Модулирующие полинуклеотиды

Изобретение относится к области биотехнологии. Предложен модулирующий полинуклеотид для модулирования экспрессии гена в клетке. Изобретение может быть использовано в медицине. 6 н. и 11 з.п. ф-лы, 13 ил., 19 табл., 19 пр.

 

ПЕРЕКРЕСТНАЯ ССЫЛКА НА РОДСТВЕННЫЕ ЗАЯВКИ

В соответствии с настоящей заявкой испрашивается приоритет согласно предварительной заявке на выдачу патента США № 62/079590, озаглавленной «Модулирующие полинуклеотиды», поданной 14 ноября 2014 года, предварительной заявке на выдачу патента США № 62/212004, озаглавленной «Модулирующие полинуклеотиды», поданной 31 августа 2015 года, предварительной заявке на выдачу патента США № 62/234477, озаглавленной «Модулирующие полинуклеотиды», поданной 29 сентября 2015 года; причем содержание каждой из них включено в данный документ во всей своей полноте посредством ссылки.

ССЫЛКА НА ПЕРЕЧЕНЬ ПОСЛЕДОВАТЕЛЬНОСТЕЙ

Данная заявка подана вместе с перечнем последовательностей в электронном формате. Перечень последовательностей представлен в виде файла с названием 1014PCTSL.txt, созданного 12 ноября 2015 года, размер которого составляет 235330 байта. Информация из перечня последовательностей в электронном формате включена в данный документ во всей своей полноте посредством ссылки.

ОБЛАСТЬ ТЕХНИКИ, К КОТОРОЙ ОТНОСИТСЯ НАСТОЯЩЕЕ ИЗОБРЕТЕНИЕ

Настоящее изобретение относится к описываемым в настоящем документе композициям, способам, процессам, наборам и устройствам для разработки, получения, производства и/или составления модулирующих полинуклеотидов. В соответствии с некоторыми вариантами осуществления такие модулирующие полинуклеоитиды могут кодироваться рекомбинантными аденоассоциированными вирусами (AAV) или находиться в рекомбинантных аденоассоциированных вирусах (AAV) и могут содержать искусственные микроРНК, искусственные pre-микроРНК и/или искусственные pri-микроРНК.

УРОВЕНЬ ТЕХНИКИ НАСТОЯЩЕГО ИЗОБРЕТЕНИЯ

МикроРНК (или miRNA, или miR) представляют собой небольшие некодирующие одноцепочечные молекулы рибонуклеиновой кислоты (РНК), которые обычно имеют длину 19-25 нуклеотидов. В геномах млекопитающих было выявлено более тысячи молекул микроРНК. Зрелая микроРНК изначально связывается с 3'-нетранслируемым участком (3'-UTR) целевых матричных РНК (мРНК) в результате частичного или полного спаривания с комплементарными последовательностями целевых мРНК, способствуя разрушению целевых мРНК на посттранскрипционном уровне, а в некоторых случаях подавляя инициацию трансляции. МикроРНК играют решающую роль во многих биологических процессах, таких как регуляция клеточного цикла и клеточного роста, апоптоз, клеточная пролиферация и развитие тканей.

Гены miRNA, как правило, транскрибируются в виде длинных первичных транскриптов miRNA (т. е. pri-miRNA). pri-miRNA расщепляется на предшественник miRNA (т.е., pre-miRNA), который дополнительно процессируется с образованием зрелой и функциональной miRNA.

Несмотря на то, что во многих стратегиях целевой экспрессии используются подходы на основе нуклеиновых кислот, сохраняется потребность в улучшенных подходах на основе нуклеиновых кислот, которые характеризуются более высокой специфичностью и меньшим количеством нецелевых эффектов.

Настоящее изобретение предлагает такие улучшенные подходы в форме искусственных конструкций pri-, pre- и зрелой микроРНК и способы их разработки. Такие новые конструкции могут быть синтетическими автономными молекулами или могут кодироваться в плазмиде или векторе экспрессии для доставки в клетки. Такие векторы включают, без ограничения, векторы на основе аденоассоциированного вируса, такие как векторные геномы любого из серотипов AAV или другие средства доставки на основе вирусов, такие как лентивирус и т.д.

СУЩНОСТЬ ИЗОБРЕТЕНИЯ

Настоящее изобретение относится к описываемым в настоящем документе композициям, способам, процессам, наборам и устройствам для разработки, получения, производства и/или составления модулирующих полинуклеотидов.

В соответствии с некоторыми вариантами осуществления такие модулирующие полинуклеоитиды могут кодироваться или содержаться в плазмидах или рекомбинантных аденоассоциированных вирусах (AAV) и могут содержать искусственные микроРНК, искусственные pre-микроРНК и/или искусственные pri-микроРНК.

Подробности различных вариантов осуществления настоящего изобретения изложены в описании ниже. Другие признаки, объекты и преимущества настоящего изобретения будут очевидны из описания и графических материалов, а также из формулы изобретения.

КРАТКОЕ ОПИСАНИЕ ГРАФИЧЕСКИХ МАТЕРИАЛОВ

Вышеизложенные и другие цели, признаки и преимущества будут понятны из следующего описания конкретных вариантов осуществления настоящего изобретения, которые иллюстрируются в сопутствующих графических материалах, в которых аналогичные условные обозначения относятся к одним и тем же частям на разных видах. Графические материалы не обязательно сведены к определенному масштабу, вместо этого акцент сделан на иллюстрацию принципов различных вариантов осуществления настоящего изобретения.

Фиг. 1 представляет собой схематическое изображение искусственной pri-микроРНК, кодируемой в векторе AAV по настоящему изобретению.

Фиг. 2 представляет собой гистограмму, показывающую активность конструкций pri-мРНК, закодированных в AAV-векторах.

Фиг. 3 представляет собой гистограмму, показывающую активность направляющей цепи модулирующих полинуклеотидов, закодированных в AAV-векторах, в клетках HEK293T.

Фиг. 4 представляет собой гистограмму, показывающую активность сопровождающей цепи модулирующих полинуклеотидов, закодированных в AAV-векторах, в клетках HEK293T.

Фиг. 5 представляет собой гистограмму, показывающую активность направляющей цепи модулирующих полинуклеотидов, закодированных в AAV-векторах, в клетках HeLa.

Фиг. 6 представляет собой гистограмму, показывающую активность сопровождающей цепи модулирующих полинуклеотидов, закодированных в AAV-векторах, в клетках HeLa.

Фиг. 7 представляет собой гистограмму количественного определения экспрессируемой ДНК внутриклеточного AAV.

Фиг. 8 представляет собой гистограмму, показывающую активность конструкций, закодированных в AAV-векторах, в двигательных нейронах человека.

Фиг. 9 представляет собой график, показывающий дозозависимый сайленсинг SOD1 в клетках U251MG.

Фиг. 10 представляет собой график, показывающий дозозависимый сайленсинг SOD1 в астроцитах человека.

Фиг. 11 представляет собой график, показывающий длительность сайленсинга SOD1 в клетках U251MG.

Фиг. 12 содержит фиг. 12A, фиг. 12B и фиг. 12C, которые представляют собой графики, показывающие дозозависимые эффекты конструкции. Фиг. 12A показывает относительную экспрессию SOD1. Фиг. 12B показывает процент направляющей цепи. Фиг. 12C показывает процент сопровождающей цепи.

Фиг. 13 представляет собой диаграмму, показывающую положение модулирующего полинуклеотида (MP) по отношению к ITR, интрону (I) и полиA (P).

ПОДРОБНОЕ ОПИСАНИЕ

Композиции согласно настоящему изобретению

В соответствии с настоящим изобретением представлены модулирующие полинуклеотиды, которые функционируют в качестве искусственных микроРНК. В контексте настоящего описания «модулирующий полинуклеотид» представляет собой любой полимер нуклеиновых кислот, чьей функцией является модуляция (либо повышение, либо снижение) уровня или количества целевого гена. Модулирующие полинуклеотиды включают себя молекулы-предшественники, которые перед модулированием процессируются внутри клетки. Модулирующие полинуклеотиды или их процессированные формы могут быть закодированы в плазмиде, векторе, геноме или другом векторе экспрессии нуклеиновой кислоты для доставки в клетку.

В соответствии с некоторыми вариантами осуществления модулирующие полинуклеотиды разработаны в виде первичных микроРНК (pri-miR) или предшественников микроРНК (pre-miR), которые процессируются внутри клетки с образованием высокоспецифических искусственных микроРНК.

Модулирующие полинуклеотиды, особенно искусственные микроРНК по настоящему изобретению, могут быть разработаны на основе последовательности или структурного остова канонической или известной микроРНК, pri-микроРНК или pre-микроРНК. Такие последовательности могут соответствовать любой известной микроРНК или ее предшественнику, например описанным в публикации США US2005/0261218 и публикации США US2005/0059005, причем содержание каждого из этих источников включено в данный документ во всей своей полноте посредством ссылки.

МикроРНК (или miRNA, или miR) представляют собой некодирующие РНК длиной 19-25 нуклеотидов, которые связываются с 3′UTR молекул нуклеиновых кислот и подавляют экспрессию генов либо в результате снижения стабильности молекул нуклеиновых кислот, либо в результате подавления трансляции. Модулирующие полинуклеотиды согласно настоящему изобретению могут содержать одну или более последовательностей микроРНК, затравочные участки микроРНК или искусственные микроРНК, например, последовательности, которые выступают в роли микроРНК.

Последовательность микроРНК содержит «затравочный» участок, т. е. последовательность в участке 2-9 положения зрелой микроРНК, последовательность которой полностью комплементарна по Уотсону-Крику целевой последовательности miRNA. Затравочный участок микроРНК может содержать 2-8 положения или 2-7 или 2-9 положения зрелой микроРНК. В соответствии с некоторыми вариантами осуществления затравочный участок микроРНК может содержать 7 нуклеотидов (например, со 2-го по 8-й нуклеотиды зрелой микроРНК), где комплементарный затравочному участку сайт в соответствующей целевой miRNA фланкирован аденином (A) напротив 1-го положения микроРНК. В соответствии с некоторыми вариантами осуществления затравочный участок микроРНК может содержать 6 нуклеотидов (например, со 2-го по 7-й нуклеотиды зрелой микроРНК), где комплементарный затравочному участку сайт в соответствующей целевой miRNA фланкирован аденином (A) напротив 1-го положения микроРНК. См., например, Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105; содержание которой включено в данный документ во всей своей полноте посредством ссылки. У встречающихся в природе микроРНК основания затравочного участка микроРНК полностью комплементарны целевой последовательности.

Как раскрыто в данном документе, были выявлены и применены расчетные параметры или правила с целью разработки модулирующих полинуклеотидов (например, искусственных микроРНК), которые обладают превосходящими модулирующими свойствами в отношении целевого гена при ограниченных нецелевых эффектах.

В соответствии с одним вариантом осуществления молекулярный остов модулирующих полинуклеотидов, описанных в данном документе, можно разработать и оптимизировать таким образом, чтобы получить модулирующий полинуклеотид, который характеризуется необходимыми модулирующими свойствами к целевому гену. В качестве неограничивающего примера, модулирующий полинуклеотид может обладать превосходящими модулирующими свойствами к целевому гену при ограниченных нецелевых эффектах.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды согласно настоящему изобретению, такие как искусственные miR, состоят из модульных элементов или мотивов последовательностей, собранных согласно ряду правил, которые приводят к высокоспецифическому целевому распознаванию и низкому соотношению направляющей/сопровождающей цепи. Такие модули или мотивы последовательностей включают без ограничения двухцепочечные участки, фланкирующие участки, петли, оптимизированные петли, UGUG-петли, GU-домены, спейсеры (для контроля расстояний между проксимальными и дистальными мотивами или модулями или для введения структурных элементов, таких как повороты, петли или вздутия), мотивы CNNC и участки с термодинамической асимметрией, которые могут охватывать петли, вздутия, ошибочно спаренные основания, неоднозначные пары оснований и/или их комбинации. Неограничивающие примеры правил, которые можно применять отдельно или в комбинации при создании искусственных miR, включают описанные в Seitz et al. Silence 2011, 2:4; Gu, et al., Cell 151, 900-911, November 9, 2012; Schwartz, et al., Cell, Vol. 115, 199-208, October 17, 2003; Park, et al., Nature, Vol. 475, 101, 14 July 2011; Ketley et al., 2013, PLoS ONE 8(6); Liu, et al., Nucleic Acids Research, 2008, Vol. 36, No. 9 2811-2824; Dow, et al., 2013, Nat Protoc. ; 7(2): 374-393. doi:10.1038/nprot.2011.446; Auyeung, et al., Cell 152, 844-858, February 14, 2013; Gu et al., Cell 2012 Nov 9, 151(4):900-11; Fellmann et al. Molecular Cell 41, 733-746, 2011; Han et al. Cell 125, 887-907, 2006; Betancur et al. Frontiers in Genetics, Vol. 3, Art. 127, 1-6 July 2012; Schwarz et al. Cell Vol 115, 199-208, 2003; содержание каждой из которых включено в данный документ во всей своей полноте посредством ссылки.

Кроме модулей или мотивов последовательностей, модулирующие полинуклеотиды содержат по меньшей мере одну из сопровождающей и направляющей цепи или обе. Сопровождающая и направляющая цепь могут размещаться или располагаться на 5'-ветви или 3'-ветви структуры «петля на стебле» модулирующего полинуклеотида.

В соответствии с одним вариантом осуществления 3'-стеблевая ветвь модулирующих полинуклеотидов может содержать 11 нуклеотидов ниже 3'-конца направляющей цепи, которые комплементарны 11 из 13 нуклеотидов, расположенных выше 5'-конца сопровождающей цепи в 5'-стеблевой ветви.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды могут содержать цистеин, который расположен в 6 нуклеотидах ниже от 3'-конца 3'-стеблевой ветви модулирующего полинуклеотида.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды содержат затравочный участок miRNA, соответствующий направляющей цепи. В соответствии с другим вариантом осуществления модулирующие полинуклеотиды содержат затравочный участок miRNA, соответствующий сопровождающей цепи. В соответствии с еще одним вариантом осуществления модулирующие полинуклеотиды не содержат затравочный участок, соответствующий направляющей или сопровождающей цепи.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды могут почти не иметь значительных полноразмерных нецелевых последовательностей в отношении направляющей цепи. В соответствии с другим вариантом осуществления модулирующие полинуклеотиды могут почти не иметь значительных полноразмерных нецелевых последовательностей сопровождающей цепи. В соответствии с еще одним вариантом осуществления модулирующие полинуклеотиды могут почти не иметь значительных полноразмерных нецелевых последовательностей направляющей цепи или сопровождающей цепи.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды могут характеризоваться высокой активностью in vitro. В соответствии с другим вариантом осуществления модулирующие полинуклеотиды могут характеризоваться низкой активностью in vitro. В соответствии с еще одним вариантом осуществления модулирующие полинуклеотиды могут характеризоваться высокой активностью направляющей цепи и низкой активностью сопровождающей цепи in vitro.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды характеризуются высокой активностью направляющей цепи и низкой активностью сопровождающей цепи in vitro. Нокдаун (KD) мишени направляющей цепью может составлять по меньшей мере 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99,5% или 100%. Нокдаун мишени направляющей цепью может составлять 60-65%, 60-70%, 60-75%, 60-80%, 60-85%, 60-90%, 60-95%, 60-99%, 60-99,5%, 60-100%, 65-70%, 65-75%, 65-80%, 65-85%, 65-90%, 65-95%, 65-99%, 65-99,5%, 65-100%, 70-75%, 70-80%, 70-85%, 70-90%, 70-95%, 70-99%, 70-99,5%, 70-100%, 75-80%, 75-85%, 75-90%, 75-95%, 75-99%, 75-99,5%, 75-100%, 80-85%, 80-90%, 80-95%, 80-99%, 80-99,5%, 80-100%, 85-90%, 85-95%, 85-99%, 85-99,5%, 85-100%, 90-95%, 90-99%, 90-99,5%, 90-100%, 95-99%, 95-99,5%, 95-100%, 99-99,5%, 99-100% или 99,5-100%. В качестве неограничивающего примера, нокдаун (KD) мишени направляющей цепью составляет более 70%.

В соответствии с одним вариантом осуществления IC50 сопровождающей цепи для ближайшей нецелевой последовательности превышает 100, умноженное на IC50 направляющей цепи для целевой последовательности. В качестве неограничивающего примера, если IC50 сопровождающей цепи для ближайшей нецелевой последовательности превышает 100, умноженное на IC50 направляющей цепи для целевой последовательности, то считается, что модулирующий полинуклеотид характеризуется высокой активностью направляющей цепи и низкой активностью сопровождающей цепи in vitro.

В соответствии с одним вариантом осуществления процессинг 5'-конца направляющей цепи характеризуется корректной стартовой точкой (n) на 5'-конце по меньшей мере 75%, 80%, 85%, 90%, 95%, 99% или 100% времени in vitro или in vivo. В качестве неограничивающего примера, 5'-процессинг направляющей цепи является точным и характеризуется корректной стартовой точкой (n) на 5'-конце по меньшей мере 99% времени in vitro. В качестве неограничивающего примера, 5'-процессинг направляющей цепи является точным и характеризуется корректной стартовой точкой (n) на 5'-конце по меньшей мере 99% времени in vivo.

В соответствии с одним вариантом осуществления соотношение направляющей цепи к сопровождающей цепи (G:P) составляет 1:99, 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5 или 99:1 in vitro или in vivo. В качестве неограничивающего примера, соотношение направляющей цепи и сопровождающей цепи составляет 80:20 in vitro. В качестве неограничивающего примера, соотношение направляющей цепи и сопровождающей цепи составляет 80:20 in vivo.

В соответствии с одним вариантом осуществления целостность векторного генома составляет по меньшей мере 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% или более 99% от полной длины конструкции.

Модулирующие полинуклеотиды

В соответствии с одним вариантом осуществления любая из известных конструкций для RNAi или средств для RNAi может выступать в роли исходной конструкции для разработки сопровождающей и/или направляющей цепи модулирующих полинуклеотидов или искусственных микроРНК по настоящему изобретению. В их число входят канонические siRNA, малые интерферирующие РНК (siRNA), двухцепочечные РНК (dsRNA), инвертированные повторы, короткие шпилечные РНК (shRNA), короткие временно регулируемые РНК (stRNA), кластеризованные ингибиторные РНК (cRNA), в том числе радиальная кластеризованная ингибиторная РНК, асимметричная кластеризованная ингибиторная РНК, линейная кластеризованная ингибиторная РНК и сложная или составная кластеризованная ингибиторная РНК, субстраты дайсеров, средства для ДНК-направленной RNAi (ddRNAi), средства для одноцепочечной RNAi (ssRNAi), антагонисты микроРНК (miRNA), микроРНК-мимики, микроРНК-агонисты, блокмиры (также известные как Xmir), микроРНК-мимики, микроРНК-средства для прикрытия, supermiR, олигомерные конструкции, раскрытые в публикации PCT WO/2005/013901, содержание которой включено в данный документ во всей своей полноте при помощи ссылки, тройные конструкции для RNAi, такие как раскрытые в публикации США 20090131360, содержание которой включено в данный документ во всей своей полноте при помощи ссылки, конструкции соло-rxRNA, раскрытые в публикации PCT WO/2010/011346, содержание которой включено в данный документ во всей своей полноте при помощи ссылки; конструкции sd-rxRNA, раскрытые в публикации PCT WO/2010/033247, содержание которой включено в данный документ во всей своей полноте при помощи ссылки, конструкции для RNAi двойного действия, которые снижают уровни РНК, а также модулируют иммунный ответ, как раскрыто в публикациях PCT WO/2010/002851 и WO/2009/141146, содержание которых включено в данный документ во всей своей полноте при помощи ссылки, и антигенные РНК (agRNA) или малые активирующие РНК (saRNA), которые повышают экспрессию целевой последовательности, для которой они разработаны, раскрытые в публикациях PCT WO/2006/130201, WO/2007/086990, WO/2009/046397, WO/2009/149182, WO/2009/086428, содержание которых включено в данный документ во всей своей полноте при помощи ссылки.

Аналогично, любой pri- или pre-микроРНК-предшественник вышеприведенной микроРНК также может выступать в роли молекулярного остова модулирующих полинуклеотидов по настоящему изобретению.

В соответствии с одним вариантом осуществления исходная конструкция может быть получена из любого соответствующего вида, такого как, без ограничения, мышь, крыса, собака, обезьяна или человек.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться ниже промотора в векторе экспрессии, такого, как без ограничения, промотор CMV, U6, CBA или CBA с интроном SV40. Кроме того, модулирующий полинуклеотид также может располагаться выше последовательности полиаденилирования в векторе экспрессии. В качестве неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии. В качестве неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или более 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться выше последовательности полиаденилирования в векторе экспрессии. Кроме того, модулирующий полинуклеотид может располагаться ниже промотора в векторе экспрессии, такого как, без ограничения, промотор CMV, U6, CBA или CBA с интроном SV40. В качестве неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии. В качестве неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или более 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования в векторе экспрессии.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться в scAAV.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться в ssAAV.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться возле 5'-конца флип-ITR в векторе экспрессии. В соответствии с другим вариантом осуществления модулирующий полинуклеотид может располагаться возле 3'-конца флип-ITR в векторе экспрессии. В соответствии с еще одним вариантом осуществления модулирующий полинуклеотид может располагаться возле 5'-конца флоп-ITR в векторе экспрессии. В соответствии с еще одним вариантом осуществления модулирующий полинуклеотид может располагаться возле 3'-конца флоп-ITR в векторе экспрессии. В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться между 5'-концом флип-ITR и 3'-концом флоп-ITR в векторе экспрессии. В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться между (например, посередине между 5'-концом флип-ITR и 3'-концом флоп-ITR или 3'-концом флоп-ITR и 5'-концом флип-ITR) 3'-концом флип-ITR и 5'-концом флип-ITR в векторе экспрессии. В качестве неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов ниже 5'- или 3'-конца ITR (например, флип- или флоп-ITR) в векторе экспрессии. В качестве неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов выше 5'- или 3'-конца ITR (например, флип- или флоп-ITR) в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже 5'- или 3'-конца ITR (например, флип-ITR или флоп-ITR) в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов выше 5'- или 3'-конца ITR (например, флип- или флоп-ITR) в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или более 25% нуклеотидов выше 5'- или 3'-конца ITR (например, флип- или флоп-ITR) в векторе экспрессии. В качестве другого неограничивающего примера, модулирующий полинуклеотид может располагаться в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% ниже 5'- или 3'-конца ITR (например, флип-ITR или флоп-ITR) в векторе экспрессии.

Молекулярные остовы

В соответствии с некоторыми вариантами осуществления исходным молекулярным остовом модулирующего полинуклеотида является известная pri- или pre-микроРНК или pri- или pre-микроРНК дикого типа. В соответствии с другими вариантами осуществления молекулярный остов модулирующих полинуклеотидов разрабатывают ab initio. (См. Cullen, Gene Therapy (2006) 13, 503-508, работа с miR30; Chung, et al., Nucleic Acids Research, 2006, Vol. 34, No. 7, работа с miR-155; содержание которых включено в данный документ во всей своей полноте при помощи ссылки).

В контексте настоящего описания «молекулярный остов» представляет собой каркасную или исходную молекулу, которая образует последовательность или структурную основу, по отношению к которой необходимо разрабатывать или создавать последующую молекулу.

Обратимся к фиг. 1. Модулирующие полинуклеотиды согласно настоящему изобретению могут быть разработаны в виде проиллюстрированных pri-miR. На фигуре показан молекулярный остов pri-miR. Модулирующий полинуклеотид, который содержит полезный груз (например, siRNA, miRNA или другое средство для RNAi, описанное в данном документе), содержит лидерную 5'-фланкирующую последовательность, которая может иметь любую длину и может быть получена целиком или частично из последовательности микроРНК дикого типа или быть полностью искусственной.

Аналогично, показанная на фигуре 3'-фланкирующая последовательность может являться зеркальным отражением 5'-фланкирующей последовательности по размеру и происхождению. Либо же фланкирующая последовательность может отсутствовать. 3'-фланкирующая последовательность может необязательно содержать один или более мотивов CNNC, где «N» обозначает любой нуклеотид.

Образование стебля представленной структуры «петля на стебле» включает как минимум по меньшей мере одну последовательность полезного груза. В соответствии с некоторыми вариантами осуществления последовательность полезного груза содержит по меньшей мере одну последовательность нуклеиновой кислоты, которая частично комплементарна или будет гибридизироваться с целевой последовательностью. В соответствии с некоторыми вариантами осуществления полезный груз представляет собой микроРНК дикого типа. В соответствии с некоторыми вариантами осуществления полезный груз представляет собой молекулу siRNA или фрагмент молекулы siRNA. В соответствии с некоторыми вариантами осуществления полезный груз представляет собой практически двухцепочечную конструкцию, которая может содержать одну или более микроРНК, искусственных микроРНК или siRNA.

