Новый бактериофаг pas-mup-1 pasteurella multocida и его применение для ингибирования размножения pasteurella multocida

Изобретение относится к области биотехнологии. Изобретение представляет собой бактериофаг Pas-MUP-1 семейства Myoviridae (учетный №: KCTC 12706ВР), выделенный из природы и способному специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ. ID. NO: 1, и способ предупреждения и лечения инфекций Pasteurella multocida с применением композиции, содержащей указанный бактериофаг в качестве активного ингредиента. Изобретение позволяет расширить арсенал антибактериальных средств. 3 н. и 2 з.п. ф-лы, 2 ил., 4 табл., 9 пр.

 

ПРЕДШЕСТВУЮЩИЙ УРОВЕНЬ ТЕХНИКИ

1. Область изобретения

Настоящее изобретение относится к выделенному из природы бактериофагу, который инфицирует и уничтожает клетки Pasteurella multocida, и к способу предупреждения и лечения инфекций Pasteurella multocida с помощью композиции, содержащей этот бактериофаг в качестве активного ингредиента. В частности, настоящее изобретение относится к бактериофагу Pas-MUP-1 семейства Myoviridae (учетный №: КСТС 12706 ВР), выделенному из природы и способному специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ. ID. NO: 1, и к способу предупреждения инфекций Pasteurella multocida, а также их лечения с применением композиции, содержащей указанный бактериофаг в качестве активного ингредиента.

2. Описание уровня техники

Pasteurella multocida представляет собой грамотрицательную неподвижную бациллу, которую классифицируют в соответствии с капсульными полисахаридами на 5 типов: А, В, D, Е и F. Более подробно, Pasteurella multocida типа А связана с заболеваниями легких у крупного рогатого скота, овец, свиней, Pasteurella multocida типа В вызывает геморрагический сепсис у крупного рогатого скота и буйволов, a Pasteurella multocida типа D вызывает атрофический ринит у свиней. В целом Pasteurella multocida является возбудителем различных заболеваний у сельскохозяйственных животных, что, таким образом, приводит к серьезным экономическим потерям в области животноводческой промышленности. Поэтому необходима разработка новой методики предупреждения вызываемых Pasteurella multocida заболеваний и состояний у животных, а также лечения инфекций Pasteurella multocida.

В животноводческой промышленности в целях предупреждения и лечения инфекций Pasteurella multocida широко применяют антибиотики. Однако при этом возникают штаммы бактерий, устойчивые к антибиотикам, что постоянно снижает результативность лечения антибиотиками. Кроме того, в условиях ужесточения национальных нормативных требований такое избыточное применение антибиотиков для животных запрещено. Поэтому в настоящее время требуется разработка новой эффективной методики, заменяющей антибиотики. Особенно предпочтительными могут быть экологически благоприятные способы.

С недавних пор внимание авторов изобретения привлекло применение бактериофагов в качестве нового пути лечения бактериальных инфекций. В частности, причина повышенного интереса авторов изобретения к бактериофагам заключается в том, что лечение на основе бактериофагов представляет собой безопасный для природы способ. Бактериофаги представляют собой крайне мелкие микроорганизмы, сокращенно называемые фагами, которые инфицируют бактерии. Как только бактериофаг инфицирует бактерию, происходит его размножение внутри бактериальной клетки. После размножения его потомство разрушает клеточную стенку бактерий, чтобы покинуть организм-хозяин, что позволяет предположить, что бактериофаг обладает способностью уничтожать бактерии. Инфекция бактериофагами характеризуется высокой специфичностью, поэтому определенный бактериофаг инфицирует только специфичную для него бактерию. Таким образом, бактерии, которые могут быть инфицированы определенным бактериофагом, ограничены, что позволяет предположить, что бактериофаг способен уничтожать только конкретные бактерии и не может навредить другим бактериям. За счет этой клеточной специфичности бактериофаг оказывает антибактериальное действие на бактерии-мишени, в то время как его действие на комменсальные бактерии в условиях окружающей среды или внутренней среды организма животного исключено. Обычно универсальные антибиотики для терапевтического применения против бактерий поражают различные виды бактерий одновременно, что приводит к многочисленным проблемам, связанным с загрязнением окружающей среды, нарушением нормальной микрофлоры у животных и т.п. К счастью, применение бактериофагов не влияет на нормальную микрофлору и т.п. благодаря избирательному уничтожению бактерий-мишеней. Следовательно, бактериофаг может быть безопасным и, таким образом, позволяет уменьшить вероятность побочных действий по сравнению с другими антибиотиками.

Бактериофаг был впервые обнаружен английским бактериологом Туортом в 1915 г., когда он заметил, что колонии Micrococcus таяли и становились прозрачными под действием какого-то неизвестного вещества. В 1917 г. французский бактериолог д'Эррель обнаружил, что Shigella dysenteriae в фильтрате кала пациента с дизентерией таяли под действием какого-то неизвестного вещества, и дополнительно исследовал этот феномен. В результате он независимо идентифицировал бактериофаг и назвал его бактериофагом, что означает «убийца бактерий». С тех пор происходит постоянная идентификация бактериофагов, специфически действующих в отношении таких патогенных бактерий, как Shigella, Salmonella Typhi и Vibrio cholerae.

В связи со своей уникальной способностью уничтожать бактерии, бактериофаги были изучены, и было сделано предположение, что их применение представляет собой улучшенный способ лечения бактериальных инфекций. Однако в связи с универсализацией антибиотиков после открытия Флеммингом пенициллина исследования по бактериофагам продолжались лишь в некоторых восточно-европейских странах и в странах бывшего Советского Союза. После 2000 года достоинства традиционных антибиотиков поблекли в связи с возрастающим количеством бактерий, устойчивых к антибиотикам. Поэтому бактериофаги вновь стали актуальны в качестве нового антибактериального агента, который может заменить традиционные антибиотики. Кроме того, недавно государства по всему миру ужесточили нормативные требования к применению антибиотиков. Интерес к бактериофагам все больше возрастает, кроме того, все больше достижений наблюдается в области их промышленного применения.

Как продемонстрировано выше, бактериофаги проявляют высокую специфичность к бактериям. Эта специфичность часто обусловливает эффективность бактериофагов лишь против части бактерий, даже относящихся к одному виду. Кроме того, результативность применения бактериофагов различна в зависимости от штаммов бактерий-мишеней. Поэтому необходимо собрать много видов бактериофагов, пригодных для эффективного контроля определенных бактерий. Следовательно, в ходе разработки применения бактериофагов против Pasteurella multocida необходимо получить множество бактериофагов (множество видов бактериофагов, обладающих антибактериальным действием против Pasteurella multocida). Кроме того, необходим скрининг полученных в результате бактериофагов в отношении улучшенных свойств по сравнению с другими с точки зрения антибактериальной силы и спектра действия.

