Способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета



Способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета
Способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета
Способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета
C12N1/00 - Микроорганизмы, например простейшие; их композиции (лекарственные препараты, содержащие материал из микроорганизмов A61K 35/66; приготовление лекарственных составов, содержащих бактериальные антигены или антитела, например бактериальных вакцин A61K 39/00); способы размножения, содержания или консервирования микроорганизмов или их композиций; способы приготовления или выделения композиций, содержащих микроорганизмы; питательные среды

Владельцы патента RU 2710324:

федеральное государственное бюджетное образовательное учреждение высшего образования "Пермский государственный медицинский университет имени академика Е.А. Вагнера" Министерства здравоохранения Российской Федерации (RU)

Изобретение относится к биотехнологии и представляет собой способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета. Изобретение дает возможность прогнозирования скорости течения PC до назначения лечения препаратами интерферона-бета и осуществляется следующим образом: образец ДНК, выделенный из периферической венозной крови больного PC, исследуют по полиморфизмам, используя в качестве праймеров участок ДНК генов KIF1B С/Т (rs10492972), ZFHX4 C/G (rs11787532), STARD13 G/T (rs9527281), CIT C/T (rs7308076), ZFAT A/C (rs733254), для каждого из указанных полиморфизмов устанавливают гетерозиготный или гомозиготный генотип и определяют доминирующую аллель, а при наличии гетерозиготного генотипа ее определяют путем соотношения пороговых циклов амплификации по каналам FAM и VIC (HEX), определяют гаплотип как сочетание пяти доминирующих аллелей и при наличии в геноме больного PC гаплотипа TGTCA прогнозируют высокую скорость прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета. 3 пр.

 

Изобретение относится к медицине, а именно неврологии, и может быть использовано для прогнозирования скорости прогрессирования рассеянного склероза (PC) у больных, получающих терапию препаратами интерферона-бета.

Все лица с установленным диагнозом PC получают терапию препаратами, изменяющими течение рассеянного склероза (ПИТРС) по федеральной льготе, согласно реестру пациентов по государственной программе «Семь нозологий» и приказом министерства здравоохранения РФ от 15.02.13 №69н (в ред. Приказа Минздрава России от 10.04.15 №181н) «О мерах по реализации постановления правительства российской федерации от 26 апреля 2012 г. N 404 «Об утверждении правил ведения федерального регистра лиц, больных гемофилией, муковисцидозом, гипофизарным нанизмом, болезнью Гоше, злокачественными новообразованиями лимфоидной, кроветворной и родственных им тканей, рассеянным склерозом, лиц после трансплантации органов и (или) тканей».

Одними из основных стартовых препаратов для лечения PC, зарегистрированных в РФ, являются препараты интерферона-бета, эффективность которых доказана в ряде фундаментальных исследований [А.Н. Бойко Выбор оптимального препарата для лечения рассеянного склероза. Медицинский совет. 2015; 5: 78-88]. Назначение препарата происходит на основе течения заболевания, выраженности клинических симптомов, а также с учетом противопоказаний. Оценка эффективности препарата происходит через 6-12 месяцев после его назначения, но нередко препарат оказывается неэффективным у конкретного больного и подлежит замене на другой, что негативно сказывается на состоянии больного. При динамическом наблюдении за эффективностью ПИТРС, тяжесть состояния оценивается в ходе неврологического осмотра при помощи шкалы функциональных систем Kurtzke с расчетом балла по Expanded Disability Status Scale (EDSS). Скорость прогрессирования PC определяется, как отношение балла EDSS к длительности заболевания. Значение скорости прогрессирования можно рассчитать только в процессе длительного наблюдения за больным. Скорость прогрессирования ≤0,25 балла/год считается низкой, скорость прогрессирования >0,25 балла/год, но ≤0,75 балла/год определяется, как умеренная; высокой считается скорость >0,75 балла/год [Гончарова З.А. Клинико-эпидемиологическая характеристика рассеянного склероза (проспективное 20-летнее исследование): Автореф. дис. д-ра мед. наук. Иваново 2012].

Недостатки: данный способ применим только в процессе лечения больного PC препаратами интерферона-бета, способ субъективный, т.к. зависит от квалификации врача.

Технический результат: возможность прогнозирования скорости течения PC до назначения лечения препаратами интерферона-бета, объективизация способа.

Указанный результат достигается за счет определения генетических маркеров в ДНК больного PC.

Способ осуществляют следующим образом:

У обследуемого больного из вены в пластиковую вакуумную пробирку с антикоагулянтом ЭДТА набирают 5-7 мл крови, вне зависимости от времени суток и приема пищи.