В соответствии с некоторыми вариантами осуществления 5'-ветвь «петли на стебле» содержит сопровождающую цепь. Эта цепь также называется смысловой цепью в том плане, что она идентична целевой последовательности. Сопровождающая цепь может иметь длину 15-30 нуклеотидов. Она может иметь длину 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов.

В соответствии с некоторыми вариантами осуществления 3'-ветвь «петли на стебле» содержит направляющую цепь. Эта цепь также называется антисмысловой цепью в том плане, что она гомологична мишени. Направляющая цепь может иметь длину 15-30 нуклеотидов, 21-25 нуклеотидов или 22 нуклеотида. Она может иметь длину 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 или 30 нуклеотидов. Направляющая цепь в некоторых случаях содержит нуклеотид «G» в самом крайнем положении 5'-конца.

В соответствии с некоторыми вариантами осуществления, если направляющая цепь содержит микроРНК или искусственные микроРНК, то направляющая цепь может содержать одну или более затравочных последовательностей микроРНК. Затравочная последовательность может располагаться во 2-7, 2-8 или 2-9 положениях направляющей цепи по отношению к первому 5'-нуклеотиду направляющей цепи или относительно сайта расщепления дайсером.

В соответствии с другими вариантами осуществления сопровождающая цепь может находиться в 3'-ветви, в то время как направляющая цепь находится в 5'-ветви стебля структуры «петля на стебле».

Сопровождающая и направляющая цепи могут быть полностью комплементарны в пределах значительной части своей длины. В соответствии с другими вариантами осуществления сопровождающая и направляющая цепь могут быть по меньшей мере на 70, 80, 90, 95 или 99% комплементарны независимо в пределах по меньшей мере 50, 60, 70, 80, 85, 90, 95 или 99% длины цепей.

Ни идентичная сопровождающая цепь, ни гомологичная направляющая цепь не должны быть на 100% комплементарны целевой последовательности.

Сопровождающую и направляющую цепи структуры «петля на стебле» разделяет петля (также известная как петлевой мотив). Петля может иметь любую длину в диапазоне 4-30 нуклеотидов, 4-20 нуклеотидов, 4-15 нуклеотидов, 5-15 нуклеотидов, 6-12 нуклеотидов, 6 нуклеотидов, 7 нуклеотидов, 8 нуклеотидов, 9 нуклеотидов, 10 нуклеотидов, 11 нуклеотидов и/или 12 нуклеотидов.

В соответствии с некоторыми вариантами осуществления петля содержит по меньшей мере один мотив UGUG. В соответствии с некоторыми вариантами осуществления мотив UGUG расположен на 5'-конце петли.

В модулирующих полинуклеотидах могут присутствовать спейсерные участки, разделяющие один или более модулей друг от друга. Может присутствовать один или более таких спейсерных участков.

В соответствии с одним вариантом осуществления между сопровождающей цепью и фланкирующей последовательностью может присутствовать спейсерный участок из 8-20, т. е. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидов.

В соответствии с одним вариантом осуществления спейсер составляет 13 нуклеотидов и расположен между 5'-концом сопровождающей цепи и фланкирующей последовательностью. В соответствии с одним вариантом осуществления спейсер имеет достаточную длину для того, чтобы образовывать примерно один оборот спирали последовательности.

В соответствии с одним вариантом осуществления между направляющей цепью и фланкирующей последовательностью может присутствовать спейсерный участок из 8-20, т. е. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 или 20 нуклеотидов.

В соответствии с одним вариантом осуществления спейсерная последовательность состоит из 10-13, т. е. 10, 11, 12 или 13 нуклеотидов и расположена между 3'-концом направляющей цепи и фланкирующей последовательностью. В соответствии с одним вариантом осуществления спейсер имеет достаточную длину для того, чтобы образовывать примерно один оборот спирали последовательности.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид содержит по меньше мере один мотив UG в основании петли, при этом G-нуклеотид является спаренным, а U-нуклеотид является неспаренным. В соответствии с некоторыми вариантами осуществления неспаренный U-нуклеотид расположен во фланкирующей последовательности.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид в направлении от 5' до 3' содержит 5'-фланкирующую последовательность, 5'-ветвь, петлевой мотив, 3'-ветвь и 3'-фланкирующую последовательность. В качестве неограничивающего примера, 5'-ветвь может содержать сопровождающую цепь, а 3'-ветвь содержит направляющую цепь. В соответствии с другим неограничивающим примером, 5'-ветвь содержит направляющую цепь, а 3'-ветвь содержит сопровождающую цепь.

В соответствии с одним вариантом осуществления может быть изменена последовательность 5'-ветви, полезного груза (например, сопровождающей и/или направляющей цепи), петлевого мотива и/или 3'-ветви (например, замена 1 или более нуклеотидов, добавление нуклеотидов и/или удаление нуклеотидов). Это изменение может обуславливать полезное изменение функции конструкции (например, повысить нокдаун целевой последовательности, снизить разрушение конструкции, снизить нецелевой эффект, повысить эффективность полезного груза и снизить разрушение полезного груза).

В соответствии с одним вариантом осуществления может быть изменена последовательность сопровождающей цепи (например, замена 1 или более нуклеотидов, добавление нуклеотидов и/или удаление нуклеотидов). В качестве неограничивающего примера, последовательность сопровождающей цепи может содержать 1 или 2 замены в пределах последних 4 нуклеотидов последовательности (например, G, замененный на C). В качестве другого неограничивающего примера, последовательность сопровождающей цепи может содержать 1 или 2 замены в пределах 7-15 нуклеотидов от 5'-конца последовательности (например, A, замененный на U, или G, замененный на C).

В соответствии с одним вариантом осуществления может быть изменена последовательность цепи 3'-ветви (например, замена 1 или более нуклеотидов, добавление нуклеотидов и/или удаление нуклеотидов). В качестве неограничивающего примера, последовательность 3'-ветви может содержать 1 или 2 замены в пределах первых 4 нуклеотидов последовательности (например, U, замененный на А).

В соответствии с одним вариантом осуществления молекулярный остов конструкции полезного груза может содержать 5'-фланкирующий участок, петлевой мотив и 3'-фланкирующий участок. Между 5'-фланкирующим участком и петлевым мотивом может находиться первый участок последовательности полезного груза, а между петлевым мотивом и 3'-фланкирующим участком может находиться второй участок последовательности полезного груза. Первый и второй участки последовательности полезного груза могут содержать siRNA, miRNA или другие средства, фрагменты или варианты для RNAi, описанные в данном документе. Первый и второй участки последовательности полезного груза также могут содержать последовательность, которая является такой же, отличной или комплементарной по отношению к другой. В качестве неограничивающего примера, последовательность первого участка последовательности полезного груза может представлять собой сопровождающую цепь конструкции siRNA, а последовательность второго участка последовательности полезного груза может представлять собой направляющую цепь конструкции siRNA. Сопровождающая и направляющая последовательности могут быть практически комплементарны друг другу. В качестве другого неограничивающего примера, последовательность первого участка последовательности полезного груза может представлять собой направляющую цепь конструкции siRNA, а последовательность второй участка последовательности полезного груза может представлять собой сопровождающую цепь конструкции siRNA. Сопровождающая и направляющая последовательности могут быть практически комплементарны друг другу.

В соответствии с одним вариантом осуществления молекулярный остов модулирующих полинуклеотидов, описанных в данном документе, содержит 5'-фланкирующий участок, петлевой участок и 3'-фланкирующий участок. Неограничивающие примеры последовательностей 5'-фланкирующего участка, петлевого участка и 3'-фланкирующего участка, которые могут быть использованы в описанных в данном документе молекулярных остовах, показаны в таблицах 1-3.

Таблица 1. 5'-Фланкирующие участки для молекулярного остова

Название 5'-фланкирующего участка Последовательность 5'-фланкирующего участка SEQ ID 5'-фланкирующего участка
5F1 UUUAUGCCUCAUCCUCUGAGUGCUGAAGGCUUGCUGUAGGCUGUAUGCUG 1
5F2 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCUUCGGAA 2
5F3 GAAGCAAAGAAGGGGCAGAGGGAGCCCGUGAGCUGAGUGGGCCAGGGACUGGGAGAAGGAGUGAGGAGGCAGGGCCGGCAUGCCUCUGCUGCUGGCCAGA 3
5F4 GUGCUGGGCGGGGGGCGGCGGGCCCUCCCGCAGAACACCAUGCGCUCUUCGGGA 4

Таблица 2. Участки петлевых мотивов молекулярного остова

Название участка петлевого мотива Последовательность участка петлевого мотива SEQ ID участка петлевого мотива
L1 UGUGACCUGG 5
L2 UGUGAUUUGG 6
L3 UAUAAUUUGG 7
L4 CCUGACCCAGU 8
L5 GUCUGCACCUGUCACUAG 9

Таблица 3. 3'-Фланкирующие участки для молекулярного остова

Название 3'-фланкирующего участка Последовательность 3'-фланкирующего участка SEQ ID 3'-фланкирующего участка
3F1 AGUGUAUGAUGCCUGUUACUAGCAUUCACAUGGAACAAAUUGCUGCCGUG 10
3F2 CUGAGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 11
3F3 CUGUGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 12
3F4 UGGCCGUGUAGUGCUACCCAGCGCUGGCUGCCUCCUCAGCAUUGCAAUUCCUCUCCCAUCUGGGCACCAGUCAGCUACCCUGGUGGGAAUCUGGGUAGCC 13
3F5 GGCCGUGUAGUGCUACCCAGCGCUGGCUGCCUCCUCAGCAUUGCAAUUCCUCUCCCAUCUGGGCACCAGUCAGCUACCCUGGUGGGAAUCUGGGUAGCC 14
3F6 UCCUGAGGAGCGCCUUGACAGCAGCCAUGGGAGGGCCGCCCCCUACCUCAGUGA 810

Любой из описанных в таблицах 1-3 участков может быть использован в описанных в данном документе молекулярных остовах.

В соответствии с одним вариантом осуществления молекулярный остов может содержать один 5'-фланкирующий участок, приведенный в таблице 1. В качестве неограничивающего примера, молекулярный остов может содержать 5'-фланкирующий участок 5F1, 5F2, 5F3 или 5F4.

В соответствии с одним вариантом осуществления молекулярный остов может содержать один участок петлевого мотива, приведенный в таблице 2. В качестве неограничивающего примера, молекулярный остов может содержать участок петлевого мотива L1, L2, L3, L4 или L5.

В соответствии с одним вариантом осуществления молекулярный остов может содержать один 3'-фланкирующий участок, приведенный в таблице 3. В качестве неограничивающего примера, молекулярный остов может содержать 3'-фланкирующий участок 3F1, 3F2, 3F3, 3F4, 3F5 или 3F6.

В соответствии с одним вариантом осуществления молекулярный остов может содержать по меньшей мере один 5'-фланкирующий участок и по меньшей мере один участок петлевого мотива, которые описаны в таблицах 1 и 2. В качестве неограничивающего примера, молекулярный остов может содержать 5F1 и L1, 5F1 и L2, 5F1 и L3, 5F1 и L4, 5F1 и L5, 5F2 и L1, 5F2 и L2, 5F2 и L3, 5F2 и L4, 5F2 и L5, 5F3 и L1, 5F3 и L2, 5F3 и L3, 5F3 и L4, 5F3 и L5, 5F4 и L1, 5F4 и L2, 5F4 и L3, 5F4 и L4 или 5F4 и L5.

В соответствии с одним вариантом осуществления молекулярный остов может содержать по меньшей мере один 3'-фланкирующий участок и по меньшей мере один участок петлевого мотива, которые описаны в таблицах 2 и 3. В качестве неограничивающего примера, молекулярный остов может содержать 3F1 и L1, 3F1 и L2, 3F1 и L3, 3F1 и L4, 3F1 и L5, 3F2 и L1, 3F2 и L2, 3F2 и L3, 3F2 и L4, 3F2 и L5, 3F3 и L1, 3F3 и L2, 3F3 и L3, 3F3 и L4, 3F3 и L5, 3F4 и L1, 3F4 и L2, 3F4 и L3, 3F4 и L4, 3F4 и L5, 3F5 и L1, 3F5 и L2, 3F5 и L3, 3F5 и L4, 3F5 и L5, 3F6 и L1, 3F6 и L2, 3F6 и L3, 3F6 и L4 или 3F6 и L5.

В соответствии с одним вариантом осуществления молекулярный остов может содержать по меньшей мере один 5'-фланкирующий участок и по меньшей мере один 3'-фланкирующий участок, которые описаны в таблицах 1 и 3. В качестве неограничивающего примера, молекулярный остов может содержать 5F1 и 3F1, 5F1 и 3F2, 5F1 и 3F3, 5F1 и 3F4, 5F1 и 3F5, 5F1 и 3F6, 5F2 и 3F1, 5F2 и 3F2, 5F2 и 3F3, 5F2 и 3F4, 5F2 и 3F5, 5F2 и 3F6, 5F3 и 3F1, 5F3 и 3F2, 5F3 и 3F3, 5F3 и 3F4, 5F3 и 3F5, 5F3 и 3F6, 5F4 и 3F1, 5F4 и 3F2, 5F4 и 3F3, 5F4 и 3F4, 5F4 и 3F5, 5F4 и 3F6.

В соответствии с одним вариантом осуществления молекулярный остов может содержать по меньшей мере один 5'-фланкирующий участок, по меньшей мере один участок петлевого мотива и по меньшей мере один 3'-фланкирующий участок. В качестве неограничивающего примера, молекулярный остов может содержать 5F1, L1 и 3F1; 5F1, L1 и 3F2; 5F1, L1 и 3F3; 5F1, L1 и 3F4; 5F1, L1 и 3F5; 5F1, L1 и 3F6; 5F2, L1 и 3F1; 5F2, L1 и 3F2; 5F2, L1 и 3F3; 5F2, L1 и 3F4; 5F2, L1 и 3F5; 5F2, L1 и 3F6; 5F3, L1 и 3F1; 5F3, L1 и 3F2; 5F3, L1 и 3F3; 5F3, L1 и 3F4; 5F3, L1 и 3F5; 5F3, L1 и 3F6; 5F4, L1 и 3F1; 5F4, L1 и 3F2; 5F4, L1 и 3F3; 5F4, L1 и 3F4; 5F4, L1 и 3F5; 5F4, L1 и 3F6; 5F1, L2 и 3F1; 5F1, L2 и 3F2; 5F1, L2 и 3F3; 5F1, L2 и 3F4; 5F1, L2 и 3F5; 5F1, L2 и 3F6; 5F2, L2 и 3F1; 5F2, L2 и 3F2; 5F2, L2 и 3F3; 5F2, L2 и 3F4; 5F2, L2 и 3F5; 5F2, L2 и 3F6; 5F3, L2 и 3F1; 5F3, L2 и 3F2; 5F3, L2 и 3F3; 5F3, L2 и 3F4; 5F3, L2 и 3F5; 5F3, L2 и 3F6; 5F4, L2 и 3F1; 5F4, L2 и 3F2; 5F4, L2 и 3F3; 5F4, L2 и 3F4; 5F4, L2 и 3F5; 5F4, L2 и 3F6; 5F1, L3 и 3F1; 5F1, L3 и 3F2; 5F1, L3 и 3F3; 5F1, L3 и 3F4; 5F1, L3 и 3F5; 5F1, L3 и 3F6; 5F2, L3 и 3F1; 5F2, L3 и 3F2; 5F2, L3 и 3F3; 5F2, L3 и 3F4; 5F2, L3 и 3F5; 5F2, L3 и 3F6; 5F3, L3 и 3F1; 5F3, L3 и 3F2; 5F3, L3 и 3F3; 5F3, L3 и 3F4; 5F3, L3 и 3F5; 5F3, L3 и 3F6; 5F4, L3 и 3F1; 5F4, L3 и 3F2; 5F4, L3 и 3F3; 5F4, L3 и 3F4; 5F4, L3 и 3F5; 5F4, L3 и 3F6; 5F1, L4 и 3F1; 5F1, L4 и 3F2; 5F1, L4 и 3F3; 5F1, L4 и 3F4; 5F1, L4 и 3F5; 5F1, L4 и 3F6; 5F2, L4 и 3F1; 5F2, L4 и 3F2; 5F2, L4 и 3F3; 5F2, L4 и 3F4; 5F2, L4 и 3F5; 5F2, L4 и 3F6; 5F3, L4 и 3F1; 5F3, L4 и 3F2; 5F3, L4 и 3F3; 5F3, L4 и 3F4; 5F3, L4 и 3F5; 5F3, L4 и 3F6; 5F4, L4 и 3F1; 5F4, L4 и 3F2; 5F4, L4 и 3F3; 5F4, L4 и 3F4; 5F4, L4 и 3F5; 5F4, L4 и 3F6; 5F1, L5 и 3F1; 5F1, L5 и 3F2; 5F1, L5 и 3F3; 5F1, L5 и 3F4; 5F1, L5 и 3F5; 5F1, L5 и 3F6; 5F2, L5 и 3F1; 5F2, L5 и 3F2; 5F2, L5 и 3F3; 5F2, L5 и 3F4; 5F2, L5 и 3F5; 5F2, L5 и 3F6; 5F3, L5 и 3F1; 5F3, L5 и 3F2; 5F3, L5 и 3F3; 5F3, L5 и 3F4; 5F3, L5 и 3F5; 5F3, L5 и 3F6; 5F4, L5 и 3F1; 5F4, L5 и 3F2; 5F4, L5 и 3F3; 5F4, L5 и 3F4; 5F4, L5 и 3F5; или 5F4, L5 и 3F6.

В соответствии с одним вариантом осуществления молекулярный остов может содержать один или более линкеров, известных в данной области техники. Линкеры могут разделять участки или один молекулярный остов от другого. В качестве неограничивающего примера, молекулярный остов может быть полицистронным.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид разработан с использованием по меньшей мере одного из следующих свойств: варианта петель, варианта ошибочно спаренных оснований/вздутий/неоднозначных пар оснований затравочного участка, варианта ошибочно спаренных оснований в участке стебля, варианта петель и варианта основных ошибочно спаренных оснований в участке стебля, варианта ошибочно спаренных оснований затравочного участка и основных ошибочно спаренных оснований в участке стебля, варианта ошибочно спаренных оснований стебля и основных ошибочно спаренных оснований в участке стебля, варианта неоднозначных пар оснований затравочного участка и основных неоднозначных пар оснований в участке стебля, или варианта последовательности стебля.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может располагаться ниже промотора, такого как, без ограничения, промотор CMV, U6, CBA или CBA с интроном SV40. Кроме того, молекулярный остов может может располагаться выше последовательности полиаденилирования. В качестве неограничивающего примера, молекулярный остов может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве неограничивающего примера, молекулярный остов может располагаться в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или более 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования.

В соответствии с одним вариантом осуществления молекулярный остов может располагаться выше последовательности полиаденилирования. Кроме того, молекулярный остов может располагаться ниже промотора, такого как, без ограничения, промотор CMV, U6, CBA или CBA с интроном SV40. В качестве неограничивающего примера, молекулярный остов может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве неограничивающего примера, молекулярный остов может располагаться в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или более 25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования. В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% нуклеотидов ниже промотора и/или выше последовательности полиаденилирования.

В соответствии с одним вариантом осуществления молекулярный остов может располагаться в scAAV.

В соответствии с одним вариантом осуществления молекулярный остов может располагаться в ssAAV.

В соответствии с одним вариантом осуществления молекулярный остов может располагаться возле 5'-конца флип-ITR. В соответствии с другим вариантом осуществления молекулярный остов может располагаться возле 3'-конца флип-ITR. В соответствии с еще одним вариантом осуществления молекулярный остов может располагаться возле 5'-конца флоп-ITR. В соответствии с еще одним вариантом осуществления молекулярный остов может располагаться возле 3'-конца флоп-ITR. В соответствии с одним вариантом осуществления молекулярный остов может располагаться между 5'-концом флип-ITR и 3'-концом флоп-ITR. В соответствии с одним вариантом осуществления молекулярный остов может располагаться между (например, посередине между 5'-концом флип-ITR и 3'-концом флоп-ITR или 3'-концом флоп-ITR и 5'-концом флип-ITR) 3'-концом флип-ITR и 5'-концом флип-ITR. В качестве неограничивающего примера, молекулярный остов может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов ниже 5'- или 3'-конца ITR (например, флип- или флоп-ITR). В качестве неограничивающего примера, молекулярный остов может располагаться в пределах 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 или более 30 нуклеотидов выше 5'- или 3'-конца ITR (например, флип- или флоп-ITR). В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов ниже 5'- или 3'-конца ITR (например, флип- или флоп-ITR). В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 5-10, 5-15, 5-20, 5-25, 5-30, 10-15, 10-20, 10-25, 10-30, 15-20, 15-25, 15-30, 20-25, 20-30 или 25-30 нуклеотидов выше 5'- или 3'-конца ITR (например, флип- или флоп-ITR). В качестве неограничивающего примера, молекулярный остов может располагаться в пределах первых 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% или более 25% нуклеотидов выше 5'- или 3'-конца ITR (например, флип- или флоп-ITR). В качестве другого неограничивающего примера, молекулярный остов может располагаться в пределах первых 1-5%, 1-10%, 1-15%, 1-20%, 1-25%, 5-10%, 5-15%, 5-20%, 5-25%, 10-15%, 10-20%, 10-25%, 15-20%, 15-25% или 20-25% нуклеотидов ниже 5'- или 3'-конца ITR (например, флип- или флоп-ITR).

Вектор экспрессии

В соответствии с одним вариантом осуществления вектор экспрессии (например, AAV-вектор) может содержать по меньшей мере один из модулирующих полинуклеотидов, содержащих по меньшей мере один из описанных в данном документе молекулярных остовов.

В соответствии с одним вариантом осуществления вектор экспрессии может содержать, при перечислении от ITR к ITR в направлении от 5' к 3', ITR, промотор, интрон, модулирующий полинуклеотид, полиA-последовательность и ITR.

Размер генома

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующей описанные в данном документе модулирующие полинуклеотиды, может представлять собой одноцепочечный или двухцепочечный векторный геном. Размер векторного генома может быть небольшим, средним, большим или максимальным. Кроме того, векторный геном может содержать промотор и полиA-хвост.

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в данном документе, может представлять собой небольшой одноцепочечный векторный геном. Небольшой одноцепочечный векторный геном может иметь размер от 2,7 до 3,5 т. о., как например, может иметь размер приблизительно 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3, 3,4 и 3,5 т. о. В качестве неограничивающего примера, небольшой одноцепочечный векторный геном может иметь размер 3,2 т. о. Кроме того, векторный геном может содержать промотор и полиA-хвост.

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в данном документе, может представлять собой небольшой двухцепочечный векторный геном. Небольшой двухцепочечный векторный геном может иметь размер от 1,3 до 1,7 т. о., как например, приблизительно 1,3, 1,4, 1,5, 1,6 и 1,7 т. о. В качестве неограничивающего примера, небольшой двухцепочечный векторный геном может иметь размер 1,6 т. о. Кроме того, векторный геном может содержать промотор и полиA-хвост.

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующей описанные в данном документе модулирующие полинуклеотиды, может представлять собой одноцепочечный векторный геном среднего размера. Средний одноцепочечный векторный геном может иметь размер от 3,6 до 4,3 т. о., как например, может иметь размер приблизительно 3,6, 3,7, 3,8, 3,9, 4,0, 4,1, 4,2 и 4,3 т. о. В качестве неограничивающего примера, средний одноцепочечный векторный геном может иметь размер 4,0 т. о. Кроме того, векторный геном может содержать промотор и полиA-хвост.

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в данном документе, может представлять собой средний двухцепочечный векторный геном. Средний двухцепочечный векторный геном может иметь размер от 1,8 до 2,1 т. о., как например, приблизительно 1,8, 1,9, 2,0 и 2,1 т. о. В качестве неограничивающего примера, средний двухцепочечный векторный геном может иметь размер 2,0 т. о. Кроме того, векторный геном может содержать промотор и полиA-хвост.

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в данном документе, может представлять собой большой одноцепочечный векторный геном. Большой одноцепочечный векторный геном может иметь размер от 4,4 до 6,0 т. о., как например, приблизительно 4,4, 4,5, 4,6, 4,7, 4,8, 4,9, 5,0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9 и 6,0 т. о. В качестве неограничивающего примера, большой одноцепочечный векторный геном может иметь размер 4,7 т. о. В качестве другого неограничивающего примера, большой одноцепочечный векторный геном может иметь размер 4,8 т. о. В качестве еще одного неограничивающего примера, большой одноцепочечный векторный геном может иметь размер 6,0 т. о. Кроме того, векторный геном может содержать промотор и полиA-хвост.

В соответствии с одним вариантом осуществления векторный геном, который содержит последовательность нуклеиновой кислоты, кодирующую модулирующие полинуклеотиды, описанные в данном документе, может представлять собой большой двухцепочечный векторный геном. Большой двухцепочечный векторный геном может иметь размер от 2,2 до 3,0 т. о., как например, может иметь размер приблизительно 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9 и 3,0 т. о. В качестве неограничивающего примера, большой двухцепочечный векторный геном может иметь размер 2,4 т. о. Кроме того, векторный геном может содержать промотор и полиA-хвост.