Таким образом, авторами настоящего изобретения предпринята попытка разработки композиции, применимой для предупреждения или лечения инфекций Pasteurella multocida с помощью бактериофага, выделенного из природы и способного к избирательному уничтожению клеток Pasteurella multocida, а также разработки способа предупреждения или лечения инфекций Pasteurella multocida с применением этой композиции. В результате авторы настоящего изобретения выделили бактериофаги, пригодные для этой цели, и установили нуклеотидную последовательность генома, которая позволяет отличать бактериофаг по настоящему изобретению от других бактериофагов. Таким образом, авторами изобретения была разработана композиция, содержащая изолированный бактериофаг в качестве активного ингредиента, и подтверждено, что эту композицию можно эффективно применять для предупреждения и лечения инфекций Pasteurella multocida, что привело к выполнению настоящего изобретения.

КРАТКОЕ ИЗЛОЖЕНИЕ СУЩНОСТИ ИЗОБРЕТЕНИЯ

Цель настоящего изобретения состоит в обеспечении бактериофага Pas-MUP-1 семейства Myoviridae (учетный №: КСТС 12706 ВР), выделенного из природы и способного специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ. ID. NO: 1.

Другая цель настоящего изобретения состоит в разработке композиции, применимой для предупреждения инфекций Pasteurella multocida, которая содержит в качестве активного ингредиента бактериофаг Pas-MUP-1, способный к инфицированию и уничтожению клеток Pasteurella multocida, и способа предупреждения инфекций Pasteurella multocida с помощью указанной композиции.

Другая цель настоящего изобретения состоит в разработке композиции, применимой для лечения инфекций Pasteurella multocida, которая содержит в качестве активного ингредиента бактериофаг Pas-MUP-1, способный к инфицированию и уничтожению клеток Pasteurella multocida, и способа лечения инфекций Pasteurella multocida с помощью указанной композиции.

Другая цель настоящего изобретения состоит в разработке дезинфицирующего средства для предупреждения и лечения инфекций Pasteurella multocida с помощью указанной композиции.

Другая цель настоящего изобретения состоит в разработке кормовой добавки, эффективной в сельскохозяйственном производстве для предупреждения и лечения инфекций Pasteurella multocida с помощью указанной композиции.

Для достижения вышеуказанных целей в настоящем изобретении предложен бактериофаг Pas-MUP-1 семейства Myoviridae (учетный №: КСТС 12706 ВР), выделенный из природы и способный специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ. ID. NO: 1, и способ предупреждения и лечения инфекций Pasteurella multocida с помощью композиции, содержащей в качестве активного ингредиента данный бактериофаг.

Бактериофаг Pas-MUP-1 выделен авторами настоящего изобретения и впоследствии депонирован в Корейской коллекции типовых культур Корейского научно-исследовательского института естественных наук и биотехнологии 7 ноября 2014 г. (учетный №: КСТС 12706 ВР).

В дополнение к этому в настоящем изобретении также предложено дезинфицирующее средство и кормовая добавка, пригодные для предупреждения или лечения инфекций Pasteurella multocida, содержащие в качестве активного ингредиента бактериофаг Pas-MUP-1.

Поскольку бактериофаг Pas-MUP-1, включенный в композицию по настоящему изобретению, эффективно уничтожает клетки Pasteurella multocida, его считают эффективным для предупреждения или лечения заболеваний (инфекций), вызванных Pasteurella multocida. Таким образом, композицию по настоящему изобретению можно применять для предупреждения и лечения заболеваний, вызванных Pasteurella multocida.

В настоящем описании термин «предупреждение» или «предупреждать» указывает на (i) блокирование инфекций Pasteurella multocida; и (ii) блокирование развития заболеваний, вызванных Pasteurella multocida.

В настоящем описании термин «лечение» или «лечить» указывает на (i) подавление заболеваний, вызванных Pasteurella multocida; и (ii) облегчение состояния при заболеваниях, вызванных Pasteurella multocida.

В настоящем описании термин «выделение» или «выделенный» указывает на все действия по выделению бактериофага с помощью экспериментальных методов и по установлению характеристик, которые позволяют отличить этот бактериофаг от других, и дополнительно включает размножение бактериофага методами биоинженерии, чтобы обеспечить его практичность.

Фармацевтически приемлемый носитель, включенный в композицию по настоящему изобретению, представляет собой носитель, обычно применяемый для приготовления фармацевтической лекарственной формы, примерами которого являются лактоза, декстроза, сахароза, сорбит, маннит, крахмал, гуммиарабик, фосфат кальция, альгинат, желатин, силикат кальция, микрокристаллическая целлюлоза, поливинилпирролидон, целлюлоза, вода, патока, метилцеллюлоза, метилгидроксибензоат, пропилгидроксибензоат, тальк, стеарат магния и минеральное масло, но не всегда ограниченный ими. Композиция по настоящему изобретению может дополнительно включать в себя смазывающие вещества, смачивающие агенты, подсластители, корригенты, эмульгаторы, суспендирующие агенты и консерванты в дополнение к вышеописанным ингредиентам.

Бактериофаг Pas-MUP-1 включен в композицию по настоящему изобретению в качестве активного ингредиента. При этом бактериофаг Pas-MUP-1 включен в концентрации 1×101 бляшкообразующих единиц (бое)/мл - 1×1030 бое/мл или 1×101 бое/г - 1×1030 бое/г и предпочтительно в концентрации 1×104 бое/мл - 1×1015 бое/мл или 1×104 бое/г - 1×1015 бое/г.

Композиция по настоящему изобретению может быть приготовлена традиционными способами, осуществляемыми специалисты в данной области техники, с фармацевтически приемлемыми носителями и/или эксципиентами в форме однократной дозы или в многодозовом контейнере. Лекарственная форма может иметь форму раствора, суспензии или эмульсии в жирорастворимой или водорастворимой среде, экстракта, порошка, гранулы, таблетки или капсулы и может дополнительно включать в себя диспергирующий агент или стабилизатор.

Композиция по настоящему изобретению может быть получена в виде дезинфицирующего средства или кормовой добавки в соответствии с целью применения, но не всегда ограничена ими.

