard, A. Riveroll, and F. Kibenge. 2010. Identification of the 3' and 5' terminal sequences of the 8 rna genome segments of European and North American genotypes of infectious salmon anemia virus (an orthomyxovirus) and evidence for quasispecies based on the non-coding sequences of transcripts. Virol J 7:338.

18. Lovely, J. E., B. H. Dannevig, K. Falk, L. Hutchin, A. M. MacKinnon, K. J. Melville, E. Rimstad, and S. G. Griffiths. 1999. First identification of infectious salmon anaemia virus in North America with haemorrhagic kidney syndrome. Dis Aquat Organ 35:145-148.

19. McBeath, A. J., B. Collet, R. Paley, S. Duraffour, V. Aspehaug, E. Biering, C. J. Secombes, and M. Snow. 2006. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 115:176-184.

20. Merour, E., M. LeBerre, A. Lamoureux, J. Bernard, M. Bremont, and S. Biacchesi. 2011. Completion of the full-length genome sequence of the infectious salmon anemia virus, an aquatic orthomyxovirus-like, and characterization of mAbs. J Gen Virol 92:528-533.

21. Muller, A., S. T. Solem, C. R. Karlsen, and T. O. Jorgensen. 2008. Heterologous expression and purification of the infectious salmon anemia virus hemagglutinin esterase. Protein Expr Purif 62:206-215.

22. Munir, K., and F. S. Kibenge. 2004. Detection of infectious salmon anaemia virus by real-time RT-PCR. J Virol Methods 117:37-47.

23. Neumann, G., G. G. Brownlee, E. Fodor, and Y. Kawaoka. 2004. Orthomyxovirus replication, transcription, and polyadenylation. Curr Top Microbiol Immunol 283:121-143.

24. Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A 96:9345-9350.

25. Reed, K. M., J. D. Hackett, and R. B. Phillips. 2000. Comparative analysis of intra-individual and inter-species DNA sequence variation in salmonid ribosomal DNA cistrons. Gene 249:115-125.

26. Rimstad, E., and S. Mjaaland. 2002. Infectious salmon anaemia virus. APMIS 110:273-282.

27. Rowley, H. M. C. S. J., Curran W. L. , Turnbull T., Bryson D. G. 1999. Isolation of infectious salmon anaemia virus (ISAV) from Scottish farmed Atlantic salmon, Salmo salar L. Journal of Fish Diseases 22:483 - 487.

28. Thoroud K., D. H. O. 1988. Infectious salmon anemia in atlantic salmon (salmo salar L.). European Association of Fish Pathologists 8:109-111.

29. Van Herwerden, L., M. J. Caley, and D. Blair. 2003. Regulatory motifs are present in the ITS1 of some flatworm species. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution 296B:80-86.

30. Nylund A, Plarre H, Karlsen M, Fridell F, Ottem KF, Bratland A, Saether PA. 2007. Transmission of infectious salmon anaemia virus (ISAV) in farmed populations of Atlantic salmon (Salmo salar). Arch Virol 152:151-179.

31. Kibenge FS, Godoy MG, Wang Y, Kibenge MJ, Gherardelli V, Mansilla S, Lisperger A, Jarpa M, Larroquete G, Avendano F, Lara M, Gallardo A. 2009. Infectious salmon anaemia virus (ISAV) isolated from the ISA disease outbreaks in Chile diverged from ISAV isolates from Norway around 1996 and was disseminated around 2005, based on surface glycoprotein gene sequences. Virol J 6:88.

32. Christiansen DH, Ostergaard PS, Snow M, Dale OB, Falk K. 2011. A low-pathogenic variant of infectious salmon anemia virus (ISAV-HPR0) is highly prevalent and causes a non-clinical transient infection in farmed Atlantic salmon (Salmo salar L.) in the Faroe Islands. J Gen Virol 92:909-918.

33. Mjaaland S, Hungnes O, Teig A, Dannevig BH, Thorud K, Rimstad E. 2002. Polymorphism in the infectious salmon anemia virus hemagglutinin gene: importance and possible implications for evolution and ecology of infectious salmon anemia disease. Virology 304:379-391.

34. Cunningham CO, Gregory A, Black J, Simpson I, Raynard RS. 2002. A novel variant of the infectious salmon anaemia virus (ISAV) haemagglutinin gene suggests mechanisms for virus diversity. Bull Eur Assoc Fish Pathol 22:366-374.