Промоторы

Специалист в данной области техники может понять, что целевая клетка может требовать специфического промотора, включающего, без ограничения, промотор, который является видоспецифическим, индуцируемым, тканеспецифическим или специфическим в отношении фазы клеточного цикла; Parr et al., Nat. Med.3:1145-9 (1997); содержание которого включено в данный документ во всей своей полноте при помощи ссылки).

В соответствии с одним вариантом осуществления промотор представляет собой промотор, эффективный для полезного груза в модулирующем полинуклеотиде.

В соответствии с одним вариантом осуществления промотор представляет собой промотор, эффективный для клетки, подвергающейся целенаправленному воздействию.

В соответствии с одним вариантом осуществления промотор представляет собой слабый промотор, который обеспечивает экспрессию полезного груза в течение периода времени в целевых тканях, таких как без ограничения тканях нервной системы. Экспрессия может осуществляться в течение периода длительностью 1 час, 2 часа, 3 часа, 4 часа, 5 часов, 6 часов, 7 часов, 8 часов, 9 часов, 10 часов, 11 часов, 12 часов, 13 часов, 14 часов, 15 часов, 16 часов, 17 часов, 18 часов, 19 часов, 20 часов, 21 час, 22 часа, 23 часа, 1 сутки, 2 суток, 3 суток, 4 суток, 5 суток, 6 суток, 1 неделя, 8 суток, 9 суток, 10 суток, 11 суток, 12 суток, 13 суток, 2 недели, 15 суток, 16 суток, 17 суток, 18 суток, 19 суток, 20 суток, 3 недели, 22 суток, 23 суток, 24 суток, 25 суток, 26 суток, 27 суток, 28 суток, 29 суток, 30 суток, 31 суток, 1 месяц, 2 месяца, 3 месяца, 4 месяца, 5 месяцев, 6 месяцев, 7 месяцев, 8 месяцев, 9 месяцев, 10 месяцев, 11 месяцев, 1 год, 13 месяцев, 14 месяцев, 15 месяцев, 16 месяцев, 17 месяцев, 18 месяцев, 19 месяцев, 20 месяцев, 21 месяц, 22 месяца, 23 месяца, 2 года, 3 года, 4 года, 5 лет, 6 лет, 7 лет, 8 лет, 9 лет, 10 лет или более 10 лет. Экспрессия может может осуществляться в течение 1-5 часов, 1-12 часов, 1-2 суток, 1-5 суток, 1-2 недель, 1-3 недель, 1-4 недель, 1-2 месяцев, 1-4 месяцев, 1-6 месяцев, 2-6 месяцев, 3-6 месяцев, 3-9 месяцев, 4-8 месяцев, 6-12 месяцев, 1-2 лет, 1-5 лет, 2-5 лет, 3-6 лет, 3-8 лет, 4-8 лет или 5-10 лет. В качестве неограничивающего примера, промотор представляет собой слабый промотор для устойчивой экспрессии полезного груза в нервных тканях.

В соответствии с одним вариантом осуществления промотор может представлять собой промотор, который имеет длину менее 1 т. о. Промотор может иметь длину 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 или боле 800. Промотор может иметь длину 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 или 700-800.

В соответствии с одним вариантом осуществления промотор может представлять собой комбинацию двух или более компонентов, таких как, без ограничения, CMV и CBA. Каждый компонент может иметь длину 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800 или более 800. Каждый компонент может иметь длину 200-300, 200-400, 200-500, 200-600, 200-700, 200-800, 300-400, 300-500, 300-600, 300-700, 300-800, 400-500, 400-600, 400-700, 400-800, 500-600, 500-700, 500-800, 600-700, 600-800 или 700-800. В качестве неограничивающего примера, промотор представляет собой комбинацию 382-нуклеотидной энхансерной последовательности CMV и 260-нуклеотидной промоторной последовательности CBA.

В соответствии с одним вариантом осуществления векторный геном содержит по меньшей мере один элемент для повышения специфичности трансгена в отношении мишени и усиления экспрессии (см., например, Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; содержание которого включено в данный документ во всей своей полноте при помощи ссылки). Неограничивающие примеры элементов для повышения специфичности трансгена в отношении мишени и усиления экспрессии включают промоторы, эндогенные miRNA, посттранскрипционные регуляторные элементы (PRE), последовательности сигнала полиаденилирования (полиA) и вышележащие энхансеры (USE), энхансеры CMV и интроны.

В соответствии с одним вариантом осуществления векторный геном содержит по меньшей мере один элемент для повышения специфичности трансгена в отношении мишени и усиления экспрессии (см., например, Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; содержание которого включено в данный документ во всей своей полноте при помощи ссылки), такой как промоторы. Промоторы, которые стимулируют экспрессию в большинстве тканей, включают в себя без ограничения промотор 1α-субъединицы фактора элонгации (EF1α) человека, предранний промотор цитомегаловируса (CMV), промотора β-актина курицы (CBA) и его производного CAG, β-глюкуронидазы (GUSB) или убиквитина C (UBC). Для ограничения экспрессии определенными типами клеток можно применять тканеспецифические экспрессионные элементы, такие как, без ограничения, промоторы, специфические в отношении нервной системы, которые можно применять для ограничения экспрессии нейронами, астроцитами или олигодендроцитами. Неограничивающий пример тканеспецифических экспрессионных элементов для нейронов включает промоторы нейрон-специфической енолазы (NSE), фактора роста тромобоцитов (PDGF), B-цепи фактора роста тромбоцитов (PDGF-β), синапсина (Syn), метил-CpG связывающего белка 2 (MeCP2), CaMKII, mGluR2, NFL, NFH, nβ2, PPE, Enk и EAAT2. Неограничивающий пример тканеспецифических экспрессионных элементов для астроцитов включает промоторы глиального фибриллярного кислого белка (GFAP) и EAAT2. Неограничивающим примером тканеспецифического экспрессионного элемента для олигодендроцитов является промотор основного белка миелина (MBP).

В соответствии с одним вариантом осуществления векторный геном содержит убиквитарный промотор. Неограничивающие примеры убиквитарных промоторов включают CMV, CBA (в том числе производные CAG, CBh и т.д.), EF-1α, PGK, UBC, GUSB (hGBp) и UCOE (промотор HNRPA2B1-CBX3). Yu et al. (Molecular Pain 2011, 7:63; содержание которой включено в данный документ в своей полноте посредством ссылки) оценивали экспрессию eGFP под контролем промоторов CAG, EFIα, PGK и UBC в крысиных DRG клетках и первичных DRG клетках с использованием векторов на основе лентивируса, и обнаружили, что UBC показывал более слабую экспрессию, чем 3 других промотора, и для всех промоторов наблюдали экспрессию только в 10-12% глии. Soderblom et al. (E. Neuro 2015; содержание которой включено в данный документ в своей полноте посредством ссылки) исследовали экспрессию eGFP в AAV8 с промоторами CMV и UBC и AAV2 с промотором CMV после инъекции в двигательную кору. Интраназальное введение плазмиды, содержащей промотор UBC или EFIα, показывало устойчивую экспрессию в дыхательных путях, большую, чем экспрессия с промотором CMV (см., например, Gene Therapy 2001, Vol. 8, 1539-1546; содержание которой включено в данный документ во всей своей полноте при помощи ссылки). Husain et al. (Gene Therapy 2009; содержание которой включено в данный документ в своей полноте посредством ссылки) оценивали конструкцию HβH с промотором hGUSB, промотором HSV-1LAT и промотором NSE и выяснили, что конструкция HβH показывала более слабую экспрессию в головном мозге мышей, чем NSE. Passini и Wolfe (J. Virol. 2001, 12382-12392, содержание которой включено в данный документ в своей полноте посредством ссылки) оценивали долговременные эффекты вектора HβH после внутрижелудочковой инъекции у новорожденных мышей и выяснили, что присутствовала устойчивая экспрессия в течение по меньшей мере 1 года. Низкая экспрессия во всех областях головного мозга была обнаружена Xu et al. (Gene Therapy 2001, 8, 1323-1332; содержание которой включено в данный документ в своей полноте посредством ссылки) в случае, когда использовали промоторы NF-L и NF-H в сравнении с CMV-lacZ, CMV-luc, EF, GFAP, hENK, nAChR, PPE, PPE+wpre, NSE (0,3 т. о.), NSE (1,8 т. о.) и NSE (1,8 т. о.+wpre). Xu et al. выяснили, что активность промоторов убывала в следующем порядке: NSE (1,8 т. о.), EF, NSE (0,3 т. о.), GFAP, CMV, hENK, PPE, NFL и NFH. NFL представляет собой 650-нуклеотидный промотор, и NFH представляет собой 920-нуклеотидный промотор, причем оба из них отсутствуют в печени, но NFH распространен в проприоцептивных сенсорных нейронах, головном и спинном мозге, а NFH присутствует в сердце. Scn8a представляет собой 470-нуклеотидный промотор, который экспрессируется везде в DRG, спинном мозге и головном мозге, причем особенно высокая экспрессия наблюдается в нейронах гиппокампа и мозжечковых клетках Пуркинье, коре головного мозга, таламусе и гипоталамусе (см., например, Drews et al. 2007; и Raymond et al. 2004; причем содержание каждой из которых включено в данный документ во всей своей полноте посредством ссылки).

В соответствии с одним вариантом осуществления векторный геном содержит промотор UBC. Промотор UBC может иметь размер 300-350 нуклеотидов. В качестве неограничивающего примера, промотор UBC имеет размер 332 нуклеотида.

В соответствии с одним вариантом осуществления векторный геном содержит промотор GUSB. Промотор GUSB может иметь размер 350-400 нуклеотидов. В качестве неограничивающего примера, промотор GUSB имеет размер 378 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-интрон CMV/глобина-hFXN-RBG, где AAV может быть самокомплементарныим, и AAV может представлять собой серотип DJ.

В соответствии с одним вариантом осуществления, векторный геном содержит промотор NFL. Промотор NFL может иметь размер 600-700 нуклеотидов. В качестве неограничивающего примера, промотор NFL имеет размер 650 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-интрон CMV/глобина-hFXN-RBG, где AAV может быть самокомплементарныим, и AAV может представлять собой серотип DJ.

В соответствии с одним вариантом осуществления векторный геном содержит промотор NFH. Промотор NFH может иметь размер 900-950 нуклеотидов. В качестве неограничивающего примера, промотор NFH имеет размер 920 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-интрон CMV/глобина-hFXN-RBG, где AAV может быть самокомплементарныим, и AAV может представлять собой серотип DJ.

В соответствии с одним вариантом осуществления векторный геном содержит промотор scn8a. Промотор scn8a может иметь размер 450-500 нуклеотидов. В качестве неограничивающего примера, промотор scn8a имеет размер 470 нуклеотидов. В качестве неограничивающего примера, конструкция может представлять собой AAV-промотор-интрон CMV/глобина-hFXN-RBG, где AAV может быть самокомплементарныим, и AAV может представлять собой серотип DJ.

В соответствии с одним вариантом осуществления векторный геном содержит промотор FXN.

В соответствии с одним вариантом осуществления векторный геном содержит промотор PGK.

В соответствии с одним вариантом осуществления векторный геном содержит промотор CBA.

В соответствии с одним вариантом осуществления векторный геном содержит промотор CMV.

В соответствии с одним вариантом осуществления векторный геном содержит промотор, специфичный в отношении печени или скелетных мышц. Неограничивающие примеры промоторов, специфичных в отношении печени, включают hAAT и TBG. Неограничивающие примеры промоторов, специфичных в отношении скелетных мышц, включают десминовый промотор, MCK и C5-12.

В соответствии с одним вариантом осуществления вектор экспрессии содержит энхансерный элемент, промотор и/или 5'UTR интрон. Энхансер может представлять собой, без ограничения, энхансер CMV, промотор может представлять собой, без ограничения, промотор CMV, CBA, UBC, GUSB, NSE, синапсина, MeCP2 и GFAP, и 5'UTR/интрон может представлять собой, без ограничения, SV40 и CBA-MVM. В качестве неограничивающего примера, энхансер, промотор и/или интрон, применяемые в комбинации, могут представлять собой: (1) энхансер CMV, промотор CMV, интрон 5'UTR SV40; (2) энхансер CMV, промотор CBA, интрон 5'UTR SV 40; (3) энхансер CMV, промотор CBA, интрон 5'UTR CBA-MVM; (4) промотор UBC; (5) промотор GUSB; (6) промотор NSE; (7) промотор синапсина; (8) промотор MeCP2 и (9) промотор GFAP.

В соответствии с одним вариантом осуществления вектор экспрессии имеет сконструированный промотор.

Интроны

В соответствии с одним вариантом осуществления векторный геном содержит по меньшей мере один элемент для повышения специфичности трансгена в отношении мишени и усиления экспрессии (см., например, Powell et al. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy, 2015; содержание которой включено в данный документ во всей своей полноте при помощи ссылки), такой как интрон. Неограничивающие примеры интронов включают MVM (67-97 п.о.), F.IX усеченный интрон 1 (300 п.о.), SD β-глобина /акцепторный сайт сплайсинга тяжелой цепи иммуноглобулина (250 п.о.), донорный сайт сплайсинга аденовируса/акцепторный сайт сплайсинга иммуноглобулина (500 п.о.), донорный сайт сплайсинга/акцепторный сайт сплайсинга поздних генов SV40 (19S/16S) (180 п.о.) и донорный сайт сплайсинга гибридного аденовируса/акцепторный сайт сплайсинга IgG (230 п.о.).

В соответствии с одним вариантом осуществления интрон может иметь длину 100-500 нуклеотидов. Интрон может иметь длину 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490 или 500. Промотор может иметь длину 80-100, 80-120, 80-140, 80-160, 80-180, 80-200, 80-250, 80-300, 80-350, 80-400, 80-450, 80-500, 200-300, 200-400, 200-500, 300-400, 300-500 или 400-500.

Введение в клетки

Модулирующие полинуклеотиды согласно настоящему изобретению можно вводить в клетки-хозяева при помощи любого из ряда подходов. Можно осуществить заражение вирусным вектором, содержащим модулирующий полинуклеотид. Примеры подходящих вирусных векторов включают векторы на основе ретровируса с дефектной репликацией, векторы на основе аденовируса, векторы на основе аденоассоциированного вируса и векторы на основе лентивируса.

В соответствии с настоящим изобретением вирусные векторы для применения при лечении и/или диагностике представляют собой вирус, который был очищен или сокращен до минимальных компонентов, необходимых для трансдукции переносимого или полезного груза представляющей интерес нуклеиновой кислоты.

Таким образом, вирусные векторы конструируют в качестве средств для специфической доставки при отсутствии вредных признаков репликации и/или интеграции, обнаруживаемых у вируса дикого типа.

В контексте настоящего описания термин «вектор» означает любую молекулу или фрагмент, который транспортирует, трансдуцирует или иным образом действует как носитель гетерологичной молекулы, такой как модулирующие полинуклеотиды согласно настоящему изобретению. «Вирусный вектор» представляет собой вектор, который содержит один или более полинуклеотидных участков, кодирующих или содержащих представляющие интерес молекулы полезного груза, например, трансген, полинуклеотид, кодирующий полипептид или несколько полипептидов, или модулирующую нуклеиновую кислоту. Вирусные векторы согласно настоящему изобретению могут быть получены рекомбинантными способами и могут иметь в своей основе исходную или эталонную последовательности аденоассоциированного вируса (AAV). Серотипы, которые могут быть пригодны согласно настоящему изобретению, включают любые из берущих начало от AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9.47, AAV9(hu14), AAV10, AAV11, AAV12, AAVrh8, AAVrh10, AAV-DJ и AAV-DJ8.

В соответствии с одним вариантом осуществления серотип, который может быть пригодным в настоящем изобретении, может представлять собой AAV-DJ8. Аминокислотная последовательность AAV-DJ8 может содержать две или более мутации с целью удаления гепарин-связывающего домена (HBD). В качестве неограничивающего примера последовательность AAV-DJ, описанная как SEQ ID NO: 1 в патенте США № 7588772, содержание которого включено в данный документ в его полноте посредством ссылки, может содержать две мутации: (1) R587Q, где аргинин (R; Arg) в положении аминокислоты 587 заменен на глутамин (Q; Gln), и (2) R590T, где аргинин (R; Arg) в положении аминокислоты 590 заменен на треонин (T; Thr). В качестве другого неограничивающего примера может содержать три мутации: (1) K406R, где лизин (K; Lys) в положении аминокислоты 406 заменен на аргинин (R; Arg), (2) R587Q, где аргинин (R; Arg) в положении аминокислоты 587 заменен на глутамин (Q; Gln), и (3) R590T, где аргинин (R; Arg) в положении аминокислоты 590 заменен на треонин (T; Thr).

AAV-векторы также могут содержать векторы на основе самокомплементарного AAV (scAAV). Векторы на основе scAAV содержат обе цепи ДНК, которые комплементарно соединены вместе с образованием двухцепочечной ДНК. За счет пропуска синтеза второй цепи scAAV обеспечивают возможность быстрой экспрессии в клетке.

В соответствии с одним вариантом осуществления AAV-вектор, применяемый в настоящем изобретении, представляет собой scAAV.

В соответствии с одним вариантом осуществления в клетки можно вводить модулирующие полинуклеотиды из любого соответствующего вида, такого как, без ограничения, человек, собака, мышь, крыса или обезьяна.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды можно вводить в клетки, которые имеют отношение к заболеванию, подлежащему лечению. В качестве неограничивающего примера, болезнь представляет собой ALS, и целевые клетки представляют собой двигательные нейроны и астроциты.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды можно вводить в клетки, которые характеризуются высоким уровнем эндогенной экспрессии целевой последовательности.

В соответствии с другим вариантом осуществления модулирующие полинуклеотиды можно вводить в клетки, которые характеризуются низким уровнем эндогенной экспрессии целевой последовательности.

В соответствии с одним вариантом осуществления клетки могут представлять собой клетки, характеризующиеся высокой эффективностью трансдукции AAV.

В соответствии с одним вариантом осуществления клетки, которые могут быть использованы для анализа модулирующих полинуклеотидов in vitro, включают без ограничения HEK293, HeLa, первичные астроциты человека, линию клеток астроцитов человека (U251MG), SH-SY5Y-нейроны и полученные от iPSC предшественники двигательных нейронов.

Целевые нуклеиновые кислоты

Модулирующие полинуклеотиды согласно настоящему изобретению могут быть нацелены на любую конструкцию гена или нуклеиновой кислоты, в том числе кодирующие и некодирующие гены. В качестве целей могут выступать гены (ДНК или мРНК), которые кодируют белки человека или приматов. Кроме того, в качестве целей также могут выступать некодирующие гены, например, длинные некодирующие РНК (lncRNA).

Примеры таких молекул lncRNA и конструкций для RNAi, разработанных для целенаправленного воздействия на такую lncRNA, каждая из которых соответственно может выступать в качестве цели для модулирующих полинуклеотидов или быть закодированной в модулирующих полинуклеотидах, описаны в международной публикации WO2012/018881 A2, содержание которой включено в данный документ во всей своей полноте при помощи ссылки.

В соответствии с одним вариантом осуществления модулирующие полинуклеотиды согласно настоящему изобретению могут целенаправленно воздействовать на любой ген, известный в данной области техники. В качестве неограничивающего примера, геном может быть SOD1.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может целенаправленно воздействовать на последовательность длиной в 15-19 нуклеотидов. В качестве неограничивающего примера, целью может быть любая из последовательностей, описанных в таблице 1. В качестве другого неограничивающего примера, целью могут быть 406-424 нуклеотиды NM_000454.4. В качестве еще одного неограничивающего примера, целью могут быть 645-661 нуклеотиды NM_000454.4.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может быть целенаправленно воздействовать на последовательность длиной в 21 нуклеотид. В соответствии с одним аспектом целью может быть любая последовательность 21 mer NM_000454.4 или любой ген, известный в данной области техники. В качестве неограничивающего примера, целью могут быть 521-541 нуклеотиды NM_000454.4. В качестве другого неограничивающего примера, целью могут быть 639-659 нуклеотиды NM_000454.4. В качестве другого неограничивающего примера, целью могут быть 640-660 нуклеотиды NM_000454.4. В качестве другого неограничивающего примера, целью могут быть 645-665 нуклеотиды NM_000454.4. В качестве другого неограничивающего примера, целью могут быть 664-684 нуклеотиды NM_000454.4.

В соответствии с одним вариантом осуществления модулирующий полинуклеотид может быть разработан для целенаправленного воздействия на любой ген или мРНК в геноме человека, например, гены, ассоциированные с заболеваниями ЦНС, такими как без ограничения хорея Хантингтона, ALS и т. п.

Фармацевтические композиции

Несмотря на то, что описания фармацевтических композиций, например, таких модулирующих полинуклеотидов (включая кодирующие плазмиды или векторы экспрессии, такие как вирусы, например, AAV), которые содержат подлежащий доставке полезный груз, преимущественно направлены на фармацевтические композиции, которые являются подходящими для введения людям, причем специалисту в данной области техники будет понятно, что такие композиции обычно являются подходящими для введения любому другому животному, например, животным, отличным от человека, например, млекопитающим, отличным от человека. Модификация фармацевтических композиций, подходящих для введения людям, для того, чтобы сделать композиции подходящими для введения различным животным, является хорошо понятной, и средний специалист в области ветеринарной фармакологии может разработать и/или выполнить такую модификацию с использованием только стандартного экспериментирования, если оно вообще будет необходимо. Субъекты, для которых предполагается введение фармацевтических композиций, включают, без ограничения, людей и/или других приматов; млекопитающих, в том числе коммерчески значимых млекопитающих, таких как крупный рогатый скот, свиньи, лошади, овцы, кошки, собаки, мыши и/или крысы; и/или птиц, в том числе коммерчески значимых птиц, таких как домашняя птица, куры, утки, гуси и/или индейки.

В соответствии с некоторыми вариантами осуществления композиции вводят людям, пациентам-людям или субъектам-людям. В контексте настоящего раскрытия фраза «активный ингредиент» обычно относится либо к вирусному вектору, несущему полезную груз, либо к молекуле полезного груза, представляющего собой модулирующий полинуклеотид, доставляемый вирусным вектором, который описан в настоящем документе.

Составы фармацевтических композиций, описанных в данном документе, можно получить с помощью любого способа, известного или который будет разработан в будущем в области фармакологии. В целом, такие способы получения включают стадию обеспечения объединения активного ингредиента со вспомогательным веществом и/или одним или более другими дополнительными ингредиентами, а затем, если необходимо и/или желательно, разделение, придание формы и/или упаковку продукта в предпочтительную единицу с однократной дозой или единицу с несколькими дозами.

Относительные количества активного ингредиента, фармацевтически приемлемого вспомогательного вещества и/или любых дополнительных ингредиентов в фармацевтической композиции в соответствии с настоящим изобретением будут варьировать в зависимости от индивидуальных особенностей, размера и/или состояния субъекта, получающего лечение, а также в зависимости от пути, которым следует вводить композицию.

Состав

Модулирующие полинуклеотиды или кодирующие их вирусные векторы можно составить с применением одного или более вспомогательных веществ для (1) повышения стабильности; (2) повышения уровня трансфекции или трансдукции клеток; (3) обеспечения возможности длительного или замедленного высвобождения или (4) изменения биораспределения (например, целенаправленного воздействия вирусного вектора на конкретные ткани или типы клеток).

Составы согласно настоящему изобретению могут включать, без ограничения, солевой раствор, липидоиды, липосомы, липидные наночастицы, полимеры, липоплексы, наночастицы по типу ядро-оболочка, пептиды, белки, клетки, трансфицированные вирусными векторами (например, для трансплантации субъекту), средства, имитирующие наночастицы, и их комбинации. Кроме того, вирусные векторы согласно настоящему изобретению можно составить с применением самособирающихся наночастиц нуклеиновой кислоты.

Составы фармацевтических композиций, описанных в данном документе, можно получить с помощью любого способа, известного или который будет разработан в будущем в области фармакологии. В целом, такие способы получения включают стадию объединения активного ингредиента со вспомогательным веществом и/или одним или более другими дополнительными ингредиентами.

Фармацевтическую композицию в соответствии с настоящим раскрытием можно получить, упаковать и/или реализовать нерасфасованной, в виде единичной стандартной дозы и/или в виде нескольких единичных стандартных доз. В контексте настоящего описания «стандартная доза» относится к дискретному количеству, фармацевтической композиции, содержащей заранее определенное количество активного ингредиента. Количество активного ингредиента обычно равно дозе активного ингредиента, которую можно вводить субъекту, и/или подходящей части такой дозы, такой как, например, половина или треть такой дозы.