Для этой цели в композиции по настоящему изобретению для улучшения ее эффективности могут дополнительно содержаться другие бактериофаги, которые могут придавать антибактериальную активность против других видов бактерий. В дополнение к этому в композиции по настоящему изобретению могут дополнительно содержаться другие виды бактериофагов, обладающих антибактериальной активностью против Pasteurella multocida. Кроме того, эти бактериофаги могут быть надлежащим образом комбинированы, чтобы максимально повысить антибактериальные эффекты, поскольку их антибактериальная активность против Pasteurella multocida может различаться с точки зрения антибактериальной силы и спектра действия.

ВЫГОДНЫЙ ЭФФЕКТ

Способ предупреждения и лечения инфекций Pasteurella multocida с помощью данной композиции, содержащей бактериофаг Pas-MUP-1 в качестве активного ингредиента, обладает преимуществом, состоящим в высокой специфичности к Pasteurella multocida по сравнению с традиционными способами, основанными на химических веществах, включая традиционные антибиотики. Это означает, что композицию по настоящему изобретению может применяться для специфического предупреждения или лечения инфекций Pasteurella multocida, при этом не влияя на нормальную микрофлору, и, соответственно, она имеет меньше побочных эффектов. Как правило, при применении химических веществ, таких как антибиотики, часто также повреждаются комменсальные бактерии, в результате чего у животных ослабляется иммунитет в купе с проявлением различных побочных эффектов. В то же время, в композиции по настоящему изобретению в качестве активного ингредиента применяют бактериофаг, выделенный из природы, поэтому она в высокой степени безопасна для природы. Кроме того, антибактериальная активность бактериофагов против бактерий-мишеней различается даже в случае их принадлежности к одному и тому же виду с точки зрения антибактериальной силы и спектра действия (в пределах нескольких штаммов Pasteurella multocida, антибактериальный диапазон бактериофагов для каждого штамма. Как правило, бактериофаги обычно эффективны против части штаммов бактерий даже у одного и того же вида. То есть, антибактериальная активность бактериофага различается в зависимости от штамма бактерий несмотря на принадлежность к одному и тому же виду). Таким образом, бактериофаг по настоящему изобретению может обеспечить антибиотическую активность против Pasteurella multocida, отличающуюся от активности, обеспечиваемой другими бактериофагами, действующими на Pasteurella multocida. Следовательно, бактериофаг по настоящему изобретению может обеспечить различные виды применения в животноводческой промышленности.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Применение предпочтительных вариантов осуществления настоящего изобретения более понятно со ссылкой на сопроводительные графические материалы, где:

Фиг. 1 представляет собой электронно-микроскопическую фотографию, на которой показана морфология бактериофага Pas-MUP-1.

Фиг. 2 представляет собой фотографию, иллюстрирующую способность бактериофага Pas-MUP-1 уничтожать клетки Pasteurella multocida. Прозрачная зона на чашке Петри представляет собой образование бляшки за счет лизиса бактериальных клеток-мишеней.

ОПИСАНИЕ ПРЕДПОЧТИТЕЛЬНЫХ ВАРИАНТОВ ОСУЩЕСТВЛЕНИЯ ИЗОБРЕТЕНИЯ

Практические и в настоящий момент предпочтительные варианты осуществления настоящего изобретения носят иллюстративный характер, как показано в приведенных ниже примерах.

Однако при рассмотрении данного описания специалистам в данной области техники будет понятно, что в рамках сущности и объема настоящего изобретения возможны модификации и усовершенствования.

Пример 1: Выделение бактериофага, способного уничтожать Pasteurella multocida

Для выделения бактериофага, способного уничтожать Pasteurella multocida, образцы собирали в природных условиях. Штаммы Pasteurella multocida, используемые для выделения бактериофага, в данном случае представляли собой штаммы, выделенные авторами настоящего изобретения и ранее идентифицированные как Pasteurella multocida.

Процедура выделения бактериофага подробно описана в настоящем документе. Собранный образец добавляли в среду ТСБ (триптиказо-соевый бульон) (панкреатический гидролизат казеина, 17 г/л; папаиновый гидролизат соевых бобов, 3 г/л; декстроза, 2,5 г/л; хлорид натрия, 5 г/л; двузамещенный фосфат калия, 2,5 г/л), инокулированную Pasteurella multocida в соотношении 1/1000 с последующим перемешиванием культуры при 37°С в течение 3-4 часов. После завершения культивирования проводили центрифугирование при 8000 об/мин в течение 20 минут и отбирали супернатант. Отобранный супернатант инокулировали Pasteurella multocida в соотношении 1/1000 с последующим перемешиванием культуры при 37°С в течение 3-4 часов. Если образец содержал бактериофаг, описанную выше процедуру повторяли в общей сложности 5 раз, чтобы существенно повысить титр бактериофага. После 5-кратного повторения процедуры раствор культуры обрабатывали центрифугированием при 8000 об/мин в течение 20 минут и отбирали полученный в результате супернатант. Отобранный супернатант фильтровали, используя фильтр 0,45 мкм. Полученный в результате фильтрат использовали для анализа капельным методом наличия или отсутствия бактериофага, способного уничтожать Pasteurella multocida.

Анализ капельным методом проводили, как описано ниже; среду ТСБ инокулировали Pasteurella multocida в соотношении 1/1000 с последующим перемешиванием культуры при 37°С в течение ночи. 3 мл (1,5 OD600) культурального бульона Pasteurella multocida, полученного как описано выше, рассевали на чашку с ТСА (триптиказо-соевый агар; панкреатический гидролизат казеина, 17 г/л; папаиновый гидролизат соевых бобов, 3 г/л; хлорид натрия, 5 г/л; агар, 15 г/л). Чашку оставляли в термостате приблизительно на 30 минут для высыхания. После высыхания непосредственно на поверхность «газона» Pasteurella multocida наносили каплями по 10 мкл полученного фильтрата и высушивали в течение примерно 30 минут. После высыхания чашку инкубировали при 37°С в течение дня, а затем осматривали для выявления прозрачных зон на поверхности бактериального «газона». Если прозрачная зона образовывалась в месте нанесения фильтрата, можно было считать, что фильтрат содержал бактериофаг, способный к уничтожению Pasteurella multocida. С помощью описанной выше процедуры может быть получен фильтрат, содержащий бактериофаг, обладающий способностью уничтожать Pasteurella multocida.