35. Castillo-Cerda MT, Cottet L, Toro-Ascuy D, Spencer E, Cortez-San Martin M. 2013. Development of plaque assay for Chilean Infectious Salmon Anaemia Virus, application for virus purification and titration in salmon ASK cells. J Fish Dis.

1. Способ получения вирусных частиц, включающий в себя следующие действия:

а) трансфицируют клетки рыбы тремя экспрессионными векторами pTriex3, способными к экспрессии фрагментов полимеразы РНК последовательностей РВ2 SEQ ID No 7, РВ1 SEQ ID No 8 и PA SEQ ID No 9 вируса ISAV901_09, и экспрессионным вектором pCI-neo, способным к экспрессии нуклеопротеина NP SEQ ID No 10 вируса ISAV901_09;

б) трансфицируют клетку из пункта (а) набором из восьми экспрессионных векторов, полученных из плазмиды pUC57. при этом каждый экспрессионный вектор содержит последовательности SEQ ID No 1, SEQ ID No 2, SEQ ID No 3, SEQ ID No 4 и SEQ ID No 5 и раздельно клонированную последовательность рекомбинантной РНК вируса ISAV901_09, полученную с использованием одной из следующих пар праймеров:

- пара 1а: прямой праймер обратный праймер

- пара 16: прямой праймер обратный праймер

- пара 2: прямой праймер обратный праймер

- пара 3: прямой праймер обратный праймер

- пара 4: прямой праймер обратный праймер

- пара 5: прямой праймер обратный праймер

- пара 6: прямой праймер обратный праймер

- пара 7: прямой праймер обратный праймер

- пара 8: прямой праймер обратный праймер

в) получают рекомбинантные вирусные частицы.

2. Способ по п. 1, в котором клетки рыбы культивируют в условиях 15-20°С, подходящих для репликации трансфицированных клеток.

3. Способ по п. 1, включающий в себя получение рекомбинантных функциональных вирусных частиц, экспрессирующих нуклеиновые кислоты вида одноцепочечных химерных РНК (SS-RNA) вируса ISAV901_09.

4. Способ по п. 1, включающий в себя получение рекомбинантных функциональных вирусных частиц, экспрессирующих аутогенные или экзогенные белки для вируса ISAV901_09.

5. Способ по п. 1, отличающийся тем, что последовательность SEQ ID No 1 содержит промотор атлантического лосося.

6. Способ по п. 1, отличающийся тем, что последовательность SEQ ID No 2 содержит последовательность рибозима рыбы-молота.

7. Способ по п. 1, отличающийся тем, что последовательность SEQ ID No 3 содержит сайт клонирования.

8. Способ по п. 1, отличающийся тем, что последовательность SEQ ID No 4 содержит последовательность рибозима вируса гепатита 5.

9. Способ по п. 1, отличающийся тем, что последовательность SEQ ID No 5 содержит терминатор транскрипции β-глобина кролика.

10. Набор плазмид в клетках рыбы, предназначенный для получения вирусных частиц, содержащий:

экспрессионную плазмиду pTriex3, содержащую раздельно клонированную последовательность SEQ ID No 7 вируса ISAV 901_09, кодирующую белок РВ2 клеточного cRNP;

экспрессионную плазмиду pTriex3, содержащую раздельно клонированную последовательность SEQ ID No 8 вируса ISAV 901_09, кодирующую белок РВ1 клеточного cRNP;

экспрессионную плазмиду pTriex3, содержащую раздельно клонированную последовательность SEQ ID No 9 вируса ISAV 901_09, кодирующую белок РА клеточного cRNP;

экспрессионную плазмиду pCI-neo, содержащую раздельно клонированную последовательность SEQ ID No 10 вируса ISAV 901_09, кодирующую белок NP клеточного cRNP;

и набор из восьми рекомбинантных плазмид, в котором каждая рекомбинантная плазмида содержит:

- основу, полученную из плазмиды pUC57;

- клонированные последовательности SEQ ID No 1, SEQ ID No 2, SEQ ID No 3, SEQ ID No 4 и SEQ ID No 5;

- раздельно клонированную последовательность рекомбинантной РНК вируса ISAV901_09, полученную с использованием одной из следующих пар праймеров:

- пара 1а: прямой праймер обратный праймер

- пара 1б: прямой праймер обратный праймер

- пара 2: прямой праймер обратный праймер

- пара 3: прямой праймер обратный праймер

- пара 4: прямой праймер обратный праймер

- пара 5: прямой праймер обратный праймер

- пара 6: прямой праймер обратный праймер

- пара 7: прямой праймер обратный праймер

- пара 8: прямой праймер обратный праймер

11. Набор плазмид по п. 10, отличающийся тем, что плазмиды обеспечивают клонирование генетических последовательностей животного, растения, протеста, гриба, бактерии или вируса с использованием фермента удаленной рестрикции SapI.

12. Набор плазмид по п. 10, отличающийся тем, что последовательность SEQ ID No 1 содержит промотор атлантического лосося.

13. Набор плазмид по п. 10, отличающийся тем, что последовательность SEQ ID No 2 содержит последовательность рибозима рыбы-молота.

14. Набор плазмид по п. 10, отличающийся тем, что последовательность SEQ ID No 3 содержит сайт клонирования.

15. Набор плазмид по п. 10, отличающийся тем, что последовательность SEQ ID No 4 содержит последовательность рибозима вируса гепатита 5.

16. Набор плазмид по п. 10, отличающийся тем, что последовательность SEQ ID No 5 содержит терминатор транскрипции β-глобина кролика.



 

Похожие патенты:

Изобретение относится к биотехнологии. Описана поливалентная вакцина от гриппа, содержащая ВПЧ, где гены гемагглютинина, нейраминидазы и M1 белка получены из штамма A/California/04/2009; ген гемагглютинина получен из штамма A/Michigan/45/2015, а гены нейраминидазы и M1 белка получены из штамма A/California/04/2009; ген гемагглютинина получен из штамма A/Novosibirsk/01/2014, а гены нейраминидазы и M1 белка получены из штамма A/California/04/2009; ген гемагглютинина получен из штамма A/HongKong/4801/2014, а гены нейраминидазы и M1 белка получены из штамма A/California/04/2009; ген гемагглютинина получен из штамма B/Phuket/3073/13, а гены нейраминидазы и M1 белка получены из штамма A/California/04/2009 или ген гемагглютинина получен из штамма B/Brisbane/60/2008, а гены нейраминидазы и M1 белка получены из штамма A/California/04/2009.

Согласно настоящему изобретению предложена комбинация, содержащая по меньшей мере онколитический вирус и один или более чем один модулятор иммунологической контрольной точки для применения для лечения пролиферативного заболевания, такого как рак.

Изобретение относится к области биотехнологии, молекулярной биологии и вирусологии. Предложен нереплицируемый, поглощаемый клеткой рабдовирус, представляющий собой вирус везикулярного стоматита, причем указанный вирус получен путем воздействия на живой вирус УФ излучением, применяемым в дозе от 100 мДж/см2 до 1000 мДж/см2, так что по меньшей мере 0,05%, но не более 80% нуклеотидов РНК вируса сшивается и/или РНК вируса расщепляется на по меньшей мере две дискретные полинуклеотидные последовательности, и при этом поверхность оболочки вирусной частицы содержит по меньшей мере 5% от числа G белков вирусной частицы дикого типа.

Изобретение относится к области биотехнологии. Изобретение представляет собой антибактериальную композицию лечебно-профилактического назначения, которая включает комбинацию стерильных, очищенных от токсинов фильтратов фаголизатов с титром каждого из бактериофагов не ниже 1010 БОЕ/мл по Грациа с неперекрывающимся спектром литической активности в отношении возбудителей сальмонеллезной и эшерихиозной инфекций, способных вызывать массовые болезни птиц, сельскохозяйственных животных и человека.

Изобретение относится к биотехнологии. Описана вирусоподобная частица для индуцирования и/или усиления иммунного ответа против антигена у млекопитающих, содержащая структурный полипептид вируса и по меньшей мере один антиген, в которой структурный полипептид вируса содержит по меньшей мере один первый сайт прикрепления, по меньшей мере один антиген содержит по меньшей мере один второй сайт прикрепления, структурный полипептид вируса и антиген соединяются через по меньшей мере один первый и по меньшей мере один второй сайт прикрепления, и структурный полипептид вируса получен из вируса Chikungunya (CHIKV) или вируса венесуэльского энцефалита лошадей (VEEV), в которой антиген не происходит из вируса CHIKV или вируса VEEV.