Относительные количества активного ингредиента, фармацевтически приемлемого вспомогательного вещества и/или любых дополнительных ингредиентов в фармацевтической композиции в соответствии с настоящим раскрытием могут варьировать в зависимости от индивидуальных особенностей, размера и/или состояния субъекта, получающего лечение, а также в зависимости от пути, которым следует вводить композицию. Например, композиция может содержать от 0,1% до 99% (вес/вес) активного ингредиента. В качестве примера, композиция может содержать от 0,1% до 100%, например, от 0,5 до 50%, 1-30%, 5-80%, по меньшей мере 80% (вес/вес) активного ингредиента.

В соответствии с некоторыми вариантами осуществления описанные в настоящем документе составы могут содержать по меньшей мере одну молекулу полезного груза. В качестве неограничивающего примера составы могут содержать 1, 2, 3, 4 или 5 молекул полезного груза, представляющих собой модулирующий полинуклеотид. В соответствии с одним вариантом осуществления состав может содержать конструкцию полезного груза, представляющего собой модулирующий полинуклеотид, которая целенаправленно воздействует на белки, выбранные из таких категорий, как без ограничения человеческие белки, белки для ветеринарного применения, бактериальные белки, биологические белки, антитела, иммуногенные белки, пептиды и белки для терапевтического применения, секретируемые белки, белки плазматической мембраны, белки цитоплазмы и цитоскелета, белки, связанные с внутриклеточными мембранами, ядерные белки, белки, ассоциированные с заболеваниями человека, и/или белки, ассоциированные с заболеваниями, не относящимися к человеку. В соответствии с одним вариантом осуществления состав содержит по меньшей мере три конструкции полезного груза, целенаправленно воздействующего на белки.

В соответствии с некоторыми вариантами осуществления фармацевтически приемлемое вспомогательное вещество может иметь чистоту по меньшей мере 95%, по меньшей мере 96%, по меньшей мере 97%, по меньшей мере 98%, по меньшей мере 99% или 100%. В соответствии с некоторыми вариантами осуществления вспомогательное вещество одобрено для применения у людей и для применения в ветеринарии. В соответствии с некоторыми вариантами осуществления вспомогательное вещество может быть одобрено Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США. В соответствии с некоторыми вариантами осуществления вспомогательное вещество может иметь фармацевтическую степень чистоты. В соответствии с некоторыми вариантами осуществления вспомогательное вещество может отвечать стандартам Фармакопеи США (USP), Европейской фармакопеи (EP), Британской фармакопеи и/или Международной фармакопеи.

Вспомогательные вещества, которые в контексте данного описания включают, без ограничения, любые и все растворители, дисперсионные среды, разбавители или другие жидкие среды, вспомогательные средства для диспергирования или суспендирования, поверхностно-активные средства, средства для обеспечения изотоничности, загущающие или эмульгирующие средства, консерванты и т.п., которые подходят для конкретной необходимой лекарственной формы. Различные вспомогательные вещества для составления фармацевтических композиций и методики получения композиции известны из уровня техники (см. Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro, Lippincott, Williams & Wilkins, Baltimore, MD, 2006; включенную в данный документ в своей полноте посредством ссылки). Применение традиционной среды для лекарственного средства может предполагаться в объеме настоящего раскрытия, за исключением того случая, когда какая-либо традиционная среда для лекарственного средства может быть несовместима с веществом или его производными, как например, являясь причиной какого-либо нежелательного биологического эффекта или иным образом пагубно взаимодействуя с любым другим компонентом(компонентами) фармацевтической композиции.

Иллюстративные разбавители включают, без ограничения, карбонат кальция, карбонат натрия, фосфат кальция, фосфат дикальция, сульфат кальция, гидрофосфат кальция, фосфат натрия, лактозу, сахарозу, целлюлозу, микрокристаллическую целлюлозу, каолин, маннит, сорбит, инозит, хлорид натрия, сухой крахмал, кукурузный крахмал, сахарную пудру и т.д. и/или их комбинации.

Неактивные компоненты

В соответствии с некоторыми вариантами осуществления составы с модулирующими полинуклеотидами могут содержать по меньшей мере одно вспомогательное вещество, которое является неактивным ингредиентом. В контексте настоящего описания термин «неактивный ингредиент» относится к одному или более неактивным средствам, включенным в составы. В соответствии с некоторыми вариантами осуществления все, ни один или некоторые из неактивных ингредиентов, которые можно применять в составах согласно настоящему изобретению, могут быть одобрены Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA).

Составы с вирусными векторами, несущими раскрытые в настоящем документе модулирующие полинуклеотиды, могут включать в себя катионы или анионы. В соответствии с одним вариантом осуществления составы включают катионы металлов, такие как, без ограничения, Zn2+, Ca2+, Cu2+, Mg+ и их комбинации. В качестве неограничивающего примера составы могут включать в себя полимеры и модулирующие полинуклеотиды в комплексе с катионом металла (см., например, патент США № 6265389 и № 6555525, каждый из которых включен в данный документ во всей своей полноте при помощи ссылки).

Введение

Вирусные векторы, содержащие модулирующие полинуклеотиды согласно настоящему изобретению, можно вводить любым путем, который приведет к терапевтически эффективному результату. Они включают, без ограничения, энтеральное введение (в кишечник), желудочно-кишечное, эпидуральное (в твердую мозговую оболочку), пероральное (через рот), трансдермальное, перидуральное, интрацеребральное (в головной мозг), интрацеребровентрикулярное (в желудочки головного мозга), накожное (нанесение на кожу), интрадермальное (в саму кожу), подкожное (под кожу), интраназальное введение (через нос), внутривенное (в вену), внутривенное струйное, внутривенное капельное, внутриартериальное (в артерию), внутримышечное (в мышцу), внутрисердечное (в сердце), внутрикостную инфузию (в костный мозг), интратекальное введение (в спинномозговой канал), внутрибрюшинное (инфузия или инъекция в брюшную полость), интравезикальную инфузию, интравитреальное введение (через глаз), интракавернозную инъекцию (в патологическую полость), интракавитарное (в сонование полового члена), интравагинальное введение, внутриматочное, экстраамниотическое введение, трансдермальное (диффузия через интактную кожу для системного распространения), трансмукозальное (диффузия через слизистую оболочку), трансвагинальное введение, инсуффляцию (втягивание носом), сублингвальное введение, сублабиальное, введение клизмой, введение в глазных каплях (на конъюнктиву), в ушных каплях, ушное введение (в или через ухо), буккальное (по направлению к щеке), конъюнктивальное введение, кожное, дентальное (в зуб или зубы), электроосмос, эндоцервикальное введение, внутрипазушное, эндотрахеальное, экстракорпоральное введение, гемодиализ, инфильтрацию, введение в интерстициальную ткань, интраабдоминальное введение, интраамниотическое, интраартикулярное, интрабилиарное, интрабронхиальное, интрабурсальное, внутрихрящевое (в хрящ), интракаудальное (в конский хвост), интрацистернальное (в большую мозжечково-мозговую цистерну), внутрироговичное (в роговицу), введение в коронку зуба, интракоронарное (в коронарные артерии), введение в пещеристое тело (в расширяющиеся участки пешеристого тела полового члена), внутридисковое введение (в диск), внутрипротоковое (в проток железы), интрадуоденальное (в двенадцатиперстную кишку), интрадуральное (в или под твердую мозговую оболочку), интраэпидермальное (в эпидермис), внутрипищеводное (в пищевод), внутрижелудочное (в желудок), интрагингивальное введение (в десны), введение в подвздошную кишку (в дистальную часть тонкого кишечника), внутриочаговое введение (введение в очаг или введение непосредственно в локализованный очаг), введение в просвет (в просвет трубки), внутрилимфатическое (в лимфу), интрамедуллярное (в мозговую полость кости), интраменингеальное (в оболочки головного мозга), внутриглазное (в глаз), внутрияичниковое (в яичник), интраперикардиальное (в перикард), интраплевральное (в плевру), внутрипростатное (в предстательную железу), внутрилегочное (в легкие или их бронхи), внутрипазушное (в носовые или окологлазничные пазухи), интраспинальное (в позвоночный столб), внутрисуставное (в синовиальную полость сустава), внутрисухожильное (в сухожилье), интратестикулярное (в яичко), интратекальное (в спинномозговую жидкость на любом уровне цереброспинальной оси), интраторакальное (в грудную клетку), интратубулярное (в канальцы органа), внутриопухолевое (в опухоль), интратимпанальное (в ушную среду), внутрисосудистое (в сосуд или сосуды), внутрижелудочковое введение (в желудочек), ионофорез (с помощью электрического тока, под действием которого ионы растворимых солей мигрируют в ткани тела), промывание (для обмывания или промывания открытых ран или полостей тела), ларингеальное (непосредственно на гортань), назогастральное введение (через нос и в желудок), методику наложения окклюзионной повязки (местный путь введения, при котором область введения затем накрывают повязкой, которая герметизирует область), глазное введение (на наружную поверхность глаза), орофарингеальное (непосредственно в рот и глотку), парентеральное, чрескожное, периартикулярное, перидуральное, периневральное, периодонтальное, ректальное, респираторное (в дыхательные пути посредством пероральной или назальной ингаляции для локального или системного эффекта), ретробульбарное введение (за варолиев мост или за глазное яблоко), введение в мягкие ткани, субарахноидальное введение, субконъюнктивальное, субмукозальное, местное, трансплацентарное (через плаценту или в плаценту), транстрахеальное (через стенку трахеи), транстимпанальное введение (через барабанную полость или в барабанную полость), введение в мочеточник (в мочеточник), уретральное введение (в мочеиспускательный канал), вагинальное введение, каудальную блокаду, диагностику, блокаду нерва, перфузию желчных протоков, перфузию сердца, фотоферез или спинальное введение. В соответствии с конкретными вариантами осуществления композиции можно вводить таким образом, который позволяет им преодолевать гематоэнцефалический барьер, сосудистый барьер или другой эпителиальный барьер. В соответствии с одним вариантом осуществления состав для некоторого пути введения может включать по меньшей мере один неактивный компонент.

Дозировка

Настоящее изобретение относится к способам, предусматривающим введение вирусных векторов и их полезного груза в виде модулирующих полинуклеотидов или комплексов в соответствии с настоящим изобретением нуждающемуся в том субъекту. Фармацевтические, визуализирующие, диагностические или профилактические композиции с вирусными векторами могут быть введены субъекту в любом количестве и любым путем введения, эффективным для предупреждения, лечения, диагностики или визуализации заболевания, нарушения и/или состояния (например, заболевания, нарушения и/или состояния, связанного с нарушением кратковременной памяти). Точное необходимое количество будет варьировать от субъекта к субъекту в зависимости от вида, возраста и общего состояния субъекта, тяжести заболевания, конкретной композиции, способа ее введения, механизма ее действия и т.п. Композиции согласно настоящему изобретению, как правило, составляют в единичной лекарственной форме для облегчения введения и равномерности дозировки. Тем не менее, будет понятно, что общее суточное потребление композиций согласно настоящему изобретению может определяться лечащим врачом по результатам тщательной клинической оценки. Конкретный терапевтически эффективный, профилактически эффективный или соответствующий для визуализации уровень дозы для каждого конкретного пациента будет зависеть от ряда факторов, в том числе от нарушения, подлежащего лечению, и тяжести нарушения; активности конкретного используемого соединения; конкретной используемой композиции; возраста, массы тела, общего состояния здоровья, пола и рациона пациента; времени введения, пути введения, а также скорости выведения из организма используемого полезного груза в виде конкретных модулирующих полинуклеотидов; длительности лечения; лекарственных средств, применяемых в комбинации или совместно с конкретным используемым соединением; и подобных факторов, хорошо известных в области медицины.

В соответствии с некоторыми вариантами осуществления фармацевтические композиции c вирусными векторами согласно настоящему изобретению можно вводить с уровнями дозировки модулирующих полинуклеотидов, достаточными для доставки от приблизительно 0,0001 мг/кг до приблизительно 100 мг/кг, от приблизительно 0,001 мг/кг до приблизительно 0,05 мг/кг, от приблизительно 0,005 мг/кг до приблизительно 0,05 мг/кг, от приблизительно 0,001 мг/кг до приблизительно 0,005 мг/кг, от приблизительно 0,05 мг/кг до приблизительно 0,5 мг/кг, от приблизительно 0,01 мг/кг до приблизительно 50 мг/кг, от приблизительно 0,1 мг/кг до приблизительно 40 мг/кг, от приблизительно 0,5 мг/кг до приблизительно 30 мг/кг, от приблизительно 0,01 мг/кг до приблизительно 10 мг/кг, от приблизительно 0,1 мг/кг до приблизительно 10 мг/кг или от приблизительно 1 мг/кг до приблизительно 25 мг/кг массы тела субъекта в день, один или более раз в день, для получения желаемого терапевтического, диагностического, профилактического или визуального эффекта (см., например, диапазон стандартных доз, описанных в международной публикации № WO2013078199, включенной в данный документ во всей своей полноте при помощи ссылки). Необходимая дозировка модулирующих полинуклеотидов может быть доставлена более одного раза (например, более одного введения в день). В соответствии с определенными вариантами осуществления необходимую дозировку модулирующего полинуклеотида можно доставить с помощью нескольких введений (например, двух, трех, четырех, пяти, шести, семи, восьми, девяти, десяти, одиннадцати, двенадцати, тринадцати, четырнадцати или большего числа введений). Если используют несколько введений, можно применять режимы дозирования с разделением дозы, такие как описанные в данном документе. В контексте настоящего описания «раздельная доза» представляет собой разделение единичной стандартной дозы или общей суточной дозы на две или более доз, например, два или более введений единичной стандартной дозы. В контексте настоящего описания «единичная стандартная доза» представляет собой дозу любого терапевтического средства на основе модулирующего полинуклеотида, вводимого в одной дозе/в одно время/одним путем/через одну точку контакта, т.е. при одном событии введения. В контексте настоящего описания «общая суточная доза» представляет собой количество, которое дают или прописывают на 24 часовой период. Его можно вводить в виде единичной стандартной дозы. В соответствии с одним вариантом осуществления вирусные векторы, содержащие модулирующие полинуклеотиды согласно настоящему изобретению, вводят субъекту раздельными дозами. Их можно составить только в буфере или в составе, описанном в данном документе.

В соответствии с одним вариантом осуществления доставка композиций в соответствии с настоящим изобретением в клетки предусматривает скорость доставки, определяемую выражением [вг/час= мл/час * вг/мл], где вг представляет собой количество вирусных геномов, вг/мл представляет собой концентрацию композиции, и мл/час представляет собой скорость пролонгированной доставки.

В соответствии с одним вариантом осуществления доставка композиций в соответствии с настоящим изобретением в клетки может предусматривать общую концентрацию у субъекта от приблизительно 1×106 вг до приблизительно 1×1016 вг. В соответствии с некоторыми вариантами осуществления доставка может предусматривать концентрацию композиции приблизительно 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 2×1011, 2,1×1011, 2,2×1011, 2,3×1011, 2,4×1011, 2,5×1011, 2,6×1011, 2,7×1011, 2,8×1011, 2,9×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 7,1×1011, 7,2×1011, 7,3×1011, 7,4×1011, 7,5×1011, 7,6×1011, 7,7×1011, 7,8×1011, 7,9×1011, 8×1011, 9×1011, 1×1012, 1,1 x1012, 1,2×1012, 1,3×1012, 1,4×1012, 1,5×1012, 1,6×1012, 1,7×1012, 1,8×1012, 1,9×1012, 2×1012, 3×1012, 4×1012, 4,1×1012, 4,2×1012, 4,3×1012, 4,4×1012, 4,5×1012,4,6×1012, 4,7×1012, 4,8×1012, 4,9×1012, 5×1012, 6×1012, 7×1012, 8×1012, 8,1×1012, 8,2×1012, 8,3×1012, 8,4×1012, 8,5×1012, 8,6×1012, 8,7×1012, 8,8 x1012, 8,9×1012, 9×1012, 1×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6,7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015 или 1×1016 вг/субъект.

В соответствии с одним вариантом осуществления доставка композиций в соответствии с настоящим изобретением в клетки может предусматривать общую концентрацию у субъекта от приблизительно 1×106 вг/кг до приблизительно 1×1016 вг/кг. В соответствии с некоторыми вариантами осуществления доставка может предусматривать концентрацию композиции приблизительно 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 2×1011, 2,1×1011, 2,2×1011, 2,3×1011, 2,4×1011, 2,5×1011, 2,6×1011, 2,7×1011, 2,8×1011, 2,9×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 7,1×1011, 7,2×1011, 7,3×1011, 7,4×1011, 7,5×1011, 7,6×1011, 7,7×1011, 7,8×1011, 7,9×1011, 8×1011, 9×1011, 1×1012, 1,1 x1012, 1,2×1012, 1,3×1012, 1,4×1012, 1,5×1012, 1,6×1012, 1,7×1012, 1,8×1012, 1,9×1012, 2×1012, 3×1012, 4×1012, 4,1×1012, 4,2×1012, 4,3×1012, 4,4×1012, 4,5×1012,4,6×1012, 4,7×1012, 4,8×1012, 4,9×1012, 5×1012, 6×1012, 7×1012, 8×1012, 8,1×1012, 8,2×1012, 8,3×1012, 8,4×1012, 8,5×1012, 8,6×1012, 8,7×1012, 8,8 x1012, 8,9×1012, 9×1012, 1×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6,7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015 или 1×1016 вг/кг.

В соответствии с одним вариантом осуществления можно доставлять от приблизительно 105 до 106 вирусных геномов (единиц) на дозу.

В соответствии с одним вариантом осуществления доставка композиций в соответствии с настоящим изобретением в клетки может предусматривать общую концентрацию от приблизительно 1×106 вг/мл до приблизительно 1×1016 вг/мл. В соответствии с некоторыми вариантами осуществления доставка может предусматривать концентрацию композиции приблизительно 1×106, 2×106, 3×106, 4×106, 5×106, 6×106, 7×106, 8×106, 9×106, 1×107, 2×107, 3×107, 4×107, 5×107, 6×107, 7×107, 8×107, 9×107, 1×108, 2×108, 3×108, 4×108, 5×108, 6×108, 7×108, 8×108, 9×108, 1×109, 2×109, 3×109, 4×109, 5×109, 6×109, 7×109, 8×109, 9×109, 1×1010, 2×1010, 3×1010, 4×1010, 5×1010, 6×1010, 7×1010, 8×1010, 9×1010, 1×1011, 2×1011, 3×1011, 4×1011, 5×1011, 6×1011, 7×1011, 8×1011, 9×1011, 1×1012, 1,1×1012, 1,2×1012, 1,3×1012, 1,4×1012, 1,5×1012, 1,6×1012, 1,7×1012, 1,8×1012, 1,9×1012, 2×1012, 2,1×1012, 2,2×1012, 2,3×1012, 2,4×1012, 2,5×1012, 2,6×1012, 2,7×1012, 2,8×1012, 2,9×1012, 3×1012, 3,1×1012, 3,2×1012, 3,3×1012, 3,4×1012, 3,5×1012, 3,6×1012, 3,7×1012, 3,8×1012, 3,9×1012, 4×1012, 4,1×1012, 4,2×1012, 4,3×1012, 4,4×1012, 4,5×1012, 4,6×1012, 4,7×1012, 4,8×1012, 4,9×1012, 5×1012, 6×1012, 7×1012, 8×1012, 9×1012, 1×1013, 2×1013, 3×1013, 4×1013, 5×1013, 6×1013, 6,7×1013, 7×1013, 8×1013, 9×1013, 1×1014, 2×1014, 3×1014, 4×1014, 5×1014, 6×1014, 7×1014, 8×1014, 9×1014, 1×1015, 2×1015, 3×1015, 4×1015, 5×1015, 6×1015, 7×1015, 8×1015, 9×1015 или 1×1016 вг/мл.

Комбинации

Вирусные векторы, содержащие модулирующий полинуклеотид, можно применять в комбинации с одним или более другими терапевтическими, профилактическими, диагностическими или визуализирующими средствами. Под выражением «в сочетании с» не подразумевается, что средства нужно вводить одновременно и/или составлять для совместной доставки, хотя эти способы доставки находятся в пределах объема настоящего раскрытия. Композиции можно вводить одновременно с одним или более другими необходимыми терапевтическими средствами или медицинскими процедурами, до или после них. В целом, каждое средство будут вводить в дозе и/или по временному графику, определенным для каждого средства. В соответствии с некоторыми вариантами осуществления настоящее раскрытие охватывает доставку фармацевтических, профилактических, диагностических или визуализирующих композиций в комбинации со средствами, которые могут повысить их биодоступность, снизить и/или модифицировать их метаболизм, подавить их выведение из организма и/или модифицировать их распределение в организме.

Доставка

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки вирионов AAV, описанных в Европейской патентной заявке № EP1857552, содержание которой включено в настоящее описание с помощью ссылки в полном ее объеме.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки белков с использованием AAV-векторов, описанных в Европейской патентной заявке № EP2678433, содержание которой включено в настоящее описание с помощью ссылки в полном ее объеме.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки молекул ДНК с использованием AAV-векторов, описанных в патенте США № US 5858351, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки ДНК в кровоток, описанных в патенте США № US 6211163, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки вирионов AAV, описанных в патенте США № US 6325998, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки ДНК в мышечные клетки, описанных в патенте США № US 6335011, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки ДНК в мышечные клетки и ткани, описанных в патенте США № US 6610290, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки ДНК в мышечные клетки, описанных в патенте США № US 7704492, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза в скелетные мышцы, описанных в патенте США № US 7112321, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор можно вводить или доставлять с помощью способов доставки полезного груза в центральную нервную систему, описанных в патенте США № US 7588757, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза, описанных в патенте США № US 8283151, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза для лечения болезни Альцгеймера, описанных в патенте США № US 8318687, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза, описанных в международной патентной публикации № WO2012144446, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза с использованием вектора для доставки глутаматдекарбоксилазы (GAD), описанных в Международной патентной публикации № WO2001089583, содержание которой включено в настоящее описание с помощью ссылки в полном ее объеме.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза, описанных в международной патентной публикации № WO2001096587, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза в мышечную ткань, описанных в международной патентной публикации № WO2002014487, содержание которого включено в данный документ в его полноте посредством ссылки.

В соответствии с одним вариантом осуществления вирусный вектор, содержащий модулирующий полинуклеотид, можно вводить или доставлять с помощью способов доставки полезного груза в нервные клетки, описанных в международной патентной публикации № WO2012057363, содержание которой включено в настоящее описание с помощью ссылки в полном ее объеме.

Фармацевтические композиции с описанными в данном документе вирусными векторами могут быть охарактеризованы с помощью одного или более из биодоступности, терапевтического окна и/или объема распределения.

В соответствии с одним вариантом осуществления можно получить состав с вирусными векторами, содержащими модулирующий полинуклеотид. В качестве неограничивающего примера баричность и/или осмоляльность состава можно оптимизировать для обеспечения оптимального распределения лекарственного средства в центральной нервной системе или в области или компоненте центральной нервной системы.

В соответствии с одним вариантом осуществления вирусные векторы, содержащие модулирующий полинуклеотид, можно доставлять субъекту посредством одного пути введения.

В соответствии с одним вариантом осуществления вирусные векторы, содержащие модулирующий полинуклеотид, можно доставлять субъекту посредством пути введения в несколько мест. Субъекту можно вводить вирусные векторы, содержащие модулирующий полинуклеотид, в 2, 3, 4, 5 или более 5 мест введения.

В соответствии с одним вариантом осуществления субъекту можно вводить вирусные векторы, содержащие модулирующий полинуклеотид, описанный в данном документе, с применением струйной инфузии.

В соответствии с одним вариантом осуществления субъекту можно вводить вирусные векторы, содержащие модулирующий полинуклеотид, описанный в данном документе, с применением длительной доставки в течение периода времени, составляющего минуты, часы или сутки. Скорость инфузии можно изменять в зависимости от субъекта, распределения, состава или другого параметра доставки.

В соответствии с одним вариантом осуществления катетер может быть расположен в более чем одном участке в позвоночнике для доставки в несколько участков. Вирусные векторы, содержащие модулирующий полинуклеотид, можно доставлять посредством продолжительной и/или струйной инфузии. Каждый участок может иметь отличающийся режим дозирования, или один и тот же режим дозирования можно применять для каждого участка доставки. В качестве неограничивающего примера, участки доставки могут находиться в шейной и поясничной области. В качестве другого неограничивающего примера, участки доставки могут находиться в шейной области. В качестве еще одного неограничивающего примера, участки доставки могут находиться в поясничной области.

В соответствии с одним вариантом осуществления субъект может подвергаться анализу в отношении анатомии и патологии позвоночника перед доставкой вирусных векторов, содержащих модулирующий полинуклеотид, описанный в данном документе. В качестве неограничивающего примера, субъект со сколиозом может иметь отличающийся режим дозирования и/или расположение катетера по сравнению с субъектом без сколиоза.

В соответствии с одним вариантом осуществления ориентация позвоночника субъекта в ходе доставки вирусных векторов, содержащих модулирующий полинуклеотид, может быть вертикальной относительно поверхности земли.