После этого бактериофаг выделяли из фильтрата, для которого была подтверждена способность бактериофага уничтожать Pasteurella multocida, как описано выше. Для выделения чистого бактериофага применяли традиционный анализ бляшкообразования. Более подробно, бляшку, образовавшуюся в ходе анализа бляшкообразования, собирали, используя стерилизованный наконечник пипетки, а затем добавляли в раствор культуры Pasteurella multocida с последующим культивированием при 37°С в течение 4-5 часов.

После завершения культивирования проводили центрифугирование при 8000 об/мин в течение 20 минут с получением супернатанта. Отобранный супернатант инокулировали культурой Pasteurella multocida в соотношении 1/50 с последующим культивированием при 37°С в течение 4-5 часов. Для повышения титра бактериофага описанную выше процедуру повторяли по меньшей мере 5 раз. Впоследствии проводили центрифугирование при 8000 об/мин в течение 20 минут с получением супернатанта. С полученным супернатантом проводили анализ бляшкообразования. Как правило, выделение чистого бактериофага не заканчивалось после однократной процедуры, поэтому описанную выше процедуру повторяли, используя бляшку, образовавшуюся, как описано выше. После по меньшей мере 5-кратного повторения процедуры получали раствор, содержащий чистый бактериофаг. Процедуру выделения чистого бактериофага обычно повторяли до тех пор, пока образующиеся бляшки не становились сходными по размеру и морфологии. После конечного выделения чистого бактериофага его идентичность подтверждали с помощью электронной микроскопии. Описанную выше процедуру повторяли до подтверждения выделения чистого бактериофага с помощью электронной микроскопии. Электронную микроскопию проводили традиционным способом. Кратко, раствор, содержащий чистый бактериофаг, наносили на медную сетку с последующим отрицательным окрашиванием 2%-ным уранилацетатом. После ее высушивания наблюдали морфологию, используя трансмиссионный электронный микроскоп.Электронная микрофотография бактериофага, выделенного в настоящем изобретении, представлена на Фиг. 1. На основании морфологических характеристик было подтверждено, что выделенный выше бактериофаг относится к семейству Myoviridae.

Раствор, содержащий подтвержденный выше чистый бактериофаг, подвергали очистке. Культуральный бульон Pasteurella multocida добавляли к раствору, содержащему чистый бактериофаг, в объеме, составляющем 1/50 от общего объема раствора бактериофага с последующим культивированием в течение 4-5 часов. После завершения культивирования проводили центрифугирование при 8000 об/мин в течение 20 минут с получением супернатанта. Эту процедуру повторяли 5 раз с получением раствора, содержащего достаточные количества бактериофага. Супернатант, полученный в результате конечного центрифугирования, фильтровали через фильтр 0,45 мкм с последующим традиционным осаждением полиэтиленгликолем (ПЭГ). В частности, ПЭГ и NaCl добавляли к 100 мл фильтрата до достижения концентрации 10% ПЭГ 8000/0,5 М NaCl и выдерживали без перемешивания при 4°С в течение 2-3 часов. Впоследствии проводили центрифугирование при 8000 об/мин в течение 30 минут с получением осадка бактериофага. Полученный в результате осадок бактериофага ресуспендировали в 5 мл буферного раствора (10 мМ Трис-НСl, 10 мМ MgSO4, 0,1%-ный желатин, рН 8,0). Этот раствор называли суспензией бактериофага или раствором бактериофага.

В результате собирали чистый бактериофаг, очищенный, как описано выше, который был назван бактериофагом Pas-MUP-1 и впоследствии депонирован в Корейской коллекции типовых культур Корейского научно-исследовательского института естественных наук и биотехнологии 7 ноября 2014 г. (учетный №: КСТС 12706 ВР).

Пример 2: Выделение и анализ последовательности генома бактериофага Pas-MUP-1

Геном бактериофага Pas-MUP-1 выделяли, как описано ниже. Геном выделяли из суспензии бактериофага, полученной в примере 1. Сначала, чтобы удалить ДНК и РНК клеток Pasteurella multocida, включенных в суспензию, к 10 мл суспензии бактериофага добавляли по 200 ед. ДНКазы I и РНказы А каждого и инкубировали при 37°С в течение 30 минут. Спустя 30 минут для устранения активности ДНКазы I и РНКазы А добавляли 500 мкл 0,5 М этилендиаминтетрауксусной кислоты (ЭДТА) и инкубировали в течение 10 минут. Суспензию дополнительно инкубировали при 65°С в течение 10 минут, а затем добавляли к ней 100 мкл протеиназы K (20 мг/мл) для лизиса внешней оболочки бактериофага, после чего инкубировали при 37°С в течение 20 минут. Затем к суспензии добавляли 500 мкл 10%-ного раствора додецилсульфата натрия (ДСП) с последующей инкубацией при 65°С в течение 1 часа. Добавляли 10 мл смеси фенол:хлороформ:изоамиловый спирт в соотношении 25:24:1, затем тщательно перемешивали. Смесь центрифугировали при 13000 об/мин в течение 15 минут для отделения каждого слоя. К полученному верхнему слою добавляли изопропиловый спирт в объеме, равном 1,5-кратному объему верхнего слоя, с последующим центрифугированием при 13000 об/мин в течение 10 минут для осаждения генома бактериофага. После сбора осадка к нему добавляли 70%-ный этанол с последующим центрифугированием при 13000 об/мин в течение 10 минут для промывания осадка. Промытый осадок выделяли, высушивали в вакууме, а затем растворяли в 100 мкл воды. Эту процедуру повторяли до получения достаточного количества генома бактериофага Pas-MUP-1.

Нуклеотидную последовательность генома бактериофага Pas-MUP-1, полученного, как описано выше, анализировали путем Секвенирования Следующего Поколения (Next Generation Sequencing, NGS) с использованием устройства Illumina Mi-Seq, в Национальном контрольно-измерительном центре рационального природопользования Сеульского Национального Университета. В результате предположили, что конечный геном бактериофага Pas-MUP-1 имеет размер 39497 п.о. и нуклеотидную последовательность полноразмерного генома SEQ. ID. NO: 1.

На основании геномной последовательности полученного, как описано выше, бактериофага Pas-MUP-1 исследовали ее подобие другим описанным ранее геномным последовательностям с использованием программы BLAST. На основании результата исследования с помощью программы BLAST показано отсутствие геномной последовательности, имеющей более 50% гомологии последовательности бактериофага Pas-MUP-1.