Далее производят выделение ДНК из пробы при помощи коммерческого набора ДНК-Экстран-1 ЗАО «Синтол», Россия (Кат. номер - ЕХ-509).

Полученный материал готов к постановке полимеразной цепной реакции (ПЦР). Полимеразную цепную реакцию проводят на детектирующем амплификаторе с гибридизационно-флуоресцентной детекцией в режиме «реального времени» с использованием готовых наборов праймеров и зондов производства ThermoFisherScientific, AppliedBiosystems, США (Кат. номер - 4351379), где в качестве праймеров использованы участки ДНК: гена KIF1B С/Т (rs10492972), ZFHX4 C/G(rs11787532), STARD13 G/T(rs9527281), CIT С/Т(rs7308076), ZFAT A/C(rs733254).

Проводят реакцию амплификации с использованием набора 2,5х Реакционная смесь для проведения ПЦР, ЗАО «Синтол», Россия (Кат. номер - М 428).

При проведении ПЦР амплификацию и детекцию проводят на детектирующем амплификаторе CFX96 фирмы Bio-Rad, США [Руководство по эксплуатации систем ПЦР реального времени с флуоресцентной детекцией CFX96 Touch, CFX96 Touch Deep Well, CFX Connect и CFX384 Touch].

Используется универсальная программа амплификации, подобранная производителем реактивов. Она включает в себя несколько этапов: 1 этап - активация TaqF-полимеразы (режим «горячего старта») продолжается 15 мин при 95°С; 2 этап - установочные циклы амплификации без измерения флуоресценции (5 циклов); 3 этап - рабочие циклы амплификации с измерением флюоресценции (40 циклов).

Каждый цикл амплификации включает в себя денатурацию ДНК (5 с при 95°С), отжиг праймеров (20 с при 60°С) и саму реакцию полимеризации ДНК (15 с при 72°С).

Регистрация сигнала флюоресценции, возникающего при накоплении продуктов амплификации участков ДНК проводится в режиме «реального времени» после стадии отжига праймеров для выбранных генов по каналу FAM - для детекции одного из аллельных вариантов генов, и по каналу VIC или HEX - для альтернативного варианта.

Результаты интерпретируются на основании наличия (или отсутствия) пересечения кривой флюоресценции с установленной на заданном уровне пороговой линией, что соответствует наличию (или отсутствию) значения порогового цикла (Cq1 для канала FAM, Cq2 для канала VIC (HEX) в соответствующей графе в таблице результатов, отображаемой в программном обеспечении для амплификатора CFX96.

По соотношению пороговых циклов (Cq1/Cq2), полученных по двум каналам детекции, определяют состояние генов (генотип) KIF1B в исследуемом участке ДНК С/Т (rs10492972), ZFHX4 C/G (rs11787532), STARD13 G/T (rs9527281), CITC/T (rs7308076), ZFATA/C (rs733254), а также гена ZFAT в исследуемом участке ДНК А/С (733254) методом аллельной дискриминации. Возможны два генотипа: гомозиготный - в случае, когда одно из значений порогового цикла не определяется (ниже пороговой линии) и гетерозиготный - в случае, когда получено два значения пороговых циклов и по этим каналам определяют параболические кривые флюоресценции. В зависимости от того, накопление какого продукта амплификации происходит в реакции, устанавливают гетерозиготное или гомозиготное, состояние генов KIF1B С/Т (rs10492972), ZFHX4 C/G (rs11787532), STARD13 G/T (rs9527281), CIT C/T (rs7308076), ZFAT A/C (rs733254).

В случае гетерозиготного генотипа для определения доминирующей аллели определяют числовое значение соотношения номеров пороговых циклов амплификации по каналам FAM и VIC (HEX). Для полиморфизма rs10492972 гена KIF1B, если Cq1/Cq2≤1,047, то преобладает аллель Т, если Cq1/Cq2>1,047, то доминирует аллель С. Для полиморфизма rs11787532 гена ZFHX4, если Cq1/Cq2≤1,017, то преобладает аллель G, если Cq1/Cq2>1,017, то доминирует аллель С. Для полиморфизма rs9527281 гена STARD13, если Cq1/Cq2≤0,894, то преобладает аллель Т, если Cq1/Cq2>0,894, то доминирует аллель G. Для полиморфизма rs7308076 гена CIT, если Cq1/Cq2≤0,957, то преобладает аллель Т, если Cq1/Cq2>0,957, то доминирует аллель С. Для полиморфизма rs733254 гена ZFAT, если Cq1/Cq2≤1,033, то преобладает аллель С, если Cq1/Cq2>1,033, то доминирует аллель А.