В соответствии с другим вариантом осуществления ориентация позвоночника субъекта в ходе доставки вирусных векторов, содержащих модулирующий полинуклеотид, может быть горизонтальной относительно поверхности земли.

В соответствии с одним вариантом осуществления позвоночник субъекта может находиться под углом относительно поверхности земли в ходе доставки субъекту вирусных векторов, содержащих модулирующий полинуклеотид. Угол позвоночника субъекта относительно поверхности земли может составлять по меньшей мере 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 или 180 градусов.

В соответствии с одним вариантом осуществления способ и длительность доставки выбирают для обеспечения свободной трансдукции в спинной мозг. В качестве неограничивающего примера, интратекальную доставку применяют для обеспечения свободной трансдукции по всей длине спинного мозга в рострально-каудальном направлении. В качестве другого неограничивающего примера, инфузии в несколько мест обеспечивают более равномерную трансдукцию по всей длине спинного мозга в рострально-каудальном направлении. В качестве еще одного неограничивающего примера, пролонгированные инфузии обеспечивают более равномерную трансдукцию по всей длине спинного мозга в рострально-каудальном направлении.

Биодоступность

Вирусные векторы, содержащие модулирующий полинуклеотид по настоящему изобретению, при составлении в композиции со средствами для доставки/составления или средами, которые описаны в настоящем документе, могут иметь повышенную биодоступность по сравнению с композициями без средств для доставки, которые описаны в настоящем документе. В контексте настоящего описания термин «биодоступность» относится к системной доступности заданного количества определенного средства, вводимого субъекту. Биодоступность может быть оценена путем измерения площади под кривой (AUC) или максимальной концентрации в сыворотке или плазме (Cmax) неизмененной формы соединения после введения соединения млекопитающему. AUC представляет собой определение площади под кривой, графически представляющей концентрацию соединения в сыворотке или плазме по оси ординат (оси Y) в зависимости от времени по оси абсцисс (оси X). Как правило, AUC для определенного соединения может быть рассчитана при помощи способов, известных специалистам в данной области техники и описанных в G. S. Banker, Modern Pharmaceutics, Drugs and the Pharmaceutical Sciences, v. 72, Marcel Dekker, New York, Inc., 1996, содержание которой включено в данный документ при помощи ссылке во всей своей полноте.

Значения Cmax представляют собой максимальные концентрации соединений, достигаемые в сыворотке или плазме субъекта после введения соединений субъекту. Значения Cmax определенных соединений могут быть измерены при помощи способов, известных специалистам в данной области техники. В контексте настоящего описания выражения «повышение биодоступности» или «улучшение фармакокинетики» относятся к действиям, которые могут повышать системную доступность вирусного вектора согласно настоящему изобретению (по результатам измерения по AUC, Cmax или Cmin) у субъекта. В соответствии с некоторыми вариантами осуществления такие действия могут предусматривать совместное введение с одним или более средствами для доставки, которые описаны в данном документе. В соответствии с некоторыми вариантами осуществления биодоступность вирусных векторов может повышаться по меньшей мере приблизительно на 2%, по меньшей мере приблизительно на 5%, по меньшей мере приблизительно на 10%, по меньшей мере приблизительно на 15%, по меньшей мере приблизительно на 20%, по меньшей мере приблизительно на 25%, по меньшей мере приблизительно на 30%, по меньшей мере приблизительно на 35%, по меньшей мере приблизительно на 40%, по меньшей мере приблизительно на 45%, по меньшей мере приблизительно на 50%, по меньшей мере приблизительно на 55%, по меньшей мере приблизительно на 60%, по меньшей мере приблизительно на 65%, по меньшей мере приблизительно на 70%, по меньшей мере приблизительно на 75%, по меньшей мере приблизительно на 80%, по меньшей мере приблизительно на 85%, по меньшей мере приблизительно на 90%, по меньшей мере приблизительно на 95% или приблизительно на 100%.

Терапевтическое окно

Вирусные векторы, содержащие модулирующий полинуклеотид по настоящему изобретению, при составлении с одним или более средствами для доставки, которые описаны в настоящем документе, могут характеризоваться увеличением терапевтического окна введения соединения и/или композиции по сравнению с терапевтическим окном вирусных векторов, вводимых без одного или более средств для доставки, которые описаны в настоящем документе. В контексте настоящего описания термин «терапевтическое окно» относится к диапазону концентраций в плазме или диапазону уровней терапевтически активного вещества в месте действия с высокой вероятностью получения терапевтического эффекта. В соответствии с некоторыми вариантами осуществления терапевтические окна вирусных векторов при введении в составе могут повышаться по меньшей мере приблизительно на 2%, по меньшей мере приблизительно на 5%, по меньшей мере приблизительно на 10%, по меньшей мере приблизительно на 15%, по меньшей мере приблизительно на 20%, по меньшей мере приблизительно на 25%, по меньшей мере приблизительно на 30%, по меньшей мере приблизительно на 35%, по меньшей мере приблизительно на 40%, по меньшей мере приблизительно на 45%, по меньшей мере приблизительно на 50%, по меньшей мере приблизительно на 55%, по меньшей мере приблизительно на 60%, по меньшей мере приблизительно на 65%, по меньшей мере приблизительно на 70%, по меньшей мере приблизительно на 75%, по меньшей мере приблизительно на 80%, по меньшей мере приблизительно на 85%, по меньшей мере приблизительно на 90%, по меньшей мере приблизительно на 95% или приблизительно на 100%.

Объем распределения

Вирусные векторы, содержащие модулирующий полинуклеотид по настоящему изобретению, при составлении с одним или более средствами для доставки, которые описаны в настоящем документе, могут характеризоваться улучшенным объемом распределения (Vраспр.), например, сниженным или направленным, относительно составов без одного или более средств для доставки, которые описаны в настоящем документе. Vраспр. относится к количеству средства в организме по отношению к концентрации того же самого средства в крови или плазме. В контексте настоящего описания термин «объем распределения» относится к объему жидкости, которое потребовалось бы для содержания всего количества средства в организме в такой же концентрации, что и в крови и в плазме: Vраспр. равняется количеству средства в организме/концентрации средства в крови или плазме. Например, для дозы 10 мг заданного средства и концентрации в плазме 10 мг/л объем распределения составил бы 1 литр. Объем распределения отражает степень, в которой средство присутствует во внесосудистой ткани. Большие объемы распределения отражают тенденцию средств связываться с тканевыми компонентами, а не с белками плазмы. В клинических условиях Vраспр. может быть использован для определения нагрузочных доз для достижения концентраций в равновесном состоянии. В соответствии с некоторыми вариантами осуществления объемы распределения композиций с вирусными векторами по настоящему изобретению при совместном введении с одним или более средствами доставки, которые описаны в данном документе, могут снижатьсяпо меньшей мере приблизительно на 2%, по меньшей мере приблизительно на 5%, по меньшей мере приблизительно на 10%, по меньшей мере приблизительно на 15%, по меньшей мере приблизительно на 20%, по меньшей мере приблизительно на 25%, по меньшей мере приблизительно на 30%, по меньшей мере приблизительно на 35%, по меньшей мере приблизительно на 40%, по меньшей мере приблизительно на 45%, по меньшей мере приблизительно на 50%, по меньшей мере приблизительно на 55%, по меньшей мере приблизительно на 60%, по меньшей мере приблизительно на 65%, по меньшей мере приблизительно на 70%.

Наборы и устройства

Настоящее изобретение предлагает ряд наборов для удобного и/или эффективного осуществления способов по настоящему изобретению. Как правило, наборы будут содержать достаточные количества и/или числа компонентов, с тем чтобы позволить пользователю осуществить несколько процедур обработки субъекта(субъектов) и/или провести несколько экспериментов.

В состав набора можно включить любой из векторов, конструкций, модулирующих полинуклеотидов, полинуклеотидов или полипептидов по настоящему изобретению. В соответствии с некоторыми вариантами осуществления наборы могут дополнительно включать реагенты и/или инструкции для получения и/или синтеза соединений и/или композиций по настоящему изобретению. В соответствии с некоторыми вариантами осуществления наборы также могут включать один или более буферов. В соответствии с некоторыми вариантами осуществления наборы по настоящему изобретению могут включать компоненты для получения массивов или библиотек белков или нуклеиновых кислот и, таким образом, могут включать, например, твердые подложки.

В соответствии с некоторыми вариантами осуществления компоненты наборов могут быть упакованы либо в водных средах, либо в лиофилизированной форме. Емкость в наборе обычно будет включать по меньшей мере одну ампулу, пробирку, колбу, бутылку, шприц или другую емкость, в которую можно поместить компонент и предпочтительно в виде соответствующей аликвоты. В случае, если в наборе присутствует более одного компонента (метящий реагент и метка могут быть упакованы вместе), наборы, как правило, также могут содержать вторые, третьи или другие дополнительные емкости, в которые могут быть отдельно помещены дополнительные компоненты. В соответствии с некоторыми вариантами осуществления наборы также могут содержать вторую емкость для хранения стерильных фармацевтически приемлемых буферов и/или других разбавителей. В соответствии с некоторыми вариантами осуществления в одной или более ампулах могут содержаться различные комбинации компонентов. Наборы по настоящему изобретению также обычно могут включать средства хранения соединений и/или композиций по настоящему изобретению, например, емкости для белков, нуклеиновых кислот и любых других реагентов исключительно для коммерческой продажи. Такие емкости могут включать емкости для инъекций или пластиковые емкости, полученные методом выдувания, в которых хранятся необходимые ампулы.

В соответствии с некоторыми вариантами осуществления компоненты наборов представлены в одном и/или более жидких растворах. В соответствии с некоторыми вариантами осуществления жидкими растворами являются водные растворы, при этом стерильные водные растворы являются особенно предпочтительными. В соответствии с некоторыми вариантами осуществления компоненты наборов могут быть представлены в виде сухого(сухих) порошка(порошков). Если реагенты и/или компоненты представлены в виде сухих порошков, то такие сухие порошки могут быть разведены при добавлении подходящих объемов растворителя. В соответствии с некоторыми вариантами осуществления предполагается, что растворители также могут быть представлены в другой емкости. В соответствии с некоторыми вариантами осуществления метящие красители представлены в виде сухих порошков. В соответствии с некоторыми вариантами осуществления предполагается, что 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 микрограмм или по меньшей мере или по большей мере эти количества сухого красителя представлены в наборах по настоящему изобретению. В соответствии с такими вариантами осуществления краситель может также быть ресуспендирован в любом подходящем растворителе, таком как DMSO.

В соответствии с некоторыми вариантами осуществления наборы могут включать инструкции для использования компонентов наборов, а также применения любого другого реагента, не включенного в набор. Инструкции могут включать вариации, которые могут быть осуществляться.

Устройства

В соответствии с некоторыми вариантами осуществления соединения и/или композиции по настоящему изобретению могут быть комбинированы с устройством, нанесены на устройство или включены в устройство. Изделия могут включать без ограничения зубные импланты, стенты, остеозаместители, искусственные суставы, клапаны, кардиостимуляторы и/или другое имплантируемое терапевтическое устройство.

Настоящее изобретение относится к устройствам, которые могут содержать вирусные векторы, которые кодируют одну или более молекул полезного груза, представляющих собой модулирующий полинуклеотид. Эти изделия содержат в стабильном составе вирусные векторы, которые могут быть незамедлительно доставлены нуждающемуся в том субъекту, такому как пациент-человек.

Устройства для введения можно использовать для доставки вирусных векторов, содержащих модулирующий полинуклеотид по настоящему изобретению, согласно режиму однократного, множественного или разделенного дозирования, который раскрыт в настоящем документе.

Предусмотрены способы и устройства, известные в данной области техники для многократного введения в клетки, органы и ткани для применения в сочетании со способами и композициями, раскрытыми в данном документе в виде вариантов осуществления настоящего изобретения. В их число входят, например, такие способы и устройства, в которых предусмотрено использование нескольких игл, гибридные устройства с использованием, например, полостей или катетеров, а также устройства с использованием механизмов, работающих от источников тепла, электрического тока или излучения.

Модулирующие полинуклеотиды по настоящему изобретению можно применять для лечения, профилактики или облегчения любого заболевания или нарушения, характеризующегося аберрантной или нежелательной экспрессией целевой последовательности.

ОПРЕДЕЛЕНИЯ

В различных местах настоящего описания заменители соединений по настоящему раскрытию раскрыты в группах или в диапазонах. В частности предполагается, что настоящее раскрытие включает в себя все без исключения отдельные подкомбинации членов таких групп и диапазонов.

Приблизительно: в контексте настоящего описания термин «приблизительно» означает +/- 10% от указанного значения.

Вводимый в комбинации: в контексте настоящего описания термин «вводимый в комбинации» или «комбинированное введение» означает, что два или более средства вводят субъекту в одно и то же время или в пределах такого интервала, чтобы могло иметь место перекрытие эффекта от каждого средства на пациента. В соответствии с некоторыми вариантами осуществления их вводят в пределах приблизительно 60, 30, 15, 10, 5 или 1 минуты друг от друга. В соответствии с некоторыми вариантами осуществления интервал между введением средств очень незначителен, поэтому достигается комбинаторный (например, синергический) эффект.

Животное: в контексте настоящего описания термин «животное» относится к любому представителю царства животных. В соответствии с некоторыми вариантами осуществления «животное» относится к людям на любой стадии развития. В соответствии с некоторыми вариантами осуществления «животное» относится к отличным от человека животным на любой стадии развития. В соответствии с определенными вариантами осуществления отличным от человека животным человека является млекопитающее (например, грызун, мышь, крыса, кролик, обезьяна, собака, кошка, овца, крупный рогатый скот, примат или свинья). В соответствии с некоторыми вариантами осуществления животные включают без ограничения млекопитающих, птиц, рептилий, амфибий, рыб и червей. В соответствии с некоторыми вариантами осуществления животным является трансгенное животное, животное, полученное методами генной инженерии, или клон.

Примерно: в контексте настоящего описания термин «примерно» или «приблизительно», применительно к одному или более представляющим интерес значениям, относится к значению, которое является схожим с приведенным эталонным значением. В соответствии с определенными вариантами осуществления термин «примерно» или «приблизительно» относится к диапазону значений, которые находятся в пределах 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% или менее в любом направлении (больше или меньше) от указанного референтного значения, если только не указано иное или не очевидно иное из контекста (кроме случаев, когда такое число превышало бы 100% от возможного значения).

Ассоциированный с: в контексте настоящего описания термины «ассоциированный с», «конъюгированный», «соединенный», «прикрепленный» и «связанный», при использовании в отношении двух или более фрагментов, означают, что фрагменты физически ассоциированы или соединены друг с другом, либо непосредственно, либо посредством одного или более дополнительных фрагментов, которые служат связывающим средством, с образованием структуры, которая является достаточно стабильной, чтобы фрагменты оставались физически ассоциированными в условиях использования структуры, например, физиологических условиях. «Ассоциация» не обязательно должна осуществляться при помощи прямой ковалентной химической связи. Она может также предполагать ионную или водородную связь или гибридизацию на основе связности, достаточно стабильной для того, чтобы «ассоциированные» молекулярные частицы оставались физически ассоциированными.

Бифункциональный: в контексте настоящего описания термин «бифункциональный» относится к любому веществу, молекуле или фрагменту, который способен к поддержанию или поддерживает по меньшей мере две функции. Функции могут затрагивать один и тот же результат или различный результат. Структура, которая выполняет такую функцию, может быть одной и той же или различной.

Биосовместимый: в контексте настоящего описания термин «биосовместимый» означает совместимый с живыми клетками, тканями, органами или системами, представляя незначительный риск или не представляя риска повреждения, токсичности или отторжения со стороны иммунной системы.

Биоразрушаемый: в контексте настоящего описания термин «биоразрушаемый» означает способный к разрушению на безвредные продукты под действием живых организмов.

Биологически активный: в контексте настоящего описания термин «биологически активный» относится к характеристике любого вещества, которое обладает активностью в биологической системе и/или организме. Например, вещество, которое при введении в организм обладает биологическим эффектом на этот организм, считают биологически активным. В соответствии с конкретными вариантами осуществления модулирующий полинуклеотид по настоящему изобретению можно считать биологически активным, если хотя бы часть полинуклеотидов является биологически активными или имитируют активность, которая считается биологически релевантной.

Индуцированные плюрипотентные стволовые клетки: в контексте настоящего описания «индуцированными плюрипотентными стволовыми клетками» являются клетки, которые могут быть индуцированы к образованию любого из нескольких отдельных типов клеток.

Соединение: в контексте настоящего описания термин «соединение» понимают как включающий все стереоизомеры, геометрические изомеры, таутомеры и изотопы представленных структур.

Соединения, описанные в данном документе, могут быть асимметричными (например, с одним или более стереоцентров). Подразумеваются все стереоизомеры, такие как энантиомеры и диастереомеры, если не указано иное. Соединения по настоящему раскрытию, которые содержат асимметрически замещенные атомы углерода, могут быть выделены в оптически активных или рацемических формах. Из уровня техники известны способы получения оптически активных форм из оптически активных исходных материалов, такие как разделение рацемических смесей или стереоселективный синтез. Многие геометрические изомеры олефинов, C=N двойных связей и подобного также могут присутствовать в описанных в данном документе соединениях, и в настоящем раскрытии предусматриваются все такие стабильные изомеры. Цис- и транс-геометрические изомеры соединений по настоящему раскрытию описаны и могут быть выделены в виде смеси изомеров или в виде разделенных изомерных форм.

Соединения по настоящему раскрытию также включают таутомерные формы. Таутомерные формы образуются в результате обмена одинарной связи на соседнюю двойную связь и сопутствующей миграции протона. Таутомерные формы включают прототропные таутомеры, которые представляют собой изомерные протонированные состояния с той же эмпирической формулой и суммарным зарядом.

Соединения по настоящему раскрытию также включают все изотопы атомов, встречающихся в промежуточных или конечных соединениях. Выражение «изотопы» относится к атомам с одним атомным числом, но другими массовыми числами, образующимся из различного числа нейтронов в ядрах. Например, изотопы водорода включают тритий и дейтерий.

Соединения и соли по настоящему раскрытию могут быть получены при помощи стандартных способов в комбинации с молекулами растворителей или воды с образованием сольватов и гидратов.

Консервативный: в контексте настоящего описания термин «консервативный» относится к нуклеотидам или аминокислотным остаткам соответственно полинуклеотидной последовательности или полипептидной последовательности, которые встречаются неизмененными в одном и том же положении у двух или более сравниваемых последовательностей. Нуклеотиды или аминокислоты, которые являются сравнительно консервативными, представляют собой такие, которые консервативны в более родственных последовательностях по сравнению с нуклеотидами или аминокислотами, встречающимися в других местах в последовательностях.

В соответствии с некоторыми вариантами осуществления две или более последовательностей являются «полностью консервативными», если они на 100% идентичны друг другу. В соответствии с некоторыми вариантами осуществления две или более последовательностей являются «высококонсервативными», если они по меньшей мере на 70% идентичны, по меньшей мере на 80% идентичны, по меньшей мере на 90% идентичны или по меньшей мере на 95% идентичны друг другу. В соответствии с некоторыми вариантами осуществления две или более последовательностей являются «высококонсервативными», если они приблизительно на 70% идентичны, приблизительно на 80% идентичны, приблизительно на 90% идентичны, приблизительно на 95% идентичны, приблизительно на 98% идентичны или приблизительно на 99% идентичны друг другу. В соответствии с некоторыми вариантами осуществления две или более последовательностей являются «консервативными», если они по меньшей мере на 30% идентичны, по меньшей мере на 40% идентичны, по меньшей мере на 50% идентичны, по меньшей мере на 60% идентичны, по меньшей мере на 70% идентичны, по меньшей мере на 80% идентичны, по меньшей мере на 90% идентичны или по меньшей мере на 95% идентичны друг другу. В соответствии с некоторыми вариантами осуществления две или более последовательности являются «консервативными», если они по меньшей мере на 30% идентичны, по меньшей мере на 40% идентичны, по меньшей мере на 50% идентичны, по меньшей мере на 60% идентичны, по меньшей мере на 70% идентичны, по меньшей мере на 80% идентичны, по меньшей мере на 90% идентичны или по меньшей мере на 95% идентичны, по меньшей мере на 98% идентичны или по меньшей мере на 99% идентичны друг другу. Консервативность последовательности может быть применима ко всей длине полинуклеотида или полипептида или может быть применима к его части, участку или элементу.

Контролированное высвобождение: в контексте настоящего описания термин «контролируемое высвобождение» относится к профилю высвобождения фармацевтической композиции или соединения, который соответствует определенному типу высвобождения с целью оказания терапевтического результата.

Циклический или циклизированный: в контексте настоящего описания термин «циклический» относится к наличию непрерывного цикла. Циклические молекулы не обязательно должны быть круговыми, а лишь соединены с образованием неразрывной цепи субъединиц.

Цитостатический: в контексте настоящего описания «цитостатический» относится к ингибированию, уменьшению, подавлению роста, деления или размножения клетки (например, клетки млекопитающего (например, клетки человека)), бактерии, вируса, гриба, простейшего, паразита, приона или их комбинации.

Цитотоксический: в контексте настоящего описания «цитотоксический» относится к уничтожению или оказанию повреждающего, токсического или летального эффекта в отношении клетки (например, клетки млекопитающего (например, клетки человека)), бактерии, вируса, гриба, простейшего, паразита, приона или их комбинации.

Доставка: в контексте настоящего описания термин «доставка» относится к процессу или способу доставки соединения, вещества, молекулярной частицы, переносимого или полезного груза.

Средство доставки: в контексте настоящего описания «средство доставки» относится к любому веществу, которое облегчает, по меньшей мере частично, доставку in vivo модулирующего полинуклеотида к целевым клеткам.

Дестабилизированный: в контексте настоящего описания термин «дестабилизированный», «дестабилизировать» или «дестабилизирующий участок» означает участок или молекулу, которая является менее стабильной, чем исходная, дикого типа или нативная форма того же участка или молекулы.

Детектируемая метка: в контексте настоящего описания термин «детектируемая метка» относится к одному или более маркерам, сигналам или фрагментам, которые присоединены, включены или ассоциированы с другой молекулярной частицей, которая легко детектируется известными в настоящей области техники способами, включая радиографию, флуоресценцию, хемилюминесценцию, ферментативную активность, абсорбционную детекцию и т. п. Детектируемые метки включают радиоизотопы, флуорофоры, хромофоры, ферменты, красители, ионы металла, лиганды, такие как биотин, авидин, стрептавидин и гаптены, квантовые точки и т. п. Детектируемые метки могут быть иметь любое расположение в раскрываемых в данном документе пептидах или белках. Они могут находиться среди аминокислот, пептидов или белков или быть расположенными на N- или С-конце.

Диастереомер: в контексте настоящего описания термин «диастереомер» означает стереоизомеры, которые не являются зеркальными отображениями друг друга и не совпадают при наложении друг на друга.

Расщеплять: в контексте настоящего описания термин «расщеплять» означает разъединять на более мелкие части или компоненты. По отношению к полипептидам или белкам расщепление приводит к образованию пептидов.

Дистальный: в контексте настоящего описания термин «дистальный» означает расположенный по направлению от центра или по направлению от представляющей интерес точки или участка.

Режим дозирования: в контексте настоящего описания «режим дозирования» представляет собой график введения или определенный врачом режим лечения, профилактики или паллиативной терапии.

Энантиомер: в контексте настоящего описания термин «энантиомер» означает отдельно взятую оптически активную форму соединения по настоящему изобретению, характеризующуюся оптической чистотой или энантиомерным избытком (которые определяют при помощи способов, стандартных в данной области техники) по меньшей мере 80% (т. е. по меньшей мере 90% одного энантиомера и по большей мере 10% другого энантиомера), предпочтительно по меньшей мере 90% и более предпочтительно по меньшей мере 98%.

Инкапсулировать: в контексте настоящего описания термин «инкапсулировать» означает включать, окружать или заключать.

Сконструированный: в контексте настоящего описания варианты осуществления настоящего изобретения характеризуют как «сконструированные», если они разработаны такими, чтобы имели признак и свойство, либо структурное, либо химическое, которое отличается от такового у первоначальной, дикого типа или нативной молекулы.

Эффективное количество: в контексте настоящего описания термин «эффективное количество» средств представляет собой такое количество, которое достаточно для обеспечения полезных или желаемых результатов, например, клинических результатов, и само по себе «эффективное количество» зависит от контекста, в котором это выражение употребляется. Например, в контексте введения средства, которое обеспечивает лечение злокачественной опухоли, эффективное количество средства представляет собой, например, количество, достаточное для осуществления лечения злокачественной опухоли, которое определено в данном документе, по сравнению с ответом, полученным без введения средства.

Экзосом: в контексте настоящего описания «экзосом» представляет собой пузырек, секретируемый клетками млекопитающих, или комплекс, участвующий в разрушении РНК.