На основании этого результата сделан вывод, что бактериофаг Pas-MUP-1 представляет собой новый, ранее не описаннвш бактериофаг. Параллельно с этим результатом, в настоящем документе показано, что бактериофаги различных видов обладают, как правило, различной антибактериальной силой и спектром действия. Таким образом, сделан вывод, что бактериофаг Pas-MUP-1 обеспечивает значимую антибактериальную активность иного типа по сравнению с другими описанными ранее бактериофагами.

Пример 3: Исследование способности бактериофага Pas-MUP-1 уничтожать Pasteurella multocida

Была исследована способность выделенного бактериофага Pas-MUP-1 уничтожать Pasteurella multocida. Для этого наблюдали образование прозрачной зоны капельным методом аналогично тому, как описано в примере 1. Для данного исследования использовали в общей сложности 10 штаммов Pasteurella multocida, которые ранее были выделены авторами настоящего изобретения и идентифицированы как Pasteurella multocida. Была продемонстрирована способность бактериофага Pas-MUP-1 уничтожать 9 штаммов Pasteurella multocida, использованных в данном эксперименте. Репрезентативный результат теста на уничтожающую способность представлен на Фиг. 2. В то же время, в каждом отдельном тесте была также исследована активность бактериофага Pas-MUP-1 уничтожать Staphylococcus aureus, Enterococcus faecalis, Enterococcus faecium, Lactobacillus plantarum, Streptococcus uberis и Pseudomonas aeruginosa. В результате обнаружили, что бактериофаг Pas-MUP-1 не обладает активностью уничтожения этих микроорганизмов.

Таким образом, было подтверждено, что бактериофаг Pas-MUP-1 обладает специфической способностью уничтожать Pasteurella multocida и широким спектром антибактериального действия против Pasteurella multocida, что позволяет предположить возможность применения бактериофага Pas-MUP-1 по настоящему изобретению в качестве активного ингредиента композиции для предупреждения и лечения инфекций Pasteurella multocida.

Пример 4: Превентивное действие бактериофага Pas-MUP-1 на инфекции Pasteurella multocida

100 мкл раствора бактериофага Pas-MUP-1 в концентрации 1×108 бое/мл добавляли в пробирку, содержащую 9 мл ТСБ. В другую пробирку, содержащую 9 мл ТСБ, добавляли только такой же объем среды ТСБ. Затем в каждую пробирку добавляли культуру Pasteurella multocida до достижения OD600 около 0,5. После этого пробирки переносили в инкубатор при 37°С с последующим перемешиванием культуры, в ходе которого наблюдали рост Pasteurella multocida. Как показано в таблице 1, отмечено ингибирование роста Pasteurella multocida в пробирке с добавленным раствором бактериофага Pas-MUP-1, при этом в пробирке без добавления раствора бактериофага Pas-MUP-1 ингибирование роста отсутствовало.

Таблица 1. Ингибирование роста Pasteurella multocida

Приведенные выше результаты показывают, что бактериофаг Pas-MUP-1 не только ингибирует рост Pasteurella multocida, но также уничтожает их. Таким образом, сделан вывод, что бактериофаг Pas-MUP-1 можно применять в качестве активного ингредиента композиции для предупреждения инфекций Pasteurella multocida.

Пример 5: Превентивное действие бактериофага Pas-MUP-1 на инфекции Pasteurella multocida в животной модели

Исследовали превентивное действие бактериофага Pas-MUP-1 на поросят-отъемышей, зараженных Pasteurella multocida. 4 поросят-отъемышей в возрасте 25 дней группировали вместе; суммарно в каждом свинарнике (1,1 м на 1,0 м) выращивали 2 группы поросят. Была оборудована нагревательная система и контроль условий окружающей среды. Температуру и влажность свинарника постоянно контролировали и пол мыли ежедневно. С 1-го дня эксперимента поросят экспериментальной группы (с добавлением бактериофага) кормили кормом с добавлением бактериофага Pas-MUP-1 в концентрации 1×108 бое/г в соответствии со стандартной процедурой раздачи корма, при этом поросят контрольной группы (без добавления бактериофага) кормили таким же кормом без добавления бактериофага Pas-MUP-1 в соответствии со стандартной процедурой. С 7-го дня эксперимента корм для обеих групп заражали 1×108 кое/г Pasteurella multocida в течение 2 дней, а затем предоставляли два раза в день соответственно экспериментальной и контрольной группам, чтобы вызвать инфекции Pasteurella multocida. Со следующего дня после кормления зараженными кормами в течение 2 дней (с 9-го дня эксперимента) поросят экспериментальной группы (с добавлением бактериофага) снова кормили кормом с добавлением бактериофага Pas-MUP-1 в концентрации 1×108 бое/г, не содержащим Pasteurella multocida, в соответствии со стандартной процедурой раздачи корма, как и ранее, при этом поросят контрольной группы (без добавления бактериофага) кормили таким же кормом без добавления бактериофага Pas-MUP-1 в соответствии со стандартной процедурой. С 9-го дня эксперимента всех испытуемых животных обследовали с целью обнаружения наличия или отсутствия клеток Pasteurella multocida в выделениях из носа. Более подробно, исследуемые образцы выделений из носа (мазок внутренней полости носа) рассевали на чашки с кровяным агаром, инкубировали при 37°С в течение 18-24 часов до получения бактериальных колоний. Затем полученные в результате колонии подвергали скринингу для отбора клеток Pasteurella multocida. Для идентификации клеток Pasteurella multocida на образцах отобранных выше колоний проводили полимеразную цепную реакцию (ПЦР), специфичную для Pasteurella multocida. Результат представлен в таблице 2.

Таблица 2. Определение Pasteurella multocida (средние значения)

На основании описанных выше результатов подтвердили, что бактериофаг Pas-MUP-1 по настоящему изобретению может обладать высокой эффективностью для подавления инфекций Pasteurella multocida.

Пример 6: Терапевтическое действие бактериофага Pas-MUP-1 на инфекции Pasteurella multocida

Терапевтическое действие бактериофага Pas-MUP-1 исследовали на животных, зараженных Pasteurella multocida. 4 поросят-отъемышей в возрасте 25 дней группировали вместе; суммарно в каждом свинарнике (1,1 м на 1,0 м) выращивали 2 группы поросят. Была оборудована нагревательная система и контроль условий окружающей среды. Температуру и влажность свинарника постоянно контролировали и пол мыли ежедневно.