После определения доминирующей аллели каждого из полиморфизмов на каждого пациента составляют формулу гаплотипа, где в зависимости от преобладающей аллели гетерозиготный генотип записывают следующим образом Т>С или С>Т для rs10492972 гена KIF1B; G>C или C>G для rs11787532 гена ZFHX4; T>G или G>T для rs9527281 гена STARD13; Т>С или C>Т для rs7308076 гена CIT; А>С или C>A для rs733254 гена ZFAT.

Конкретная формула гаплотипа, указывающая на высокую скорость прогрессирования PC, определена методом множественного анализа частоты встречаемости аллелей с использованием программного пакета SNPstats, Institut Catala d'Oncologica, Испания.

При наличии генотипа Т/Т или Т>С rs10492972, генотипа G/G или G>C rs11787532, генотипа Т/Тили T>G rs9527281, генотипа С/С или C>Т rs7308076, генотипа А/А или А>С rs733254, то есть наличия гаплотипа TGTCA, прогнозируют высокую скорость прогрессирования PC у больных, получающих терапию препаратами интерферона-бета.

Пример 1

Больная З., 41 год. Дебют PC в возрасте 39 лет с чувствительных нарушений. Диагноз PC установлен в 2015 году, длительность заболевания на момент осмотра составила 2,5 года. С момента дебюта принимает Интерферон-бета 1а, на фоне чего имела 3-4 обострения, купированные приемом кортикостероидной терапии. На момент осмотра в неврологическом статусе отмечается умеренный тетрапарез с акцентом в ногах и слева, стволовые нарушения, чувствительные нарушения, умеренные тазовые нарушения по типу императивных позывов и недержания; выраженный астенический синдром. Способность к передвижению ограничена 200 м. Балл по EDSS -5,5. Скорость прогрессирования высокая -2,2 балла в год.

Диагноз: PC, рецидивирующе-ремиттирующее течение, с высокой скоростью прогрессирования (наличие в геноме гаплотипа TGTCA).

Рекомендована замена медикаментозной терапии.

Пример 2

Больной П., 40 лет. Дебют PC в возрасте 36 лет с координаторных нарушений. Диагноз PC установлен в 2014 году, длительность заболевания на момент осмотра составила 4 года. ПИТРС принимает в течение 3,5 лет (Интерферон-бета 1а). На фоне терапии имелось одно обострение, купированное не полностью. В статусе отмечается умеренный спастический тетрапарез с акцентом в ногах, выраженный атактический синдром, легкие стволовые нарушения, умеренные чувствительные и тазовые нарушения. Балл по EDSS-4,0. Скорость прогрессирования -1,0 балл в год.

Диагноз: PC, рецидивирующе-ремиттирующее течение, с высокой скоростью прогрессирования (наличие в геноме гаплотипа TGTCA).

Рекомендована замена медикаментозной терапии.

Пример 3

Больной С., 52 года. Дебют PC в возрасте 32 лет в виде ретробульбарного неврита. Диагноз PC установлен в 1995 году, длительность заболевания на момент осмотра составила 20 лет. В течение 6 лет получает Интерферон-бета1а. За время приема препарата 3 обострения, купированные курсами кортикостероидной терапии. На момент осмотра в неврологическом статусе отмечаются умеренные двигательные нарушения в виде тетрапареза с акцентом справа; умеренного атактического синдрома, умеренных тазовых нарушений по типу императивных позывов, нарушения зрения. В ходьбе ограничен незначительно, проходит более 500 м без отдыха. Балл по EDSS-4.0. Скорость прогрессирования низкая, 0,2 балла в год.

Диагноз: PC, рецидивирующе-ремиттирующее течение, с низкой скоростью прогрессирования (присутствие гаплотипа TCGTC, отсутствие в геноме гаплотипа TGTCA). Назначенная терапия эффективна.

Способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета, характеризующийся тем, что образец ДНК, выделенный из периферической венозной крови больного PC, исследуют по полиморфизмам, используя в качестве праймеров участок ДНК генов KIF1B С/Т (rs10492972), ZFHX4 C/G (rs11787532), STARD13 G/T (rs9527281), CIT C/T (rs7308076), ZFAT A/C (rs733254), для каждого из указанных полиморфизмов устанавливают гетерозиготный или гомозиготный генотип и определяют доминирующую аллель, а при наличии гетерозиготного генотипа ее определяют путем соотношения пороговых циклов амплификации по каналам FAM и VIC (HEX), определяют гаплотип как сочетание пяти доминирующих аллелей и при наличии в геноме больного PC гаплотипа TGTCA прогнозируют высокую скорость прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета.