Экспрессия: в контексте настоящего описания «экспрессия» последовательности нуклеиновой кислоты относится к одному или более из следующих событий: (1) производству матрицы РНК с последовательности ДНК (например, путем транскрипции); (2) процессингу РНК-транскрипта (например, путем сплайсинга, редактирования, образование 5′-кэпа и/или процессинга 3′-конца); (3) трансляции РНК в полипептид или белок; и (4) посттрансляционной модификации полипептида или белка.

Признак: в контексте настоящего описания «признак» относится к характеристике, свойству или отличительному элементу.

Состав: в контексте настоящего описания «состав» включает по меньшей мере один модулирующий полинуклеотид и средство доставки.

Фрагмент: «фрагмент», в контексте настоящего описания, означает часть. Например, фрагменты белков могут представлять собой полипептиды, полученные при расщеплении полноразмерного белка, выделенного из культивируемых клеток.

Функциональный: в контексте настоящего описания «функциональная» биологическая молекула представляет собой биологическую молекулу в форме, в которой она проявляет свойство и/или активность, которыми она характеризуется.

Гомология: в контексте настоящего описания термин «гомология» относится к общему родству между полимерными молекулами, например, между молекулами нуклеиновых кислот (например, молекулами ДНК и/или молекулами РНК) и/или между полипептидными молекулами. В соответствии с некоторыми вариантами осуществления полимерные молекулы считаются «гомологичными» друг другу, если их последовательности являются по меньшей мере на 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% или 99% идентичными или схожими. Выражение «гомологичный» обязательно относится к сравнению между по меньшей мере двумя последовательностями (полинуклеотидными или полипептидными последовательностями). В соответствии с настоящим изобретением две полинуклеотидные последовательности считаются гомологичными, если полипептиды, которые они кодируют, по меньшей мере на 50%, 60%, 70%, 80%, 90%, 95% или даже 99% идентичны по меньшей мере на одном отрезке по меньшей мере из приблизительно 20 аминокислот. В соответствии с некоторыми вариантами осуществления гомологичные полинуклеотидные последовательности характеризуются способностью кодировать отрезок, содержащий по меньшей мере 4-5 однозначно указанных аминокислот. Для полинуклеотидных последовательностей длиной менее 60 нуклеотидов гомология определяется способностью кодировать отрезок, содержащий по меньшей мере 4-5 однозначно указанных аминокислот. В соответствии с настоящим изобретением две белковые последовательности считаются гомологичными, если белки по меньшей мере на 50%, 60%, 70%, 80% или 90% идентичны по меньшей мере на одном отрезке по меньшей мере из приблизительно 20 аминокислот.

Идентичность: в контексте настоящего описания термин «идентичность» относится к общему родству между полимерными молекулами, например, между полинуклеотидными молекулами (например, молекулами ДНК и/или молекулами РНК) и/или между полипептидными молекулами. Расчет процента идентичности двух полинуклеотидных последовательностей, например, можно осуществить путем выравнивания двух последовательностей в контексте оптимального сравнения (например, можно внести гэпы в одну или обе из первой и второй последовательности нуклеиновых кислот для оптимального выравнивания, а неидентичные последовательности в контексте сравнения можно не учитывать). В соответствии с определенными вариантами осуществления длина выравниваемой последовательности для сравнения составляет по меньшей мере 30%, по меньшей мере 40%, по меньшей мере 50%, по меньшей мере 60%, по меньшей мере 70%, по меньшей мере 80%, по меньшей мере 90%, по меньшей мере 95% или по меньшей мере 100% от длины эталонной последовательности. Затем сравнивают нуклеотиды в соответствующих нуклеотидных положениях. Если положение в первой последовательности занято тем же самым нуклеотидом, что и соответствующее положение во второй последовательности, то молекулы являются идентичными по этому положению. Процент идентичности между двумя последовательностями представляет собой зависимость числа идентичных положений, общих для последовательностей, с учетом числа гэпов и длины каждого гэпа, который необходим для введения с целью оптимального выравнивания двух последовательностей. Сравнение последовательностей и определение процента идентичности между двумя последовательностями может быть выполнено при помощи математического алгоритма. Например, процент идентичности между двумя нуклеотидными последовательностями можно определить с помощью способов, таких как описанные в работах Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; и Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; каждая из которых включена в данный документ при помощи ссылки. Например, процент идентичности между двумя нуклеотидными последовательностями можно определить с помощью алгоритма Майера и Миллера (CABIOS, 1989, 4:11-17), который был включен в программу ALIGN (версия 2.0) с использованием матрицы вероятности мутаций PAM120, штрафа за удлинение гэпа 12 и штрафа за открытие гэпа 4. Процент идентичности между двумя нуклеотидными последовательностями альтернативно можно определить с помощью программы GAP в пакете компьютерной программы GCG с использованием матрицы NWSgapdna.CMP. Способы, широко используемые для определения процента идентичности между последовательностями, включают без ограничения описанные в работе Carillo, H., and Lipman, D., SIAM J Applied Math., 48:1073 (1988); включенной в данный документ при помощи ссылки. Методики определения идентичности закодированы в общедоступных компьютерных программах. Иллюстративные компьютерные программы для определения гомологии между двумя последовательностями включают без ограничения программный пакет GCG, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN и FASTA (Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).

Ингибировать экспрессию гена: в контексте настоящего описания фраза «ингибировать экспрессию гена» означает, что это приводит к снижению количества продукта экспрессии гена. Продукт экспрессии может представлять собой РНК, транскрибируемую с гена (например, мРНК), или полипептид, транслируемый с мРНК, которая транскрибируется с гена. Как правило, снижение уровня мРНК приводит в результате к снижению уровня полипептида, транслируемого с нее. Уровень экспрессии можно определить с применением стандартных методик для измерения уровня мРНК или белка.

Изомер: в контексте настоящего описания термин «изомер» означает таутомер, стереоизомер, энантиомер или диастереомер любого соединения по настоящему изобретению. Понятно, что соединения по настоящему изобретению могут иметь один или более хиральных центров и/или двойных связей и, таким образом, существовать в виде стереоизомеров, таких как изомеры с двойными связями (т. е. геометрические E/Z изомеры) или диастереомеры (например, энантиомеры (т. е. (+) или (-)) или цис/транс-изомеры). В соответствии с настоящим изобретением химические структуры, описанные в данном документе, и, таким образом, соединения по настоящему изобретению, охватывают все из соответствующих стереоизомеров, т. е. как стереоизомерно чистую форму (например, геометрически чистую, энантиометрически чистую или диастереометрически чистую), так и смеси энантиомеров и стереоизомеров, например, рацематы. Смеси энантиомеров и стереоизомеров соединений по настоящему изобретению обычно можно разделить на составляющие их энантиомеры или стереоизомеры при помощи хорошо известных способов, таких как газовая хроматография с применением хиральной фазы, высокоэффективная жидкостная хроматография с применением хиральной фазы, кристаллизация соединения в виде комплекса хиральных солей или кристаллизация соединения в хиральном растворителе. Энантиомеры и стереоизомеры также могут быть получены из стереомерно или энантиомерно чистых промежуточных соединений, реагентов и катализаторов при помощи хорошо известных способов асимметрического синтеза.

In vitro: в контексте настоящего описания «in vitro» относится к событиям, которые происходят в искусственной среде, например, в пробирке или реакционном сосуде, в клеточной культуре, в чашке Петри и т. д., а не внутри организма (например, животного, растения или микроба).

In vivo: в контексте настоящего описания термин «in vivo» относится к событиям, которые происходят внутри организма (например, животного, растения или микроба или в их клетке или ткани).

Выделенный: в контексте настоящего описания термин «выделенный» относится к веществу или молекулярной частице, которые были отделены по меньшей мере от некоторых компонентов, с которыми они были ассоциированы (либо в природе, либо в экспериментальных условиях). Выделенные вещества могут иметь различные уровни чистоты по отношению к веществам, с которыми они были ассоциированы. Выделенные вещества и/или молекулярные частицы могут быть отделены по меньшей мере приблизительно от 10%, приблизительно 20%, приблизительно 30%, приблизительно 40%, приблизительно 50%, приблизительно 60%, приблизительно 70%, приблизительно 80%, приблизительно 90% или более других компонентов, с которыми они были изначально ассоциированы. В соответствии с некоторыми вариантами осуществления выделенные средства имеют степень чистоты более чем приблизительно 80%, приблизительно 85%, приблизительно 90%, приблизительно 91%, приблизительно 92%, приблизительно 93%, приблизительно 94%, приблизительно 95%, приблизительно 96%, приблизительно 97%, приблизительно 98%, приблизительно 99% или более приблизительно 99%. В контексте настоящего описания вещество является «чистым», если оно практически не содержит других компонентов.

Практически выделенный: «практически выделенный» означает, что соединение практически отделено от среды, в которой оно было образовано или обнаружено. Частичное отделение может включать, например, композицию с высоким содержанием соединения по настоящему раскрытию. Практическое отделение может включать композиции, содержащие по меньшей мере приблизительно 50%, по меньшей мере приблизительно 60%, по меньшей мере приблизительно 70%, по меньшей мере приблизительно 80%, по меньшей мере приблизительно 90%, по меньшей мере приблизительно 95%, по меньшей мере приблизительно 97% или по меньшей мере приблизительно 99% по массе соединения по настоящему раскрытию или его соли. Способы выделения соединений и их солей общеизвестны в данной области техники.

Линкер: в контексте настоящего описания линкер относится к группе атомов, например, 10-1000 атомов, и может состоять из атомов или групп, таких как без ограничения углерод, амино, алкиламино, кислород, сера, сульфоксид, сульфонил, карбонил и имин. Линкер может быть присоединен к модифицированному нуклеозиду или нуклеотиду на нуклеиновом основании или сахарном фрагменте на первом конце, и к полезному грузу, например, детектируемому или терапевтическому средству, на втором конце. Линкер может иметь достаточную длину для того, чтобы не препятствовать его включению в последовательность нуклеиновой кислоты. Линкер может быть использован для любой полезной цели, такой как образование мультимеров модулирующих полинуклеотидов (например, при помощи связи двух или более молекул модулирующих полинуклеотидов) или конъюгатов модулирующих полинуклеотидов, а также введение полезного груза, как описано в данном документе. Примеры химических групп, которые могут быть включены в линкер, включают без ограничения алкил, алкенил, алкинил, амидо, амино, простого эфира, тиоэфира, сложного эфира, алкилен, гетероалкилен, арил или гетероциклил, каждая из которых может быть необязательно замещена, как описано в данном документе. Примеры линкеров включают без ограничения ненасыщенные алканы, полиэтиленгликоли (например, этилен- или пропиленгликолевые мономерные единицы, например, диэтиленгликоль, дипропиленгликоль, триэтиленгликоль, трипропиленгликоль, тетраэтиленгликоль или тетрапропиленгликоль) и декстрановые полимеры и их производные. Другие примеры включают без ограничения расщепляемые фрагменты в линкере, такие как, например, дисульфидную связь (-S-S-) или азо-связь (-N=N-), которые могут быть расщеплены при помощи восстановителя или фотолиза. Неограничивающие примеры избирательно расщепляемой связи включают амидосвязь, которая может быть расщеплена, например, при помощи трис(2-карбоксиэтил)фосфина (TCEP) или других восстановителей и/или фотолиза, а также сложноэфирную связь, которая может быть расщеплена при помощи кислотного или основного гидролиза.

Сайт связывания микроРНК (miRNA): в контексте настоящего описания сайт связывания микроРНК (miRNA) представляет собой нуклеотидную локализацию или участок в транскрипте нуклеиновой кислоты, с которым связывается по меньшей мере «затравочный» участок miRNA.

Модифицированный: в контексте настоящего описания «модифицированный» относится к измененному состоянию или структуре молекулы согласно настоящему изобретению. Молекулы можно модифицировать разнообразными путями, в том числе химически, структурно и функционально.

Встречающийся в природе: в контексте настоящего описания «встречающийся в природе» означает существующий в природе без искусственной поддержки.

Нейтрализующее антитело: в контексте настоящего описания «нейтрализующее антитело» относится к антителу, которое связывается со своим антигеном и защищает клетку от антигена или инфекционного агента при помощи нейтрализации или устранения любой биологической активности, которой он обладает.

Отличное от человека позвоночное: в контексте настоящего описания термин «отличное от человека позвоночное» включает всех позвоночных, за исключением Homo sapiens, включая дикие и одомашненные виды животных. Примеры отличных от человека позвоночных включают без ограничения таких млекопитающих, как альпака, бантенг, бизон, верблюд, кошка, крупный рогатый скот, олень, собака, осел, гаял, коза, морская свинка, лошадь, лама, мул, свинья, кролик, северный олень, овца, буйвол и як.

Нецелевой: в контексте настоящего описания «нецелевой» относится к любому непредусмотренному эффекту в отношении любой одной или более мишени, гена и/или клеточного транскрипта.

Открытая рамка считывания: в контексте настоящего описания «открытая рамка считывания» или «ORF» относится к последовательности, которая не содержит стоп-кодона в указанной рамке считывания.

Функционально связанный: в контексте настоящего описания термин «функционально связанный» относится к функциональному соединению между двумя или более молекулами, конструкциями, транскриптами, молекулярными частицами, фрагментами и т. п.

Необязательно замещенный: в данном документе фраза в форме «необязательно замещенный X» (например, необязательно замещенный алкил) является эквивалентным «X, где X является необязательно замещенным» (например, «алкил, где алкил является необязательно замещенным»). Это не означает, что признак «X» (например, алкил) сам по себе является необязательным.

Пептид: в контексте настоящего описания «пептид» имеет длину менее 50 аминокислот или равную 50 аминокислотам, например, приблизительно 5, 10, 15, 20, 25, 30, 35, 40, 45 или 50 аминокислотам.

Пациент: в контексте настоящего описания «пациент» относится к субъекту, который может обратиться за помощью или нуждаться в лечении, требовать лечения, проходить лечение, будет проходить лечение, или к субъекту, который находится под наблюдением обученного специалиста по конкретному заболеванию или состоянию.

Фармацевтически приемлемый: фраза «фармацевтически приемлемый» используется в данном документе для обозначения тех соединений, материалов, композиций и/или лекарственных форм, которые, по результатам тщательной клинической оценки, являются подходящими для применения в контакте с тканями человеческих организмов и животных без чрезмерной токсичности, раздражения, аллергической реакции или другой проблемы или осложнения, соизмеримых с разумным соотношением выгоды и риска.

Фармацевтически приемлемые вспомогательные вещества: фраза «фармацевтически приемлемое вспомогательное вещество» в контексте настоящего описания относится к любому ингредиенту, отличному от описанных в данном документе соединений (например, среды, способной суспендировать или растворять активное соединение), и характеризующемуся свойствами быть практически нетоксичным и не вызывать воспаления у пациента. Вспомогательные вещества могут включать, например, антиадгезивы, антиоксиданты, связующие вещества, покрытия, средства для спрессовывания, разрыхлители, красители (пигменты), смягчающие вещества, эмульгаторы, наполнители (разбавители), пленкообразователи или покрытия, ароматизаторы, отдушки, скользящие вещества (усилители текучести), смазывающие вещества, консерванты, краски для печати, сорбенты, суспензионные или диспергирующие средства, подсластители и гидратационную воду. Иллюстративные вспомогательные вещества включают без ограничения: бутилированный гидрокситолуол (BHT), карбонат кальция, фосфат кальция (двухосновный), стеарат кальция, кроскармеллозу, перекрестно сшитый поливинилпирролидон, лимонную кислоту, кросповидон, цистеин, этиленцеллюлозу, желатин, гидроксипропилцеллюлозу, гидроксипропилметилцеллюлозу, лактозу, стеарат магния, мальтит, маннит, метионин, метилцеллюлозу, метилпарабен, микрокристаллическую целлюлозу, полиэтиленгликоль, поливинилпирролидон, повидон, прежелатинизированный крахмал, пропилпарабен, ретинилпальмиат, шеллак, диоксид кремния, карбоксиметилцеллюлозу натрия, цитрат натрия, натрия крахмала гликолят, сорбит, крахмал (кукурузный), стеариновую кислоту, сахарозу, тальк, диоксид титана, витамин A, витамин E, витамин C и ксилит.

Фармацевтически приемлемые соли: настоящее раскрытие также включает фармацевтически приемлемые соли, которые описаны в данном документе. В контексте настоящего описания «фармацевтически приемлемые соли» относятся к производным раскрытых соединений, в которых исходное соединение модифицировано посредством превращения существующего кислотного или основного фрагмента в его солевую форму (например, путем осуществления реакции группы свободного основания с подходящей органической кислотой). Примеры фармацевтически приемлемых солей включают, без ограничения, соли основных остатков, таких как амины, с минеральными или органическими кислотами; соли кислотных остатков, таких как карбоновые кислоты, с щелочами или органическими основаниями и т.п. Типичные соли присоединения кислоты включают ацетат, соли уксусной кислоты, адипат, альгинат, аскорбат, аспартат, бензолсульфонат, соли бензолсульфоновой кислоты, бензоат, бисульфат, борат, бутират, камфорат, камфорсульфонат, цитрат, циклопентанпропионат, диглюконат, додецилсульфат, этансульфонат, фумарат, глюкогептаноат, глицерофосфат, гемисульфат, гептаноат, гексаноат, гидробромид, гидрохлорид, гидройодид, 2-гидрокси-этансульфонат, лактобионат, лактат, лаурат, лаурилсульфат, малат, малеат, малонат, метансульфонат, 2-нафталинсульфонат, никотинат, нитрат, олеат, оксалат, пальмитат, памоат, пектинат, персульфат, 3-фенилпропионат, фосфат, пикрат, пивалат, пропионат, стеарат, сукцинат, сульфат, тартрат, тиоцианат, толуолсульфонат, ундеканоат, валерат и т.п. Типичные соли щелочных или щелочноземельных металлов включают катионы натрия, лития, калия, кальция, магния и т.п., а также нетоксичные катионы аммония, четвертичного аммония и амина, в том числе, без ограничения, катионы аммония, тетраметиламмония, тетраэтиламмония, метиламина, диметиламина, триметиламина, триэтиламина, этиламина и т.п. Фармацевтически приемлемые соли согласно настоящему раскрытию включают традиционные нетоксичные соли, образованные исходным соединением, например, с нетоксичными неорганическими или органическими кислотами. Фармацевтически приемлемые соли согласно настоящему раскрытию можно синтезировать из исходного соединения, которое содержит основный или кислотный фрагмент, посредством традиционных химических способов. Обычно такие соли можно получить посредством проведения реакции этих соединений в форме свободной кислоты или основания со стехиометрическим количеством соответствующего основания или кислоты в воде или в органическом растворителе или же в их смеси; обычно предпочтительными являются неводные среды, подобные эфиру, этилацетату, этанолу, изопропанолу или ацетонитрилу. Перечень подходящих солей находится в Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, и Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), содержание каждый из которых включено в данный документ во всей своей полноте посредством ссылки.

Фармацевтиески приемлемый сольват: термин «фармацевтически приемлемый сольват» в контексте настоящего описания означает соединение согласно настоящему изобретению, причем молекулы подходящего растворителя включены в кристаллическую решетку. Подходящий растворитель является физиологически переносимым во вводимой дозе. Например, сольваты можно получить посредством кристаллизации, перекристаллизации или осаждения из раствора, который включает органические растворители, воду или их смесь. Примерами подходящих растворителей являются этанол, вода (например, моно-, ди- и тригидраты), N-метилпирролидинон (NMP), диметилсульфоксид (DMSO), N,N'-диметилформамид (DMF), N,N'-диметилацетамид (DMAC), 1,3-диметил-2-имидазолидинон (DMEU), 1,3-диметил-3,4,5,6-тетрагидро-2-(1H)-пиримидинон (DMPU), ацетонитрил (ACN), пропиленгликоль, этилацетат, бензиловый спирт, 2-пирролидон, бензилбензоат и т.п. Если растворителем является вода, сольват называется «гидратом».

Фармакокинетический: в контексте настоящего описания «фармакокинетический» относится к любому одному или более свойствам молекулы или соединения, когда оно относится к определению поведения веществ, вводимых в живой организм. Фармакокинетика разделена на несколько областей, в том числе степень и скорость всасывания, распределение, метаболизм и выведение из организма. В целом это обозначается как ADME, где: (A) всасывание представляет собой процесс проникновения вещества в кровоток; (D) распределение представляет собой распространение или рассредоточение веществ в жидкостях и тканях организма; (M) метаболизм (или биотрансформация) представляет собой необратимое превращение исходных соединений в дочерние метаболиты; и (E) выведение из организма (или элиминация) относится к удалению веществ из организма. В редких случаях некоторые лекарственные препараты необратимо накапливаются в ткани организма.

Физико-химический: в контексте настоящего описания «физико-химический» означает физическое и/или химическое свойство или относится к физическому и/или химическому свойству.

Предупреждение: в контексте настоящего описания термин «предупреждение» относится к частичной или полной задержке проявления инфекции, заболевания, нарушения и/или состояния; частичной или полной задержке проявления одного или более симптомов, признаков или клинических проявлений конкретной инфекции, заболевания, нарушения и/или состояния; частичной или полной задержке проявления одного или более симптомов, признаков или проявлений конкретной инфекции, заболевания, нарушения и/или состояния; частичной или полной задержке прогрессирования инфекции, конкретного заболевания, нарушения и/или состояния; и/или снижению риска развития патологии, ассоциированной с инфекцией, заболеванием, нарушением и/или состоянием.

Пролекарство: настоящее раскрытие также включает пролекарства соединений, которые описаны в данном документе. В контексте настоящего описания «пролекарства» относятся к любому веществу, молекуле или молекулярной частице, которые находятся в форме, предшествующей для такого вещества, молекулы или молекулярной частицы, начиная действовать в качестве лекарства при химическом или физическом изменении. Пролекарства могут быть ковалентно связаны или секвестированы некоторым образом и высвобождают или превращаются в активный лекарственный фрагмент до введения, при введении или после введения субъекту-млекопитающему. Пролекарства могут быть получены при модификации функциональных групп, присутствующих в соединениях, таким образом, чтобы модификации расщеплялись, либо в результате стандартной операции, либо in vivo, на исходные соединения. Пролекарства включают соединения, в которых гидроксильные, амино-, сульфгидрильные или карбоксильные группы связаны с любой группой, которая при введении субъекту-млекопитающему отщепляется с образованием соответственно свободной гидроксильной, амино-, сульфгидрильной или карбоксильной группы. Получение и применение пролекарств рассмотрено в работе T. Higuchi and V. Stella, ʺPro-drugs as Novel Delivery Systems,ʺ Vol. 14 of the A.C.S. Symposium Series, и в работе Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987, обе из которых включены в данный документ во всей своей полноте при помощи ссылки. В соответствии с некоторыми вариантами осуществления pri-miR по настоящему изобретению могут быть пролекарствами pre-miR. Аналогично, либо pri-, либо pre-miR могут быть пролекарствами искусственных miR, которые процессируются из них.

Пролиферировать: в контексте настоящего описания термин «пролиферировать» означает расти, размножаться или увеличиваться в количестве или вызывать рост, размножение или быстрое увеличение в количестве. «Пролиферативный» означает наличие способности к пролиферации. «Антипролиферативный» означает наличие свойств, которые противоположны или противодействуют пролиферативным свойствам.

Профилактический: в контексте настоящего описания «профилактический» относится к лекарству или способу воздействия, используемому для предупреждения распространения заболевания.

Профилактика: в контексте настоящего описания «профилактика» относится к мере, предпринимаемой для поддержания здоровья и предупреждения распространения заболевания.

Сайт расщепления белка: в контексте настоящего описания «сайт расщепления белка» относится к сайту, где может осуществляться контролируемое расщепление аминокислотной цепи при помощи химических, ферментативных или фотохимических средств.

Сигнал расщепления белка: в контексте настоящего описания «сигнал расщепления белка» относится по меньшей мере к одной аминокислоте, которая отмечает или маркирует полипептид с целью расщепления.

Представляющий интерес белок: в контексте настоящего описания термины «представляющие интерес белки» или «необходимые белки» включают предлагаемые в данном документе белки, а также их фрагменты, мутанты, варианты и измененнные формы.

Проксимальный: в контексте настоящего описания термин «проксимальный» означает расположенный ближе к центру или по направлению к представляющей интерес точке или участку.

Очищенный: в контексте настоящего описания «очищать», «очищенный», «очистка» означает делать практически чистым или очищенным от нежелательных компонентов, загрязнителя, примеси или дефекта.

Образец: в контексте настоящего описания термин «образец» или «биологический образец» относится к подсовокупности его тканей, клеток или составных частей (например, биологических жидкостей, в том числе без ограничения крови, слизи, лимфатической жидкости, синовиальной жидкости, спинномозговой жидкости, слюны, амниотической жидкости, пуповинной крови, мочи, вагинального отделяемого и семени). Образец дополнительно может включать гомогенат, лизат или экстракт, полученный из целого организма или подмножества его тканей, клеток или составных частей, или их фракции или доли, в том числе без ограничения, например, плазмы, сыворотки, цереброспинальной жидкости, лимфы, внешних участков кожи, дыхательных, кишечных и мочеполового трактов, слез, слюны, молока, клеток крови, опухолей или органов. Образец дополнительно относится к среде, такой как питательный бульон или гель, которая может содержать клеточные компоненты, такие как белки или молекула нуклеиновой кислоты.