На 4-й день эксперимента всем поросятам впрыскивали в полость носа 5 мл суспензии Pasteurella multocida (109 колониеобразующих единиц (кое)/мл). Суспензию Pasteurella multocida, инокулируемую, как описано выше, готовили следующим образом: Pasteurella multocida культивировали в питательной среде ТСБ при 37°С в течение 18 часов, а затем выделяли полученные в результате бактериальные клетки. К осадку бактериальных клеток добавляли физиологический раствор (рН 7,2) до доведения клеточной суспензии до концентрации 109 кое/мл. Со следующего дня после контрольного заражения Pasteurella multocida экспериментальной группе (с добавлением раствора бактериофага) впрыскивали назально бактериофаг Pas-MUP-1 в количестве 109 БОЕ/голова два раза в день таким же путем, который был описан для введения выше. Контрольную группу (без добавления раствора бактериофага) оставляли без какой-либо обработки. Обе группы одинаково обеспечивали кормом и питьевой водой. С 3-го дня после контрольного заражения Pasteurella multocida (7-й день эксперимента) всех животных обследовали ежедневно независимо от того, заболевали ли они атрофическим ринитом, вызванным Pasteurella multocida. Атрофический ринит, вызванный Pasteurella multocida, оценивали путем определения присутствия клеток Pasteurella multocida в выделениях из носа, как описано в примере 5. Результат представлен в таблице 3.

Таблица 3. Определение Pasteurella multocida (средние значения)

На основании описанных выше результатов подтвердили, что бактериофаг Pas-MUP-1 по настоящему изобретению может обладать высокой эффективностью для лечения инфекций Pasteurella multocida.

Пример 7: Приготовление кормовых добавок и корма

Кормовые добавки готовили путем добавления раствора бактериофага Pas-MUP-1 в концентрации 1×108 бое/г кормовых добавок. Способ их приготовления описан ниже: к раствору бактериофага добавляли мальтодекстрин (50% мас./об.), смешивали, а затем лиофилизировали. Наконец, высушенную смесь измельчали с получением мелких порошков. Описанную выше процедуру сушки можно заменить сушкой при пониженном давлении, сушкой при повышенной температуре или сушкой при комнатной температуре. Для получения контроля готовили кормовые добавки, не содержащие бактериофаг, а содержащие только буферный раствор (10 мМ Трис-НСl, 10 мМ MgSO4, 0,1%-ный желатин, рН 8,0).

Описанные выше два вида кормовых добавок смешивали с 1000-кратным объемом корма для разведения свиней соответственно с получением в результате двух видов конечного корма.

Пример 8: Приготовление дезинфицирующих средств

Дезинфицирующие средства, содержащие бактериофаг Pas-MUP-1 в концентрации 1×108 бое/мл, готовили с использованием раствора бактериофага Pas-MUP-1. Более подробно, для приготовления дезинфицирующего средства раствор бактериофага Pas-MUP-1 в концентрации 1×108 бое добавляли к 1 мл буферного раствора, который использовали для приготовления раствора бактериофага, а затем тщательно смешивали. Для приготовления контроля использовали только буфер, который был таким же, как используемый для приготовления раствора бактериофага.

Два вида дезинфицирующего средства, приготовленного, как описано выше, разводили в воде в соотношении 1:1000, а затем использовали для получения конечных дезинфицирующих средств.

Пример 9: Влияние на показатели свиноводства

Исследовали влияние кормов и дезинфицирующих средств, приготовленных, как описано в примере 7 и в примере 8, на показатели свиноводства. Конкретно, данное исследование проводили путем характеристики степеней роста животных и клинических признаков, обусловленных аллергическим ринитом. В совокупности 40 поросят группировали в две группы, каждая из которых состояла из 20 поросят (группа А: группа, получающая экспериментальный корм, группа В: группа, получающая экспериментальное дезинфицирующее средство). Эксперимент продолжался в течение 2 недель. Каждую группу делили на две подгруппы, содержащие 10 поросят. Затем две подгруппы делили в соответствии с введением бактериофага Pas-MUP-1 (подгруппа-(1): получала бактериофаг Pas-MUP-1; а подгруппа-(2): не получала бактериофаг). Поросята, используемые в данном эксперименте, представляли собой поросят-отъемышей в возрасте 20 дней. Каждую подгруппу выращивали в отдельном помещении, размещенном на достаточном расстоянии. Каждую подгруппу отмечали и обозначали, как представлено в таблице 4.

Таблица 4. Подгруппы эксперимента по свиноводству

Корм предоставляли в соответствии со стандартной процедурой раздачи корма, как показано в таблице 4, при этом корм готовили, как описано в примере 7. Обработку дезинфицирующими средствами проводили 3 раза в неделю, чередуя с традиционными дезинфицирующими средствами. Таким образом, в тот день, когда проводили опрыскивание дезинфицирующим средством по настоящему изобретению, традиционное дезинфицирующее средство не использовали. Вследствие этого продемонстрировано, что подгруппа, получавшая бактериофаг Pas-MUP-1, значительно опережала по скорости роста подгруппу, не получавшую бактериофаг Pas-MUP-1. Клинические признаки атрофического ринита также не были выявлены в подгруппе, получавшей бактериофаг Pas-MUP-1, при этом они были выявлены приблизительно у 5% субъектов из подгруппы, не получавшей бактериофаг. Кроме того, как описано в примере 5, подгруппы обследовали на выделение клеток Pasteurella multocida из выделений из носа. В результате было показано, что клетки Pasteurella multocida обнаруживаются в выделениях из носа некоторых животных из подгруппы, не получавшей бактериофаг, при этом не обнаруживаются ни у одного из животных подгруппы, получавшей бактериофаг Pas-MUP-1.

На основании описанных выше результатов подтверждено, что корм и дезинфицирующее средство, полученные в соответствии с настоящим изобретением, обладают эффективностью для улучшения результатов свиноводства. Таким образом, сделан вывод, что композицию по настоящему изобретению можно эффективно применять для повышения продуктивности животноводства.

Специалистам в данной области техники будет понятно, что концепции и конкретные варианты осуществления, раскрытые в приведенном выше описании, могут легко быть использованы как основа для модификации или разработки других вариантов осуществления для достижения тех же целей настоящего изобретения. Специалистам в данной области техники также будет понятно, что такие эквивалентные варианты осуществления не отклоняются от сущности и объема изобретения, которые представлены в прилагаемой формуле изобретения.

1. Бактериофаг Pas-MUP-1 семейства Myoviridae (учетный №: KCTC 12706BP), выделенный из природы и способный специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ. ID. NO: 1.