Изобретение относится к биотехнологии и представляет собой изолированную рабдовирусную частицу для применения в онколитической вирусной терапии у пациента с глиобластомой, где выделенная рабдовирусная частица включает геном, способный экспрессировать: белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 1, белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 2, белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 3, белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 4, и белок, имеющий последовательность, которая по меньшей мере на 85% идентична SEQ ID NO: 7.

Изобретение относится к области биотехнологии. Изобретение представляет собой бактериофаг Pas-MUP-1 семейства Myoviridae (учетный №: KCTC 12706ВР), выделенный из природы и способному специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ.

Настоящее изобретение относится к биотехнологии. В частности, изобретение относится к терапии злокачественных опухолей человека.

Изобретение относится к области биотехнологии, конкретно к получению антибактериальных рекомбинантных белков, и может быть использовано в медицине в качестве антибактериальной композиции, проявляющей активность в отношении грамотрицательных бактерий Pseudomonas aeruginosa.

Изобретение относится к биотехнологии, медицинской вирусологии и может быть использовано при исследовании эффективности лечебных и профилактических препаратов против вируса гриппа В.

Изобретение относится к области биотехнологии, конкретно к получению лентивирусного вектора для экспрессии химерного антигенного рецептора (CAR) на основе VHH-антитела к CD47 в Т-клетках человека, и может быть использовано в медицине.

Настоящее изобретение относится к области биотехнологии, конкретно к экспрессионным системам терапевтических белков, и может быть использовано в терапии для образования сенсорных клеток во внутреннем ухе человека.

Настоящее изобретение относится к области биотехнологии, конкретно к экспрессионным системам терапевтических белков, и может быть использовано в терапии для образования сенсорных клеток во внутреннем ухе человека.

Согласно настоящему изобретению предложена комбинация, содержащая по меньшей мере онколитический вирус и один или более чем один модулятор иммунологической контрольной точки для применения для лечения пролиферативного заболевания, такого как рак.

Изобретение относится к биотехнологии и представляет собой способ количественного определения антител, которые связываются с AAV, in vitro, включающий: (a) получение инфекционных частиц рекомбинантного AAV, содержащих рекомбинантный вектор AAV, причем рекомбинантный вектор AAV содержит репортерный трансген, где репортерный трансген содержит (a) одноцепочечный или самокомплементарный геном, (b) является функционально связанным с одним или более регуляторными элементами экспрессии, и (c) является фланкированным одним или более фланкирующими элементами;(b) получение биологического образца от индивидуума; (c) получение клеток, которые можно инфицировать указанными инфекционными частицами рекомбинантного AAV; (d) приведение в контакт или инкубирования инфекционных частиц рекомбинантного AAV (a) с биологическим образцом (b), получая таким образом, получаемую смесь (M); (e) приведение клеток в контакт (c) с получаемой смесью (M) в условиях, в которых инфекционные частицы рекомбинантного AAV (a) могут инфицировать и экспрессировать репортерный трансген в указанных клетках; (f) измерение экспрессии репортерного трансгена и (g) сравнение указанной экспрессии репортерного трансгена (f) с репортерным трансгеном отрицательного (-) контроля, (i) не содержащего антитела, которые связываются с AAV, и (+) контроля, (ii) содержащего предопределенное количество антител, которые связываются с AAV, с количественным определением, таким образом, антител в биологическом образце, которые связываются с AAV.