Сигнальные последовательности: в контексте настоящего описания термин «сигнальные последовательности» относится к последовательности, которая может управлять транспортом или локализацией белка.

Единичная стандартная доза: в контексте настоящего описания «единичная стандартная доза» относится к дозе любого терапевтического средства, вводимого в одной дозе/в одно время/одним путем/через одну точку контакта, т. е. при одном событии.

Схожесть: в контексте настоящего описания термин «схожесть» относится к общему родству между полимерными молекулами, например, между полинуклеотидными молекулами (например, молекулами ДНК и/или молекулами РНК) и/или между полипептидными молекулами. Расчет процента схожести полимерных молекул друг с другом может быть выполнен таким же образом, как и расчет процента идентичности, за исключением того, что при расчете процента схожести учитываются консервативные замены, как понимается в данной области техники.

Раздельная доза: в контексте настоящего описания «раздельная доза» представляет собой разделение единичной стандартной дозы или общей суточной дозы на две или более доз.

Стабильный: в контексте настоящего описания термин «стабильный» относится к соединению, которое достаточно устойчиво, чтобы выдержать выделение до пригодной степени чистоты из реакционной смеси, и предпочтительно может быть составлено в эффективное терапевтическое средство.

Стабилизированный: в контексте настоящего описания термин «стабилизировать», «стабилизированный», «стабилизированный участок» означает делать или становиться стабильным.

Стереоизомер: в контексте настоящего описания термин «стереоизомер» относится ко всем возможным различным изомерным, а также конформационным формам, которыми соединение может обладать (например, соединение с любой формулой, описанной в данном документе), в частности, всем возможным стереохимически и конформационно изомерным формам, всем диастереомерам, энантиомерам и/или конфомерам основной молекулярной структуры. Некоторые соединения по настоящему изобретению могут существовать в различных таутомерных формах, все из последних включены в объем настоящего изобретения.

Субъект: в контексте настоящего описания термин «субъект» или «пациент» относятся к любому организму, которому можно вводить композицию в соответствии с настоящим изобретением, например, для экспериментальных, диагностических, профилактических и/или терапевтических целей. Типичные субъекты включают в себя животных (например, млекопитающих, таких как мыши, крысы, кролики, отличные от человека приматы и люди) и/или растения.

Практически: в контексте настоящего описания термин «практически» относится к качественному состоянию проявления полной или почти полной степени или порядка представляющей интерес характеристики или свойства. Специалисту в биологии в данной области техники будет понятно, что биологические и химические явления редко, если вообще, доходят до завершения и/или продолжаются до завершенности или приводят к достижению или избежанию абсолютного результата. Таким образом, выражение «практически» используют в данном документе для отражения потенциального отсутствия завершенности, свойственного многим биологическим и химическим явлениям.

Практически равный: в контексте настоящего описания это относится к временным различиям между дозами, при этом выражение означает плюс/минус 2%.

Практически одновременно: в контексте настоящего описания, и поскольку он относится к нескольким дозам, этот термин означает в течение 2 секунд.

Страдающий: у индивидуума, который «страдает от» заболевания, нарушения и/или состояния, было диагностировано заболевание, нарушение и/или состояние или проявляется один или более его симптомов.

Подвержен развитию: у индивидуума, который «подвержен развитию» заболевания, нарушения и/или состояния, не было диагностировано заболевание, нарушение и/или состояние или не могут проявляться его симптомы, но он имеет предрасположенность к развитию заболевания или его симптомов. В соответствии с некоторыми вариантами осуществления индивид, который подвержен развитию заболевания, нарушения и/или состояния (например, злокачественной опухоли), может быть охарактеризован одним или более из следующего: (1) генетической мутацией, ассоциированной с развитием заболевания, нарушения и/или состояния; (2) генетическим полиморфизом, ассоциированным с развитием заболевания, нарушения и/или состояния; (3) повышенной и/или сниженной экспрессией и/или активностью белка и/или нуклеиновой кислоты, ассоциированной с заболеванием, нарушением и/или состоянием; (4) привычками и/или образом жизни, ассоциированным с развитием заболевания, нарушения и/или состояния; (5) семейным анамнезом заболевания, нарушения и/или состояния; и (6) воздействием микроорганизма и/или заражением микроорганизмом, ассоциированным с развитием заболевания, нарушения и/или состояния. В соответствии с некоторыми вариантами осуществления у индивида, который подвержен развитию заболевания, нарушения и/или состояния, разовьется заболевание, нарушение и/или состояние. В соответствии с некоторыми вариантами осуществления у индивида, который подвержен развитию заболевания, нарушения и/или состояния, не разовьется заболевание, нарушение и/или состояние.

Замедленное высвобождение: в контексте настоящего описания термин «замедленное высвобождение» относится к профилю высвобождения фармацевтической композиции или соединения, который соответствует скорости высвобождения в течение определенного периода времени.

Синтетический: термин «синтетический» означает полученный, приготовленный и/или произведенный руками человека. Синтез полинуклеотидов, или полипептидов, или других молекул согласно настоящему изобретению может быть химическим или ферментативным.

Целевые клетки: в контексте настоящего описания термин «целевые клетки» относится к любой одной или более представляющим интерес клеткам. Клетки могут находиться in vitro, in vivo, in situ или в ткани или органе организма. Организмом может быть животное, предпочтительно млекопитающее, более предпочтительно человек и наиболее предпочтительно пациент.

Терапевтическое средство: термин «терапевтическое средство» относится к любому средству, которое при введении субъекту оказывает терапевтический, диагностический и/или профилактический эффект и/или вызывает необходимый биологический и/или фармакологический эффект.

Терапевтически эффективное количество: в контексте настоящего описания термин «терапевтически эффективное количество» означает количество подлежащего доставке средства (например, нуклеиновой кислоты, лекарственного средства, терапевтического средства, диагностического средства, профилактического средства и т. д.) которое при введении субъекту, страдающему от инфекции, заболевания, нарушения и/или состояния или подверженному их развитию, является достаточным для лечения, улучшения симптомов, диагностики, предупреждения и/или задержки проявления инфекции, заболевания, нарушения и/или состояния.

Терапевтически эффективный результат: в контексте настоящего описания термин «терапевтически эффективный результат» означает результат, который является достаточным у субъекта, который страдает инфекцией, заболеванием, нарушением и/или состоянием или подвержен развитию инфекции, заболевания, нарушения и/или состояния, для лечения, нормализации симптомов, диагностики, предупреждения и/или задержки проявления инфекции, заболевания, нарушения и/или состояния.

Общая суточная доза: в контексте настоящего описания «общая суточная доза» относится к количеству, которое дают или прописывают на 24 часовой период. Его можно вводить в виде единичной стандартной дозы.

Трансфекция: в контексте настоящего описания термин «трансфекция» относится к способам введения в клетку экзогенных нуклеиновых кислот. Способы трансфекции включают, без ограничения, химические способы, физическую обработку и обработку катионными липидами или смесями.

Лечение: в контексте настоящего описания термин «лечение» относится к частичному или полному снижению, ослаблению, уменьшению, облегчению, задержке проявления, ингибированию прогрессирования, уменьшению тяжести и/или снижению частоты возникновения одного или более симптомов или признаков конкретной инфекции, заболевания, нарушения и/или состояния. Например, «лечение злокачественной опухоли» может относиться к ингибированию выживаемости, роста и/или распространения опухоли. Лечение можно назначать субъекту, у которого не наблюдаются признаки заболевания, нарушения и/или состояния, и/или субъекту, у которого наблюдаются только ранние признаки заболевания, нарушения и/или состояния, с целью снижения риска развития патологии, ассоциированной с заболеванием, нарушением и/или состоянием.

Немодифицированный: в контексте настоящего описания термин «немодифицированный» относится к любому веществу, соединению или молекуле до ее изменения каким-либо образом. Немодифицированный может, но не всегда, относиться к форме дикого типа или нативной форме биомолекулы. Молекулы могут быть подвергнуты ряду модификаций, при этом каждая модифицированная молекула может служить в качестве «немодифицированной» исходной молекулы для последующей модификации.

ЭКВИВАЛЕНТЫ И ОБЪЕМ

Специалисты в данной области техники поймут или будут способны установить с использованием не более чем стандартного экспериментирования многие эквиваленты конкретным вариантам осуществления в соответствии с настоящим изобретением, описанным в данном документе. Не предполагается, чтобы объем настоящего изобретения ограничивался вышеизложенным описанием, вместо этого он изложен в прилагаемой формуле изобретения.

В пунктах формулы изобретения формы единственного числа, такие как «некоторый», «некий» и «данный», могут означать один или более чем один, если не указано обратное, или это иным образом очевидно из контекста. Пункты формулы изобретения или описания, которые включают «или» между одним или более членами группы, считаются удовлетворительными, если один, более чем один или все из членов группы присутствуют в, используются в или иным образом относятся к заданному продукту или процессу, если не указано обратное, или это иным образом очевидно из контекста. Настоящее изобретение включает варианты осуществления, в которых именно один член группы присутствует в, используется в или иным образом относится к заданному продукту или процессу. Настоящее изобретение включает варианты осуществления, в которых более одного или все члены группы присутствуют в, используются в или иным образом относятся к заданному продукту или процессу.

Также отмечается, что термин «содержащий» предполагается открытым и позволяет, но не требует включения дополнительных элементов или стадий. Если термин «содержащий» используется в данном документе, термин «состоящий из», следовательно, также охватывается и раскрывается.

Если не определено иное, все технические и научные термины, используемые в данном документе, имеют то же значение, которое обычно понятно среднему специалисту в области техники, к которой принадлежит настоящее изобретение. Способы и материалы описаны в данном документе для применения в настоящем раскрытии; также могут быть использованы другие подходящие способы и материалы, известные в данной области техники.

В случае, если приведены диапазоны, конечные значения включены. Более того, следует понимать, что если не указано иное, или это в иных условиях не является очевидным из контекста и понимания специалиста в данной области техники, величины, которые выражены в виде диапазонов, могут предполагать любое конкретное значение или поддиапазон в приведенных диапазонах в разных вариантах осуществления настоящего изобретения, до десятой части единицы измерения на нижней границе диапазона, если контекст явно не предписывает иное.

Кроме того, следует понимать, что любой конкретный вариант осуществления настоящего изобретения, который попадает в уровень техники, может быть явно исключен из любого одного или более пунктов формулы изобретения. Поскольку такие варианты осуществления считаются известными специалисту в данной области техники, их можно исключить, даже если исключение явно не изложено в данном документе. Любой определенный вариант осуществления композиций по настоящему изобретению (например, любая нуклеиновая кислота или кодируемый ею белок; любой способ получения; любой способ применения; и т. д.) может быть исключен из любого одного или более пунктов формулы изобретения по любой причине, связанной или не связанной с его присутствием в уровне техники.

Все упоминаемые источники, например, ссылки, публикации, базы данных, записи в базах данных и источники из уровня техники, цитируемые в данном документе, включены в настоящую заявку при помощи ссылки, даже если явным образом не указываются при цитировании. В случае противоречивых утверждений из цитируемого источника и настоящей заявки, утверждение в настоящей заявке должно иметь преимущественную силу.

Названия разделов и таблиц не подразумеваются как ограничивающие.

ПРИМЕРЫ

Пример 1. Разработка модулирующих полинуклеотидов (искусственных pri- или pre-микроРНК)

Искусственные pri- или pre-микроРНК разрабатывали в виде shRNA или структур «петля на стебле», кодирующих искусственную miR (или искусственную siRNA), имеющую по меньшей мере одну цепь, которая может по меньшей мере частично гибридизироваться с целевой нуклеиновой кислотой, например, РНК или ДНК, или одним или более из следующих элементов: (a) мотивом UG у основания исходного стебля, (b) мотивом UGUG на 5'-конце петли miRNA, (c) уридином на 5'-конце направляющей цепи, (d) петлевой структурой, полученной из канонической микроРНК, такой как miR-22, (e) CNNC в 3'-фланкирующей последовательности, (f) фланкирующими участками из канонической микроРНК, такими как let-7b, и/или (g) одним или более вздутиями и ошибочно спаренными основаниями между сопровождающей и направляющей цепью.

После разработки последовательность конструировали, или синтезировали, или вставляли в вектор и вводили в клетку или организм. Подходящими плазмидами или векторами являлись любые, которые трансдуцируют или трансфицируют целевую клетку.

Можно было использовать векторы на основе аденоассоциированного вируса (AAV), вирусные частицы или целые вирусы.

Введение приводило к процессингу модулирующего полинуклеотида с образованием искусственной микроРНК, которая изменяла уровни экспрессии целевой нуклеиновой кислоты.

Эффективный нокдаун целевой последовательности могли определять при помощи способов, известных в данной области техники, и были показаны незначительные нецелевые эффекты или они отсутствовали.

Эффективные дуплексы сопровождающей-направляющей цепи модулирующих полинуклеотидов, например, pri- или pre-микроРНК характеризовались более 95% соотношением направляющей цепи к сопровождающей цепи при измерении процессинга.

Пример 2. Оптимизация сопровождающей-направляющей цепи

С целью достижения целевого нокдауна или модулирования целевой экспрессии, которая является специфической и эффективной, сопровождающие и направляющие цепи, которые будут образовывать стебель дуплекса структуры «петля на стебле» pri- или pre-микроРНК по настоящему изобретению, можно оптимизировать отдельно, например, в виде siRNA (малых интерферирующих РНК).

siRNA разрабатывали по отношению к выбранной целевой нуклеиновой кислоте в виде канонических siRNA, имеющих центральный дуплекс из 19 пар оснований с 3'-динуклеотидным выступающим концом на 3'-конце цепей дуплекса, при этом антисмысловая цепь была полностью комплементарной целевой нуклеиновой кислоте в пределах участка из 19 нуклеотидов.

Альтернативно, siRNA разрабатывали такими, чтобы смысловая цепь (сопровождающая цепь) была менее чем на 19 нуклеотидов идентичной целевой нуклеиновой кислоте.

Модификации в отношении спаривания оснований дуплекса смысловой-антисмысловой (сопровождающей-направляющей) цепей выполняли с целью введения вздутий или ошибочно спаренных оснований. Вставки или делеции или ошибочно спаренные основания могли быть включены на 5'- или 3'-конце смысловой цепи, и эти вставки или делеции могли зеркально отображаться или могли не отображаться на направляющей цепи.

Полученную siRNA исследовали при помощи стандартных способов, известных в данной области техники, на предмет целевого нокдауна и других релевантных физиологических и фармакокинетических свойств и на предмет нецелевых эффектов.

Затем конструировали siRNA, характеризующуюся достаточным целевым нокдауном с незначительными нецелевыми эффектами, либо с дополнительными модификациями, либо без них, в качестве сопровождающей и направляющей цепей pri- или pre-микроРНК по настоящему изобретению.

Пример 3. Разработка сопровождающей-направляющей цепей для SOD1

При конструировании оптимальной сопровождающей и направляющей цепей pri- и/или pre-микроРНК по настоящему изобретению выбирали ряд последовательностей из 19-мерной смысловой цепи (сопровождающей цепи) из последовательности супероксиддисмутазы 1 (SOD1; ссылка GenBank NM_000454.4). Последовательность мРНК SOD1 (показанная в виде ДНК) представляет собой: GTTTGGGGCCAGAGTGGGCGAGGCGCGGAGGTCTGGCCTATAAAGTAGTCGCGGAGACGGGGTGCTGGTTTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCGGCGTGGCCTAGCGAGTTATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAATTTCGAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAGTCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTAAAAGTGTAATTGTGTGACTTTTTCAGAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATTTATGATCACTTGGAAGATTTGTATAGTTTTATAAAACTCAGTTAAAATGTCTGTTTCAATGACCTGTATTTTGCCAGACTTAAATCACAGATGGGTATTAAACTTGTCAGAATTTCTTTGTCATTCAAGCCTGTGAATAAAAACCCTGTATGGCACTTATTATGAGGCTATTAAAAGAATCCAAATTCAAACTAAAAAAAAAAAAAAAAAA (SEQ ID NO: 15).

19-Мерные олигонуклеотиды вместе с крайним 5'-положением смысловой цепи показаны в таблицах 4 вместе с антисмысловой цепью, которая обратно комплементарна смысловой цепи.

19-Мерные олигонуклеотиды выступали в качестве коровых исходных последовательностей для разработки подлежащей исследованию siRNA.