2. Композиция для предупреждения или лечения инфекций Pasteurella multocida, содержащая в качестве активного ингредиента от 1×101 БОЕ/мл до 1×1030 БОЕ/мл или от 1×101 БОЕ/г до 1×1030 БОЕ/г бактериофага Pas-MUP-1 по п. 1 и фармацевтически приемлемый носитель.

3. Композиция для предупреждения или лечения инфекций Pasteurella multocida по п. 2, которую применяют для получения дезинфицирующего средства или кормовой добавки.

4. Способ предупреждения или лечения инфекций Pasteurella multocida, включающий стадию введения сельскохозяйственному животному композиции по п. 2 или 3, содержащей в качестве активного ингредиента бактериофаг Pas-MUP-1.

5. Способ предупреждения или лечения инфекций Pasteurella multocida по п. 4, в котором указанную композицию вводят сельскохозяйственному животному в виде дезинфицирующего средства или кормовой добавки.



 

Похожие патенты:

Настоящее изобретение относится к биотехнологии. В частности, изобретение относится к терапии злокачественных опухолей человека.

Изобретение относится к области биотехнологии, конкретно к получению антибактериальных рекомбинантных белков, и может быть использовано в медицине в качестве антибактериальной композиции, проявляющей активность в отношении грамотрицательных бактерий Pseudomonas aeruginosa.

Изобретение относится к биотехнологии, медицинской вирусологии и может быть использовано при исследовании эффективности лечебных и профилактических препаратов против вируса гриппа В.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложена вирусоподобная частица для вакцинации против малярии, которая содержит структурный полипептид вируса, полученный из вируса Чикунгунья (CHIKV) или вируса венесуэльского энцефалита лошадей (VEEV), и по меньшей мере один антиген малярии, где указанный структурный полипептид вируса содержит по меньшей мере один первый участок присоединения в белке оболочки и указанный по меньшей мере один антиген малярии содержит по меньшей мере один второй участок присоединения, указанный антиген малярии является антигеном, содержащим (NPNA)n, где n составляет от 4 до 30, и/или антиген содержит (EYLNKIQNSLSTEWSPCSVT)y, где y составляет от 1 до 6, и указанный структурный полипептид вируса и указанный антиген малярии связаны посредством указанного по меньшей мере одного первого и указанного по меньшей мере одного второго участков присоединения.
Изобретение относится к биотехнологии, а именно, способу получения парвовируса, происходящего из неконцентрированного супернатанта клеточной культуры. Способ включает (a) стадию предварительного расчета каждые 24 часа зависимого от времени изменения плотности клеток в культуральном субстрате, когда клетки-хозяева инфицируются парвовирусом, для каждой плотности клеток (A) при инфицировании вирусом; (b) стадию определения на основе зависимого от времени изменения клеточной плотности, рассчитанной предварительно на стадии (a), (b1) время (Tmax) от инфицирования до времени пика зависимого от времени изменения плотности клеток, (b2) плотность клеток (Bmax) при Tmax и A1, которая представляет собой A, которая удовлетворяет следующему уравнению (1) Bmax/A1>1,2, (b3) максимальную (Amax) плотность клеток A1 при инфицировании вирусом и (b4) A2, которая удовлетворяет следующему уравнению (2) Amax≥A2≥Amax/10; (c) стадию инокуляции посевного парвовируса в культуральный субстрат, содержащий клетки-хозяева, имеющие плотность клеток A2, где инфицирующий вирус, определенный в (b4) стадии (b), и сывороточная среда дают множественность заражения (MOI) от 0,001 до 0,1; (d) стадию культивирования культивируемого продукта, содержащего клетки-хозяева и парвовирус, полученные на стадии (c), в течение периода времени Tmax или более до менее (Tmax+48) часов, где Tmax определено в (b1) стадии (b); (e) стадию замены культурального супернатанта, полученного на стадии (d), бессывороточной средой и культивирования в течение 12 часов или более; и (f) стадию сбора содержащего парвовирус культурального супернатанта, полученного путем культивирования на стадии (e); где на стадии (b), когда A, удовлетворяющая уравнению (1), отсутствует, стадии (a) и (b) осуществляют повторно путем использования другой плотности клеток A при инфицировании вирусом.

Изобретение относится к области биотехнологии. Изобретение представляет собой вакцину широкого спектра действия против реовируса птиц, которая эффективна у целевых птиц для снижения инфицирования реовирусом птиц.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ тестирования на заражение вирусами посадочного материала картофеля, выращенного in vitro, заключающийся в том, что получают белковый лектинсодержащий экстракт корней подорожника большого Plantago major из гомогенизированной муки размолотых корней растений 0,9%-ным раствором хлористого натрия настаиванием в течение 24 часов в соотношении 1:6, после чего гомогенат центрифугируют и доводят до рН 4,0, вновь центрифугируют и супернотант нейтролизуют до рН 7,0, удаляют осадок центрифугированием, белок высаливают 70% сульфатом аммония, поле чего неочищенный сырой лектин собирают на фильтр и растворяют в дистиллированной воде, затем получают концентрат вирусов с посадочного материала и проводят агглютинацию полученных вирусов белковым лектинсодержащим экстрактом корней подорожника большого Plantago major в концентрации 0,03%, при этом если происходит агглютинация, то посадочный материал не заражен вирусами, а отсутствие агглютинации показывает, что посадочный материал заражен вирусами.

Изобретение относится к генной инженерии. Описано применение патогенного вируса кори (MV) из живого ослабленного штамма вируса кори (MV), в котором нокаутирован ген, кодирующий вирусный акцессорный белок С (MV-deltaC), в лечении агрессивной злокачественной опухоли или агрессивного рака при введении индивидууму, у которого диагностирована такая злокачественная опухоль или раковое заболевание.

Изобретение относится к области биотехнологии. Изобретение представляет собой штамм С/2014 вируса Мачупо - возбудителя Боливийской геморрагической лихорадки (БГЛ), вариант природного штамма Carvallo, адаптированный к морским свинкам и вызывающий у них зависимую от вводимой дозы вируса гибель.