 

Похожие патенты:

Изобретение относится к ветеринарной вирусологии, а именно к молекулярной диагностике. Разработаны олигонуклеотидные праймеры для выявления ДНК вируса африканской чумы свиней: F3 р22 GTTTTACGGATACTGCTGC, В3 р22 CCTTACCATATTTAAGAACCGG, FIP р22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC, BIP р22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT, LoopB р22 CCGATGACTGTACAGGTTGGG.

Изобретение относится к биотехнологии. Описан выделенный вирус, который является членом пестивирусов, для диагностики и лечения заболевания, вызванного пестивирусом, отличающийся тем, что а) вирус является возбудителем врожденного тремора группы А-II у свиней, а б) вирус имеет вирусный геном, содержащий ген, кодирующий оболочечный белок Erns, ген, кодирующий оболочечный белок E2, и ген, кодирующий оболочечный белок E1, при этом нуклеотидная последовательность гена Erns имеет уровень идентичности, составляющий по меньшей мере 80% по отношению к нуклеотидной последовательности, как показано в SEQ ID NO:1, и/или нуклеотидная последовательность гена E2 имеет уровень идентичности, составляющий по меньшей мере 80% по отношению к нуклеотидной последовательности, представленной в SEQ ID NO:3, и/или нуклеотидная последовательность гена Е1 имеет уровень идентичности, составляющий по меньшей мере 80% по отношению к нуклеотидной последовательности, как показано в SEQ ID NO:5.

Группа изобретений относится к области биотехнологии. Предложены система и способ секвенирования синтезом (SBS).

Изобретение относится к области биотехнологии и медицины. Предложен способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии.

Изобретение относится к области биотехнологии, конкретно к способу получения иммобилизованной библиотеки фрагментов ДНК нуклеиновой кислоты-мишени со штрихкодами с использованием иммобилизованных на носителе транспозомных комплексов для захвата специфических фрагментов ДНК.

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени.

Изобретение относится к биотехнологии. Описано множество праймеров для использования в конструировании профиля ДНК человека, содержащее два набора праймеров.
Изобретение относится к биотехнологии, а именно к офтальмологии и фармакогенетике, и может быть использовано при подборе терапии у пациентов с экссудативной («влажной») и «сухой» формах возрастной макулярной дегенерации (ВМД).

Изобретение относится к биотехнологии, в частности к способу тестирования собаки для определения предрасположенности собаки к накоплению меди в печени, включающему детекцию в образце присутствия или отсутствия в геноме собаки одного или более полиморфизмов, выбранных из: (a) Chr22_3167534 (SEQ ID NO: 144), Chr22_3135144 (SEQ ID NO: 145), Chr20_55461150 (SEQ ID NO: 146), ChrX_120879711 (SEQ ID NO: 147), Chr19_6078084 (SEQ ID NO: 148), Chr15_62625262 (SEQ ID NO: 149), Chr14_39437543 (SEQ ID NO: 150), Chr15_62625024 (SEQ ID NO: 151), Chr3_86838677 (SEQ ID NO: 152), Chr24_4011833 (SEQ ID NO: 153), Chr18_60812198 (SEQ ID NO: 154), Chr10_65209946 (SEQ ID NO: 155) и повтора CGCCCC в хромосомном положении 22:3135287; (b) одного или более полиморфизмов в неравновесном сцеплении с указанным полиморфизмом (a), и/или (c) Chr32_38904515 (SEQ ID NO: 156), Chr8_4892743 (SEQ ID NO: 157) и Chr8_4880518 (SEQ ID NO: 158).

Изобретение относится к биотехнологии и определению респираторных заболеваний с помощью молекулярных маркеров в качестве средства прогнозирования развития случаев респираторных инфекций.

Изобретение относится к ветеринарной вирусологии, а именно к молекулярной диагностике. Разработаны олигонуклеотидные праймеры для выявления ДНК вируса африканской чумы свиней: F3 р22 GTTTTACGGATACTGCTGC, В3 р22 CCTTACCATATTTAAGAACCGG, FIP р22 TGGGGGCTATGGGATTCACT-AAGAATTTGGAAAAACACGGC, BIP р22 TGTGTGAAAAATATTGTTCATGGGG-ACATAACATGTTCCCTCCTT, LoopB р22 CCGATGACTGTACAGGTTGGG.

Группа изобретений относится к области биотехнологии. Предложены система и способ секвенирования синтезом (SBS).