Изобретение относится к биотехнологии и представляет собой способ количественного определения антител, которые связываются с AAV, in vitro, включающий: (a) получение инфекционных частиц рекомбинантного AAV, содержащих рекомбинантный вектор AAV, причем рекомбинантный вектор AAV содержит репортерный трансген, где репортерный трансген содержит (a) одноцепочечный или самокомплементарный геном, (b) является функционально связанным с одним или более регуляторными элементами экспрессии, и (c) является фланкированным одним или более фланкирующими элементами;(b) получение биологического образца от индивидуума; (c) получение клеток, которые можно инфицировать указанными инфекционными частицами рекомбинантного AAV; (d) приведение в контакт или инкубирования инфекционных частиц рекомбинантного AAV (a) с биологическим образцом (b), получая таким образом, получаемую смесь (M); (e) приведение клеток в контакт (c) с получаемой смесью (M) в условиях, в которых инфекционные частицы рекомбинантного AAV (a) могут инфицировать и экспрессировать репортерный трансген в указанных клетках; (f) измерение экспрессии репортерного трансгена и (g) сравнение указанной экспрессии репортерного трансгена (f) с репортерным трансгеном отрицательного (-) контроля, (i) не содержащего антитела, которые связываются с AAV, и (+) контроля, (ii) содержащего предопределенное количество антител, которые связываются с AAV, с количественным определением, таким образом, антител в биологическом образце, которые связываются с AAV.

Настоящее изобретение относится к биотехнологии. В частности, изобретение относится к терапии злокачественных опухолей человека.

Изобретение относится к биотехнологии. Описана система CRISPR-Cas для редактирования генома в эукариотической клетке, содержащая: белок Cas9, содержащий по меньшей мере одну последовательность ядерной локализации, и химерную РНК (chiRNA) системы CRISPR-Cas, содержащую: (a) направляющую последовательность, способную гибридизироваться с целевой последовательностью в эукариотической клетке, (b) парную tracr-последовательность, способную гибридизоваться с tracr-последовательностью, и (c) tracr-последовательность, где (a), (b) и (c) расположены в 5’-3’ ориентации, где одна или несколько из направляющей, tracr- и парной tracr-последовательностей модифицированы для повышения стабильности и где необязательно белок Cas9 образует комплекс с химерной РНК (chiRNA) системы CRISPR-Cas.

Изобретение относится к области биотехнологии, конкретно к молекуле, связывающейся с фактором роста эндотелия сосудов С (VEGF-C) и фактором роста эндотелия сосудов D (VEGF-D) и может быть использовано в медицине для регулирования ангиогенеза.

Изобретение относится к области биотехнологии и может быть использовано в терапии онкологических заболеваний. Описан универсальный вспомогательный плазмидный экспрессионный лентивирусный вектор для получения высоких титров вирусных частиц, содержащих ген Vpx, включающий в качестве базовых элементов, обеспечивающих функционирование вектора, последовательность вирион-ассоциированного белка Vpx, содержащую С-концевой HIV-1 gag/pol мотив и FLAG последовательность и объединенную с последовательностью гена трансактиваторного белка Rev через специфическую последовательность Т2А, обеспечивающую расщепление слитых белков во время процесса трансляции мРНК трансгена; в качестве регуляторных элементов- RSVпромотор/энхансер [rous sarcoma virus) и NES (nuclear export signal)- сигнал экспорта из ядра в цитоплазму.

Изобретение относится к биотехнологии. Описан способ модификации целевого геномного локуса в клетке млекопитающего, включающий в себя: введение в клетку нуклеазного агента, который осуществляет одно- или двухцепочечный разрыв в пределах целевого геномного локуса; введение в клетку первого большого нацеливающего вектора (LTVEC), который имеет длину по меньшей мере 10 т.п.н.

Изобретение относится к вирусологии и представляет собой способ получения вирусных частиц, включающий в себя следующие действия: а) трансфицируют клетки рыбы тремя экспрессионными векторами pTriex3, способными к экспрессии фрагментов полимеразы РНК последовательностей РВ2 SEQ ID No 7, РВ1 SEQ ID No 8 и PA SEQ ID No 9 вируса ISAV901_09, и экспрессионным вектором pCI-neo, способным к экспрессии нуклеопротеина NP SEQ ID No 10 вируса ISAV901_09; б) трансфицируют клетку из пункта набором из восьми экспрессионных векторов, полученных из плазмиды pUC57, при этом каждый экспрессионный вектор содержит последовательности SEQ ID No 1, SEQ ID No 2, SEQ ID No 3, SEQ ID No 4 и SEQ ID No 5 и раздельно клонированную последовательность рекомбинантной РНК вируса ISAV901_09, полученную с использованием одной из пар праймеров, в) получают рекомбинантные вирусные частицы. Изобретение позволяет получать функциональные вирусные частицы из РНК отрицательной полярности. 2 н. и 14 з.п. ф-лы, 6 ил., 4 табл., 1 пр.

Наверх