Изобретение относится к биотехнологии, а именно к средствам молекулярной диагностики. Разработаны олигонуклеотидные праймеры и флуоресцентно-меченные зонды для дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита КРС с дополнительной детекцией генома каприпоксвирусов с помощью полимеразной цепной реакции в режиме реального времени:полевой изолят ЗУД КРС:f- 5'- TAGAAAATGGATGTACCACAAATACAG 3',r 5' -TTGTTACAACTCAAATCGTTAGGTG-3',зонд 5' -ACCACCTAATGATAGTGTTTATGATTTACC-3;каприпоксвирусы:f - 5' ATGAAACCAATGGATGGGATA 3',r - 5' CGAAATGAAAAACGGTATATGGA 3',зонд - 5' ATGAGCCATCCATTTTCCAA 3'4;вакцинный штамм ЗУД КРС:f- 5'-TGTTTCCATTCTCCACTGCT-3',r - 5' -TACTTACTAAAAAATGGGCGCА-3',зонд - 5'-TCGCTGACATCGTTAGTCCАСТС-3'.Предложен способ дифференциации генома вакцинного штамма и полевого изолята вируса заразного узелкового дерматита (нодулярного дерматита) КРС с дополнительной детекцией генома каприпоксвирусов с помощью ПЦР в режиме реального времени при одинаковом термическом профиле с использованием этих праймеров и зондов, и тест-система ПЦР в режиме реального времени для его проведения.

Изобретение имеет отношение к изделию, позволяющему обеспечить косметическое и/или терапевтическое полезное воздействие на кожу при местном нанесении на нее этого изделия.

Изобретение имеет отношение к композиции для эпиляции. Композиция содержит углеводородную смолу в количестве 55-70% вес.

Группа изобретений относится к области косметической промышленности, а именно к композиции для личной гигиены, которая содержит очищающую основу, содержащую по меньшей мере одно очищающее средство, выбранное из мыла и поверхностно-активного вещества, и эффективное количество антибактериальной системы, содержащей феноксиэтанол и пироктон, где феноксиэтанол присутствует в количестве от 0.5 до 1% вес.

Изобретение относится к области косметологии и представляет собой композицию против выпадения и стимулирующую рост волос, содержащую водный экстракт наземной части донника белого однолетнего, не обмолоченного, гидролизованные протеины белого люпина, витамин РР, комплекс, состоящий из лактата натрия и следующих аминокислот: пироглутамата натрия, аргинина, аспарагиновой кислоты, глицина, аланина, серина, валина, пролина, треонина, изолейцина, гистидина, фенилаланина, и консервант, причем компоненты в композиции находятся в определенном соотношении в мас.%.
Настоящее изобретение относится к композициям для ухода за полостью рта. Композиция в виде средства для чистки зубов содержит приемлемую для применения в полости рта среду-носитель; пирофосфат кальция, составляющий 20 вес.% по весу композиции; источник ионов двухвалентного олова; источник ионов цинка, содержащий оксид цинка в количестве 1,0% от веса композиции; источник фторид-ионов; кислоту, где кислота представляет собой фосфорную кислоту, взятую в количестве 0,5% от веса композиции, и полифосфатную соль, выбранную из группы, состоящей из неорганических полифосфатных солей, которые содержат три или менее атомов фосфора, где полифосфатная соль присутствует в количестве от 1% до 10% от веса композиции; при этом композиция в виде средства для чистки зубов характеризуется общим содержанием воды, составляющим менее 1 вес.

Группа изобретений касается композиции для гигиены полости рта и способов ее применения. Предлагаемая композиция включает эффективное количество хлоргидрата алюминия, суспендированного в носителе, для предотвращения или снижения гиперчувствительности зубов, где хлоргидрат алюминия присутствует в количестве от 0,01% по весу до 20% по весу от общего веса композиции и изготовлен с использованием буфера, выбранного из глицина и бетаина, и демонстрирует SEC хроматограмму, имеющую соотношение интенсивности SEC Пика 4 к Пику 3, равное по меньшей мере 7, и интенсивность Пика 4, превышающую интенсивность Пика 5.

Изобретение относится к косметической промышленности и представляет собой косметическую композицию, содержащую в физиологически приемлемой среде сложные частицы, включающие субстрат, образованный из слюды и оксихлорида висмута, покрытый по меньшей мере одним минеральным пигментом, и по меньшей мере один перламутр, выбранный из сложных частиц, включающих по меньшей мере одну подложку, выбранную из слюды, синтетического фторфлогопита или боросиликата кальция натрия, и полностью или частично покрытую одним или более слоями оксидов металлов, где сложные частицы содержатся в указанной композиции в количестве от 0,15 до 0,75 мас.% от общей массы композиции и где перламутр содержится в указанной композиции в количестве от 0,25 до 0,75 мас.% от общей массы композиции.

Изобретение относится к области дерматологии и косметологии и представляет собой комбинацию для предотвращения образования ретенционных повреждений или для лечения акне, содержащую ретиноид, выбранный из ретинола, ретинальдегида и ретиноевой кислоты, и соединение общей формулы I.

Изобретение относится к косметической промышленности и представляет собой сахарную пасту для депиляции, содержащую микропорошок минерала шунгит с размером фракции не более 20 мкм, сахар, лимонную кислоту и воду, причем компоненты в сахарной пасте находятся в определенном соотношении в мас.%.

Изобретение относится к области фармацевтики и может быть использовано для восстановления фиброэластина в дермальных соединительных тканях. Для этого используют композицию, содержащую в качестве активного ингредиента смесь аминокислот, состоящую из глицина, L-пролина, L-аланина, L-валина, L-лейцина и гидрохлорида L-лизина в заявленных массовых соотношениях.

Изобретение относится к ветеринарии, в частности к кормовой добавке для ягнят. Добавка содержит "Биобактон" и "Бифидумбактерин", растворенные в воде при температуре 37°С, минеральную добавку, включающую глюконат кальция и активированный уголь, взятые в соотношении 2:1, и растительную добавку, содержащую цикорий, плоды шиповника, подорожник, ромашку, кормовой картофель, корень одуванчика, которые предварительно смешивают в смесителе в течение 20 минут в соотношении 2:2:2:2:2:0,5 соответственно.

Изобретение относится к области биотехнологии. Изобретение представляет собой бактериофаг Pas-MUP-1 семейства Myoviridae, выделенный из природы и способному специфически уничтожать клетки Pasteurella multocida, геном которого представлен нуклеотидной последовательностью SEQ. ID. NO: 1, и способ предупреждения и лечения инфекций Pasteurella multocida с применением композиции, содержащей указанный бактериофаг в качестве активного ингредиента. Изобретение позволяет расширить арсенал антибактериальных средств. 3 н. и 2 з.п. ф-лы, 2 ил., 4 табл., 9 пр.

Наверх