Изобретение относится к области биотехнологии и медицины. Предложен способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии.

Изобретение относится к области биотехнологии и медицины. Предложен способ поиска молекулярных маркеров патологического процесса для дифференциальной диагностики, мониторинга и таргетной терапии.

Изобретение относится к области биотехнологии, конкретно к способу получения иммобилизованной библиотеки фрагментов ДНК нуклеиновой кислоты-мишени со штрихкодами с использованием иммобилизованных на носителе транспозомных комплексов для захвата специфических фрагментов ДНК.

Изобретение относится к области биотехнологии и медицины. Предложен способ дифференциальной диагностики глиом на основании анализа экспрессии генов и микро-РНК, включающий выделение тотальной РНК из тканевых проб глиом и перифокальной зоны, обратную транскрипцию, с последующей амплификацией в режиме реального времени RT-PCR, отличающийся тем, что используют высокоспецифичные праймеры для генетических локусов EGFR, MSI1, PSMC4, ТВР, RPLO, и микро-РНК hsa-miR-92-1-5р, hsa-miR-126-5p, hsa-miR-7-5p, анализируют полученные данные и вычисляют коэффициент относительной экспрессии Е с использованием трех высокоспецифичных референсных генов: PSMC4, ТВР, RPLO и двух референсных высокоспецифичных микро-РНК: hsa-miR-126-5р, hsa-miR-7-5p, сравнивают полученные значения Е в опухолевой ткани с контрольными и при значениях EEGFR<0,5 или EEGFR>1,5, EMSI1<0,5 или EMSI1>1,5, Ehsa-miR-92a-1-5p<0,5 или Ehsa-miR-92a-1-5p>1,5 хотя бы по одному локусу у пациента диагностируется глиома высокой степени злокачественности III, IV; отсутствие изменений экспрессии указанных локусов относительно контроля свидетельствует о соответствии опухоли II степени злокачественности.
Изобретение относится к медицине. На прегравидарном этапе у пациенток группы риска, которая выделена по анамнестическим данным, определяют полиморфизмы генов фолатного цикла и PAI-1.

Изобретение относится к области биотехнологии. Сущность изобретения заключается в том, что из ДНК исследуемого штамма L.

Изобретение относится к биотехнологии. Описана композиция олигонуклеотидов для амплификации последовательности-мишени.

Изобретение относится к области биотехнологии. Изобретение представляет собой способ проведения ПЦР в режиме реального времени для генотипирования крупного рогатого скота по аллелям 337C/G гена fshr (rs43745234), состоит в том, что используются:прямой праймер прямой праймер 5'-GAATTGAAAAGGCCAACAACC-3',обратный праймер 5'-CACCAGAATACAGAAGTTCTTACAGA-3',FSHR337C - аллель-специфичный флуоресцентно-меченый зонд-5'-FAM-CATCGACCCTGATGCC BHQ1-3',FSHR337G - аллель-специфичный флуоресцентно-меченый зонд5'-VIC-CATCGACGCTGATGC-BHQ1-3'.Изобретение позволяет повысить надежность детекции аллелей 337C/G (rs43745234) гена fshr, упростить анализ и сократить время его проведения до 1,5 часов.

Изобретение относится к областям биотехнологии, молекулярной биологии и медицинской микробиологии. Описан набор олигонуклеотидных праймеров для реакции петлевой изотермической амплификации (LAMP), который позволяет амплифицировать специфические для бактерий вида Francisella tularensis фрагменты ДНК из целевого гена, имеющего нуклеотидную последовательность SEQ ID №1.

Изобретение относится к биотехнологии и представляет собой способ прогнозирования скорости прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета. Изобретение дает возможность прогнозирования скорости течения PC до назначения лечения препаратами интерферона-бета и осуществляется следующим образом: образец ДНК, выделенный из периферической венозной крови больного PC, исследуют по полиморфизмам, используя в качестве праймеров участок ДНК генов KIF1B СТ, ZFHX4 CG, STARD13 GT, CIT CT, ZFAT AC, для каждого из указанных полиморфизмов устанавливают гетерозиготный или гомозиготный генотип и определяют доминирующую аллель, а при наличии гетерозиготного генотипа ее определяют путем соотношения пороговых циклов амплификации по каналам FAM и VIC, определяют гаплотип как сочетание пяти доминирующих аллелей и при наличии в геноме больного PC гаплотипа TGTCA прогнозируют высокую скорость прогрессирования рассеянного склероза у больных, получающих терапию препаратами интерферона-бета. 3 пр.

Наверх