Таблица 4. 19-Мерные олигонуклеотиды SOD1

Исходное положение смысловой цепи в NM_000454.4 Смысловая цепь, например, сопровождающая цепь (5'-3') SEQ ID NO Антисмысловая цепь, например, направляющая цепь (5'-3') SEQ ID NO
26 CGGAGGUCUGGCCUAUAAA 16 UUUAUAGGCCAGACCUCCG 17
27 GGAGGUCUGGCCUAUAAAG 18 CUUUAUAGGCCAGACCUCC 19
28 GAGGUCUGGCCUAUAAAGU 20 ACUUUAUAGGCCAGACCUC 21
29 AGGUCUGGCCUAUAAAGUA 22 UACUUUAUAGGCCAGACCU 23
30 GGUCUGGCCUAUAAAGUAG 24 CUACUUUAUAGGCCAGACC 25
32 UCUGGCCUAUAAAGUAGUC 26 GACUACUUUAUAGGCCAGA 27
33 CUGGCCUAUAAAGUAGUCG 28 CGACUACUUUAUAGGCCAG 29
34 UGGCCUAUAAAGUAGUCGC 30 GCGACUACUUUAUAGGCCA 31
35 GGCCUAUAAAGUAGUCGCG 32 CGCGACUACUUUAUAGGCC 33
36 GCCUAUAAAGUAGUCGCGG 34 CCGCGACUACUUUAUAGGC 35
37 CCUAUAAAGUAGUCGCGGA 36 UCCGCGACUACUUUAUAGG 37
74 GUCGUAGUCUCCUGCAGCG 38 CGCUGCAGGAGACUACGAC 39
76 CGUAGUCUCCUGCAGCGUC 40 GACGCUGCAGGAGACUACG 41
77 GUAGUCUCCUGCAGCGUCU 42 AGACGCUGCAGGAGACUAC 43
78 UAGUCUCCUGCAGCGUCUG 44 CAGACGCUGCAGGAGACUA 45
149 AUGGCGACGAAGGCCGUGU 46 ACACGGCCUUCGUCGCCAU 47
153 CGACGAAGGCCGUGUGCGU 48 ACGCACACGGCCUUCGUCG 49
157 GAAGGCCGUGUGCGUGCUG 50 CAGCACGCACACGGCCUUC 51
160 GGCCGUGUGCGUGCUGAAG 52 CUUCAGCACGCACACGGCC 53
177 AGGGCGACGGCCCAGUGCA 54 UGCACUGGGCCGUCGCCCU 55
192 UGCAGGGCAUCAUCAAUUU 56 AAAUUGAUGAUGCCCUGCA 57
193 GCAGGGCAUCAUCAAUUUC 58 GAAAUUGAUGAUGCCCUGC 59
195 AGGGCAUCAUCAAUUUCGA 60 UCGAAAUUGAUGAUGCCCU 61
196 GGGCAUCAUCAAUUUCGAG 62 CUCGAAAUUGAUGAUGCCC 63
197 GGCAUCAUCAAUUUCGAGC 64 GCUCGAAAUUGAUGAUGCC 65
198 GCAUCAUCAAUUUCGAGCA 66 UGCUCGAAAUUGAUGAUGC 67
199 CAUCAUCAAUUUCGAGCAG 68 CUGCUCGAAAUUGAUGAUG 69
206 AAUUUCGAGCAGAAGGAAA 70 UUUCCUUCUGCUCGAAAUU 71
209 UUCGAGCAGAAGGAAAGUA 72 UACUUUCCUUCUGCUCGAA 73
210 UCGAGCAGAAGGAAAGUAA 74 UUACUUUCCUUCUGCUCGA 75
239 AAGGUGUGGGGAAGCAUUA 76 UAAUGCUUCCCCACACCUU 77
241 GGUGUGGGGAAGCAUUAAA 78 UUUAAUGCUUCCCCACACC 79
261 GACUGACUGAAGGCCUGCA 80 UGCAGGCCUUCAGUCAGUC 81
263 CUGACUGAAGGCCUGCAUG 82 CAUGCAGGCCUUCAGUCAG 83
264 UGACUGAAGGCCUGCAUGG 84 CCAUGCAGGCCUUCAGUCA 85
268 UGAAGGCCUGCAUGGAUUC 86 GAAUCCAUGCAGGCCUUCA 87
269 GAAGGCCUGCAUGGAUUCC 88 GGAAUCCAUGCAGGCCUUC 89
276 UGCAUGGAUUCCAUGUUCA 90 UGAACAUGGAAUCCAUGCA 91
278 CAUGGAUUCCAUGUUCAUG 92 CAUGAACAUGGAAUCCAUG 93
281 GGAUUCCAUGUUCAUGAGU 94 ACUCAUGAACAUGGAAUCC 95
284 UUCCAUGUUCAUGAGUUUG 96 CAAACUCAUGAACAUGGAA 97
290 GUUCAUGAGUUUGGAGAUA 98 UAUCUCCAAACUCAUGAAC 99
291 UUCAUGAGUUUGGAGAUAA 100 UUAUCUCCAAACUCAUGAA 101
295 UGAGUUUGGAGAUAAUACA 102 UGUAUUAUCUCCAAACUCA 103
296 GAGUUUGGAGAUAAUACAG 104 CUGUAUUAUCUCCAAACUC 105
316 AGGCUGUACCAGUGCAGGU 106 ACCUGCACUGGUACAGCCU 107
317 GGCUGUACCAGUGCAGGUC 108 GACCUGCACUGGUACAGCC 109
329 GCAGGUCCUCACUUUAAUC 110 GAUUAAAGUGAGGACCUGC 111
330 CAGGUCCUCACUUUAAUCC 112 GGAUUAAAGUGAGGACCUG 113
337 UCACUUUAAUCCUCUAUCC 114 GGAUAGAGGAUUAAAGUGA 115
350 CUAUCCAGAAAACACGGUG 116 CACCGUGUUUUCUGGAUAG 117
351 UAUCCAGAAAACACGGUGG 118 CCACCGUGUUUUCUGGAUA 119
352 AUCCAGAAAACACGGUGGG 120 CCCACCGUGUUUUCUGGAU 121
354 CCAGAAAACACGGUGGGCC 122 GGCCCACCGUGUUUUCUGG 123
357 GAAAACACGGUGGGCCAAA 124 UUUGGCCCACCGUGUUUUC 125
358 AAAACACGGUGGGCCAAAG 126 CUUUGGCCCACCGUGUUUU 127
364 CGGUGGGCCAAAGGAUGAA 128 UUCAUCCUUUGGCCCACCG 129
375 AGGAUGAAGAGAGGCAUGU 130 ACAUGCCUCUCUUCAUCCU 131
378 AUGAAGAGAGGCAUGUUGG 132 CCAACAUGCCUCUCUUCAU 133
383 GAGAGGCAUGUUGGAGACU 134 AGUCUCCAACAUGCCUCUC 135
384 AGAGGCAUGUUGGAGACUU 136 AAGUCUCCAACAUGCCUCU 137
390 AUGUUGGAGACUUGGGCAA 138 UUGCCCAAGUCUCCAACAU 139
392 GUUGGAGACUUGGGCAAUG 140 CAUUGCCCAAGUCUCCAAC 141
395 GGAGACUUGGGCAAUGUGA 142 UCACAUUGCCCAAGUCUCC 143
404 GGCAAUGUGACUGCUGACA 144 UGUCAGCAGUCACAUUGCC 145
406 CAAUGUGACUGCUGACAAA 146 UUUGUCAGCAGUCACAUUG 147
417 CUGACAAAGAUGGUGUGGC 148 GCCACACCAUCUUUGUCAG 149
418 UGACAAAGAUGGUGUGGCC 150 GGCCACACCAUCUUUGUCA 151
469 CUCAGGAGACCAUUGCAUC 152 GAUGCAAUGGUCUCCUGAG 153
470 UCAGGAGACCAUUGCAUCA 154 UGAUGCAAUGGUCUCCUGA 155
475 AGACCAUUGCAUCAUUGGC 156 GCCAAUGAUGCAAUGGUCU 157
476 GACCAUUGCAUCAUUGGCC 158 GGCCAAUGAUGCAAUGGUC 159
480 AUUGCAUCAUUGGCCGCAC 160 GUGCGGCCAAUGAUGCAAU 161
487 CAUUGGCCGCACACUGGUG 162 CACCAGUGUGCGGCCAAUG 163
494 CGCACACUGGUGGUCCAUG 164 CAUGGACCACCAGUGUGCG 165
496 CACACUGGUGGUCCAUGAA 166 UUCAUGGACCACCAGUGUG 167
497 ACACUGGUGGUCCAUGAAA 168 UUUCAUGGACCACCAGUGU 169
501 UGGUGGUCCAUGAAAAAGC 170 GCUUUUUCAUGGACCACCA 171
504 UGGUCCAUGAAAAAGCAGA 172 UCUGCUUUUUCAUGGACCA 173
515 AAAGCAGAUGACUUGGGCA 174 UGCCCAAGUCAUCUGCUUU 175
518 GCAGAUGACUUGGGCAAAG 176 CUUUGCCCAAGUCAUCUGC 177
522 AUGACUUGGGCAAAGGUGG 178 CCACCUUUGCCCAAGUCAU 179
523 UGACUUGGGCAAAGGUGGA 180 UCCACCUUUGCCCAAGUCA 181
524 GACUUGGGCAAAGGUGGAA 182 UUCCACCUUUGCCCAAGUC 183
552 GUACAAAGACAGGAAACGC 184 GCGUUUCCUGUCUUUGUAC 185
554 ACAAAGACAGGAAACGCUG 186 CAGCGUUUCCUGUCUUUGU 187
555 CAAAGACAGGAAACGCUGG 188 CCAGCGUUUCCUGUCUUUG 189
562 AGGAAACGCUGGAAGUCGU 190 ACGACUUCCAGCGUUUCCU 191
576 GUCGUUUGGCUUGUGGUGU 192 ACACCACAAGCCAAACGAC 193
577 UCGUUUGGCUUGUGGUGUA 194 UACACCACAAGCCAAACGA 195
578 CGUUUGGCUUGUGGUGUAA 196 UUACACCACAAGCCAAACG 197
579 GUUUGGCUUGUGGUGUAAU 198 AUUACACCACAAGCCAAAC 199
581 UUGGCUUGUGGUGUAAUUG 200 CAAUUACACCACAAGCCAA 201
583 GGCUUGUGGUGUAAUUGGG 202 CCCAAUUACACCACAAGCC 203
584 GCUUGUGGUGUAAUUGGGA 204 UCCCAAUUACACCACAAGC 205
585 CUUGUGGUGUAAUUGGGAU 206 AUCCCAAUUACACCACAAG 207
587 UGUGGUGUAAUUGGGAUCG 208 CGAUCCCAAUUACACCACA 209
588 GUGGUGUAAUUGGGAUCGC 210 GCGAUCCCAAUUACACCAC 211
589 UGGUGUAAUUGGGAUCGCC 212 GGCGAUCCCAAUUACACCA 213
593 GUAAUUGGGAUCGCCCAAU 214 AUUGGGCGAUCCCAAUUAC 215
594 UAAUUGGGAUCGCCCAAUA 216 UAUUGGGCGAUCCCAAUUA 217
595 AAUUGGGAUCGCCCAAUAA 218 UUAUUGGGCGAUCCCAAUU 219
596 AUUGGGAUCGCCCAAUAAA 220 UUUAUUGGGCGAUCCCAAU 221
597 UUGGGAUCGCCCAAUAAAC 222 GUUUAUUGGGCGAUCCCAA 223
598 UGGGAUCGCCCAAUAAACA 224 UGUUUAUUGGGCGAUCCCA 225
599 GGGAUCGCCCAAUAAACAU 226 AUGUUUAUUGGGCGAUCCC 227
602 AUCGCCCAAUAAACAUUCC 228 GGAAUGUUUAUUGGGCGAU 229
607 CCAAUAAACAUUCCCUUGG 230 CCAAGGGAAUGUUUAUUGG 231
608 CAAUAAACAUUCCCUUGGA 232 UCCAAGGGAAUGUUUAUUG 233
609 AAUAAACAUUCCCUUGGAU 234 AUCCAAGGGAAUGUUUAUU 235
610 AUAAACAUUCCCUUGGAUG 236 CAUCCAAGGGAAUGUUUAU 237
611 UAAACAUUCCCUUGGAUGU 238 ACAUCCAAGGGAAUGUUUA 239
612 AAACAUUCCCUUGGAUGUA 240 UACAUCCAAGGGAAUGUUU 241
613 AACAUUCCCUUGGAUGUAG 242 CUACAUCCAAGGGAAUGUU 243
616 AUUCCCUUGGAUGUAGUCU 244 AGACUACAUCCAAGGGAAU 245
621 CUUGGAUGUAGUCUGAGGC 246 GCCUCAGACUACAUCCAAG 247
633 CUGAGGCCCCUUAACUCAU 248 AUGAGUUAAGGGGCCUCAG 249
635 GAGGCCCCUUAACUCAUCU 250 AGAUGAGUUAAGGGGCCUC 251
636 AGGCCCCUUAACUCAUCUG 252 CAGAUGAGUUAAGGGGCCU 253
639 CCCCUUAACUCAUCUGUUA 254 UAACAGAUGAGUUAAGGGG 255
640 CCCUUAACUCAUCUGUUAU 256 AUAACAGAUGAGUUAAGGG 257
641 CCUUAACUCAUCUGUUAUC 258 GAUAACAGAUGAGUUAAGG 259
642 CUUAACUCAUCUGUUAUCC 260 GGAUAACAGAUGAGUUAAG 261
643 UUAACUCAUCUGUUAUCCU 262 AGGAUAACAGAUGAGUUAA 263
644 UAACUCAUCUGUUAUCCUG 264 CAGGAUAACAGAUGAGUUA 265
645 AACUCAUCUGUUAUCCUGC 266 GCAGGAUAACAGAUGAGUU 267
654 GUUAUCCUGCUAGCUGUAG 268 CUACAGCUAGCAGGAUAAC 269
660 CUGCUAGCUGUAGAAAUGU 270 ACAUUUCUACAGCUAGCAG 271
661 UGCUAGCUGUAGAAAUGUA 272 UACAUUUCUACAGCUAGCA 273
666 GCUGUAGAAAUGUAUCCUG 274 CAGGAUACAUUUCUACAGC 275
667 CUGUAGAAAUGUAUCCUGA 276 UCAGGAUACAUUUCUACAG 277
668 UGUAGAAAUGUAUCCUGAU 278 AUCAGGAUACAUUUCUACA 279
669 GUAGAAAUGUAUCCUGAUA 280 UAUCAGGAUACAUUUCUAC 281
673 AAAUGUAUCCUGAUAAACA 282 UGUUUAUCAGGAUACAUUU 283
677 GUAUCCUGAUAAACAUUAA 284 UUAAUGUUUAUCAGGAUAC 285
692 UUAAACACUGUAAUCUUAA 286 UUAAGAUUACAGUGUUUAA 287
698 ACUGUAAUCUUAAAAGUGU 288 ACACUUUUAAGAUUACAGU 289
699 CUGUAAUCUUAAAAGUGUA 290 UACACUUUUAAGAUUACAG 291
700 UGUAAUCUUAAAAGUGUAA 292 UUACACUUUUAAGAUUACA 293
701 GUAAUCUUAAAAGUGUAAU 294 AUUACACUUUUAAGAUUAC 295
706 CUUAAAAGUGUAAUUGUGU 296 ACACAAUUACACUUUUAAG 297
749 UACCUGUAGUGAGAAACUG 298 CAGUUUCUCACUACAGGUA 299
770 UUAUGAUCACUUGGAAGAU 300 AUCUUCCAAGUGAUCAUAA 301
772 AUGAUCACUUGGAAGAUUU 302 AAAUCUUCCAAGUGAUCAU 303
775 AUCACUUGGAAGAUUUGUA 304 UACAAAUCUUCCAAGUGAU 305
781 UGGAAGAUUUGUAUAGUUU 306 AAACUAUACAAAUCUUCCA 307
800 UAUAAAACUCAGUUAAAAU 308 AUUUUAACUGAGUUUUAUA 309
804 AAACUCAGUUAAAAUGUCU 310 AGACAUUUUAACUGAGUUU 311
819 GUCUGUUUCAAUGACCUGU 312 ACAGGUCAUUGAAACAGAC 313
829 AUGACCUGUAUUUUGCCAG 314 CUGGCAAAAUACAGGUCAU 315
832 ACCUGUAUUUUGCCAGACU 316 AGUCUGGCAAAAUACAGGU 317
833 CCUGUAUUUUGCCAGACUU 318 AAGUCUGGCAAAAUACAGG 319
851 UAAAUCACAGAUGGGUAUU 320 AAUACCCAUCUGUGAUUUA 321
854 AUCACAGAUGGGUAUUAAA 322 UUUAAUACCCAUCUGUGAU 323
855 UCACAGAUGGGUAUUAAAC 324 GUUUAAUACCCAUCUGUGA 325
857 ACAGAUGGGUAUUAAACUU 326 AAGUUUAAUACCCAUCUGU 327
858 CAGAUGGGUAUUAAACUUG 328 CAAGUUUAAUACCCAUCUG 329
859 AGAUGGGUAUUAAACUUGU 330 ACAAGUUUAAUACCCAUCU 331
861 AUGGGUAUUAAACUUGUCA 332 UGACAAGUUUAAUACCCAU 333
869 UAAACUUGUCAGAAUUUCU 334 AGAAAUUCUGACAAGUUUA 335
891 UCAUUCAAGCCUGUGAAUA 336 UAUUCACAGGCUUGAAUGA 337
892 CAUUCAAGCCUGUGAAUAA 338 UUAUUCACAGGCUUGAAUG 339
906 AAUAAAAACCCUGUAUGGC 340 GCCAUACAGGGUUUUUAUU 341
907 AUAAAAACCCUGUAUGGCA 342 UGCCAUACAGGGUUUUUAU 343
912 AACCCUGUAUGGCACUUAU 344 AUAAGUGCCAUACAGGGUU 345
913 ACCCUGUAUGGCACUUAUU 346 AAUAAGUGCCAUACAGGGU 347
934 GAGGCUAUUAAAAGAAUCC 348 GGAUUCUUUUAAUAGCCUC 349
944 AAAGAAUCCAAAUUCAAAC 350 GUUUGAAUUUGGAUUCUUU 351
947 GAAUCCAAAUUCAAACUAA 352 UUAGUUUGAAUUUGGAUUC 353

Коровые исходные смысловые-антисмысловые пары из приведенной выше таблицы 4 затем конструировали в виде дуплексных siRNA. Для этого самый крайний 3'-нуклеотид смысловой цепи во всех случаях заменяли на цитидиновый (C) нуклеотид, оставляя, таким образом, лишь 18 нуклеотидов, идентичных целевой последовательности.

Затем динуклеотидный конец на 3'-конце каждой из смысловых и антисмысловых цепей добавляли с получением дуплексов, приведенных в таблице 5.

Таблица 5. Дуплексы siRNA к SOD1

Старт ID дуплекса ID SS Последовательность смысловой цепи (5'-3') SEQ ID NO ID AS Последовательность антисмысловой цепи (5'-3') SEQ ID NO
26 D-2741 7414 CGGAGGUCUGGCCUAUAACdTdT 354 7415 UUUAUAGGCCAGACCUCCGdTdT 355
27 D-2742 7416 GGAGGUCUGGCCUAUAAACdTdT 356 7417 UUUUAUAGGCCAGACCUCCdTdT 357
28 D-2743 7418 GAGGUCUGGCCUAUAAAGCdTdT 358 7419 UCUUUAUAGGCCAGACCUCdTdT 359
29 D-2744 7420 AGGUCUGGCCUAUAAAGUCdTdT 360 7421 UACUUUAUAGGCCAGACCUdTdT 361
30 D-2745 7422 GGUCUGGCCUAUAAAGUACdTdT 362 7423 UUACUUUAUAGGCCAGACCdTdT 363
32 D-2746 7424 UCUGGCCUAUAAAGUAGUCdTdT 364 7425 UACUACUUUAUAGGCCAGAdTdT 365
33 D-2747 7426 CUGGCCUAUAAAGUAGUCCdTdT 366 7427 UGACUACUUUAUAGGCCAGdTdT 367
34 D-2748 7428 UGGCCUAUAAAGUAGUCGCdTdT 368 7429 UCGACUACUUUAUAGGCCAdTdT 369
35 D-2749 7430 GGCCUAUAAAGUAGUCGCCdTdT 370 7431 UGCGACUACUUUAUAGGCCdTdT 371
36 D-2750 7432 GCCUAUAAAGUAGUCGCGCdTdT 372 7433 UCGCGACUACUUUAUAGGCdTdT 373
37 D-2751 7434 CCUAUAAAGUAGUCGCGGCdTdT 374 7435 UCCGCGACUACUUUAUAGGdTdT 375
74 D-2752 7436 GUCGUAGUCUCCUGCAGCCdTdT 376 7437 UGCUGCAGGAGACUACGACdTdT 377
76 D-2753 7438 CGUAGUCUCCUGCAGCGUCdTdT 378 7439 UACGCUGCAGGAGACUACGdTdT 379
77 D-2754 7440 GUAGUCUCCUGCAGCGUCCdTdT 380 7441 UGACGCUGCAGGAGACUACdTdT 381
78 D-2755 7442 UAGUCUCCUGCAGCGUCUCdTdT 382 7443 UAGACGCUGCAGGAGACUAdTdT 383
149 D-2756 7444 AUGGCGACGAAGGCCGUGCdTdT 384 7445 UCACGGCCUUCGUCGCCAUdTdT 385
153 D-2757 7446 CGACGAAGGCCGUGUGCGCdTdT 386 7447 UCGCACACGGCCUUCGUCGdTdT 387
157 D-2758 7448 GAAGGCCGUGUGCGUGCUCdTdT 388 7449 UAGCACGCACACGGCCUUCdTdT 389
160 D-2759 7450 GGCCGUGUGCGUGCUGAACdTdT 390 7451 UUUCAGCACGCACACGGCCdTdT 391
177 D-2760 7452 AGGGCGACGGCCCAGUGCCdTdT 392 7453 UGCACUGGGCCGUCGCCCUdTdT 393
192 D-2761 7454 UGCAGGGCAUCAUCAAUUCdTdT 394 7455 UAAUUGAUGAUGCCCUGCAdTdT 395
193 D-2762 7456 GCAGGGCAUCAUCAAUUUCdTdT 396 7457 UAAAUUGAUGAUGCCCUGCdTdT 397
195 D-2763 7458 AGGGCAUCAUCAAUUUCGCdTdT 398 7459 UCGAAAUUGAUGAUGCCCUdTdT 399
196 D-2764 7460 GGGCAUCAUCAAUUUCGACdTdT 400 7461 UUCGAAAUUGAUGAUGCCCdTdT 401
197 D-2765 7462 GGCAUCAUCAAUUUCGAGCdTdT 402 7463 UCUCGAAAUUGAUGAUGCCdTdT 403
198 D-2766 7464 GCAUCAUCAAUUUCGAGCCdTdT 404 7465 UGCUCGAAAUUGAUGAUGCdTdT 405
199 D-2767 7466 CAUCAUCAAUUUCGAGCACdTdT 406 7467 UUGCUCGAAAUUGAUGAUGdTdT 407
206 D-2768 7468 AAUUUCGAGCAGAAGGAACdTdT 408 7469 UUUCCUUCUGCUCGAAAUUdTdT 409
209 D-2769 7470 UUCGAGCAGAAGGAAAGUCdTdT 410 7471 UACUUUCCUUCUGCUCGAAdTdT 411
210 D-2770 7472 UCGAGCAGAAGGAAAGUACdTdT 412 7473 UUACUUUCCUUCUGCUCGAdTdT 413
239 D-2771 7474 AAGGUGUGGGGAAGCAUUCdTdT 414 7475 UAAUGCUUCCCCACACCUUdTdT 415
241 D-2772 7476 GGUGUGGGGAAGCAUUAACdTdT 416 7477 UUUAAUGCUUCCCCACACCdTdT 417
261 D-2773 7478 GACUGACUGAAGGCCUGCCdTdT 418 7479 UGCAGGCCUUCAGUCAGUCdTdT 419
263 D-2774 7480 CUGACUGAAGGCCUGCAUCdTdT 420 7481 UAUGCAGGCCUUCAGUCAGdTdT 421
264 D-2775 7482 UGACUGAAGGCCUGCAUGCdTdT 422 7483 UCAUGCAGGCCUUCAGUCAdTdT 423
268 D-2776 7484 UGAAGGCCUGCAUGGAUUCdTdT 424 7485 UAAUCCAUGCAGGCCUUCAdTdT 425
269 D-2777 7486 GAAGGCCUGCAUGGAUUCCdTdT 426 7487 UGAAUCCAUGCAGGCCUUCdTdT 427
276 D-2778 7488 UGCAUGGAUUCCAUGUUCCdTdT 428 7489 UGAACAUGGAAUCCAUGCAdTdT 429
278 D-2779 7490 CAUGGAUUCCAUGUUCAUCdTdT 430 7491 UAUGAACAUGGAAUCCAUGdTdT 431
281 D-2780 7492 GGAUUCCAUGUUCAUGAGCdTdT 432 7493 UCUCAUGAACAUGGAAUCCdTdT 433
284 D-2781 7494 UUCCAUGUUCAUGAGUUUCdTdT 434 7495 UAAACUCAUGAACAUGGAAdTdT 435
290 D-2782 7496 GUUCAUGAGUUUGGAGAUCdTdT 436 7497 UAUCUCCAAACUCAUGAACdTdT 437
291 D-2783 7498 UUCAUGAGUUUGGAGAUACdTdT 438 7499 UUAUCUCCAAACUCAUGAAdTdT 439
295 D-2784 7500 UGAGUUUGGAGAUAAUACCdTdT 440 7501 UGUAUUAUCUCCAAACUCAdTdT 441
296 D-2785 7502 GAGUUUGGAGAUAAUACACdTdT 442 7503 UUGUAUUAUCUCCAAACUCdTdT 443
316 D-2786 7504 AGGCUGUACCAGUGCAGGCdTdT 444 7505 UCCUGCACUGGUACAGCCUdTdT 445
317 D-2787 7506 GGCUGUACCAGUGCAGGUCdTdT 446 7507 UACCUGCACUGGUACAGCCdTdT 447
329 D-2788 7508 GCAGGUCCUCACUUUAAUCdTdT 448 7509 UAUUAAAGUGAGGACCUGCdTdT 449
330 D-2789 7510 CAGGUCCUCACUUUAAUCCdTdT 450 7511 UGAUUAAAGUGAGGACCUGdTdT 451
337 D-2790 7512 UCACUUUAAUCCUCUAUCCdTdT 452 7513 UGAUAGAGGAUUAAAGUGAdTdT 453
350 D-2791 7514 CUAUCCAGAAAACACGGUCdTdT 454 7515 UACCGUGUUUUCUGGAUAGdTdT 455
351 D-2792 7516 UAUCCAGAAAACACGGUGCdTdT 456 7517 UCACCGUGUUUUCUGGAUAdTdT 457
352 D-2793 7518 AUCCAGAAAACACGGUGGCdTdT 458 7519 UCCACCGUGUUUUCUGGAUdTdT 459
354 D-2794 7520 CCAGAAAACACGGUGGGCCdTdT 460 7521 UGCCCACCGUGUUUUCUGGdTdT 461
357 D-2795 7522 GAAAACACGGUGGGCCAACdTdT 462 7523 UUUGGCCCACCGUGUUUUCdTdT 463
358 D-2796 7524 AAAACACGGUGGGCCAAACdTdT 464 7525 UUUUGGCCCACCGUGUUUUdTdT 465
364 D-2797 7526 CGGUGGGCCAAAGGAUGACdTdT 466 7527 UUCAUCCUUUGGCCCACCGdTdT 467
375 D-2798 7528 AGGAUGAAGAGAGGCAUGCdTdT 468 7529 UCAUGCCUCUCUUCAUCCUdTdT 469
378 D-2799 7530 AUGAAGAGAGGCAUGUUGCdTdT 470 7531 UCAACAUGCCUCUCUUCAUdTdT 471
383 D-2800 7532 GAGAGGCAUGUUGGAGACCdTdT 472 7533 UGUCUCCAACAUGCCUCUCdTdT 473
384 D-2801 7534 AGAGGCAUGUUGGAGACUCdTdT 474 7535 UAGUCUCCAACAUGCCUCUdTdT 475
390 D-2802 7536 AUGUUGGAGACUUGGGCACdTdT 476 7537 UUGCCCAAGUCUCCAACAUdTdT 477
392 D-2803 7538 GUUGGAGACUUGGGCAAUCdTdT 478 7539 UAUUGCCCAAGUCUCCAACdTdT 479
395 D-2804 7540 GGAGACUUGGGCAAUGUGCdTdT 480 7541 UCACAUUGCCCAAGUCUCCdTdT 481
404 D-2805 7542 GGCAAUGUGACUGCUGACCdTdT 482 7543 UGUCAGCAGUCACAUUGCCdTdT 483
406 D-2806 7544 CAAUGUGACUGCUGACAACdTdT 484 7545 UUUGUCAGCAGUCACAUUGdTdT 485
417 D-2807 7546 CUGACAAAGAUGGUGUGGCdTdT 486 7547 UCCACACCAUCUUUGUCAGdTdT 487
418 D-2808 7548 UGACAAAGAUGGUGUGGCCdTdT 488 7549 UGCCACACCAUCUUUGUCAdTdT 489
469 D-2809 7550 CUCAGGAGACCAUUGCAUCdTdT 490 7551 UAUGCAAUGGUCUCCUGAGdTdT 491
470 D-2810 7552 UCAGGAGACCAUUGCAUCCdTdT 492 7553 UGAUGCAAUGGUCUCCUGAdTdT 493
475 D-2811 7554 AGACCAUUGCAUCAUUGGCdTdT 494 7555 UCCAAUGAUGCAAUGGUCUdTdT 495
476 D-2812 7556 GACCAUUGCAUCAUUGGCCdTdT 496 7557 UGCCAAUGAUGCAAUGGUCdTdT 497
480 D-2813 7558 AUUGCAUCAUUGGCCGCACdTdT 498 7559 UUGCGGCCAAUGAUGCAAUdTdT 499
487 D-2814 7560 CAUUGGCCGCACACUGGUCdTdT 500 7561 UACCAGUGUGCGGCCAAUGdTdT 501
494 D-2815 7562 CGCACACUGGUGGUCCAUCdTdT 502 7563 UAUGGACCACCAGUGUGCGdTdT 503
496 D-2816 7564 CACACUGGUGGUCCAUGACdTdT 504 7565 UUCAUGGACCACCAGUGUGdTdT 505
497 D-2817 7566 ACACUGGUGGUCCAUGAACdTdT 506 7567 UUUCAUGGACCACCAGUGUdTdT 507
501 D-2818 7568 UGGUGGUCCAUGAAAAAGCdTdT 508 7569 UCUUUUUCAUGGACCACCAdTdT 509
504 D-2819 7570 UGGUCCAUGAAAAAGCAGCdTdT 510 7571 UCUGCUUUUUCAUGGACCAdTdT 511
515 D-2820 7572 AAAGCAGAUGACUUGGGCCdTdT 512 7573 UGCCCAAGUCAUCUGCUUUdTdT 513
518 D-2821 7574 GCAGAUGACUUGGGCAAACdTdT 514 7575 UUUUGCCCAAGUCAUCUGCdTdT 515
522 D-2822 7576 AUGACUUGGGCAAAGGUGCdTdT 516 7577 UCACCUUUGCCCAAGUCAUdTdT 517
523 D-2823 7578 UGACUUGGGCAAAGGUGGCdTdT 518 7579 UCCACCUUUGCCCAAGUCAdTdT 519
524 D-2824 7580 GACUUGGGCAAAGGUGGACdTdT 520 7581 UUCCACCUUUGCCCAAGUCdTdT 521
552 D-2825 7582 GUACAAAGACAGGAAACGCdTdT 522 7583 UCGUUUCCUGUCUUUGUACdTdT 523
554 D-2826 7584 ACAAAGACAGGAAACGCUCdTdT 524 7585 UAGCGUUUCCUGUCUUUGUdTdT 525
555 D-2827 7586 CAAAGACAGGAAACGCUGCdTdT 526 7587 UCAGCGUUUCCUGUCUUUGdTdT 527
562 D-2828 7588 AGGAAACGCUGGAAGUCGCdTdT 528 7589 UCGACUUCCAGCGUUUCCUdTdT 529
576 D-2829 7590 GUCGUUUGGCUUGUGGUGCdTdT 530 7591 UCACCACAAGCCAAACGACdTdT 531
577 D-2830 7592 UCGUUUGGCUUGUGGUGUCdTdT 532 7593 UACACCACAAGCCAAACGAdTdT 533
578 D-2831 7594 CGUUUGGCUUGUGGUGUACdTdT 534 7595 UUACACCACAAGCCAAACGdTdT 535
579 D-2832 7596 GUUUGGCUUGUGGUGUAACdTdT 536 7597 UUUACACCACAAGCCAAACdTdT 537
581 D-2833 7598 UUGGCUUGUGGUGUAAUUCdTdT 538 7599 UAAUUACACCACAAGCCAAdTdT 539
583 D-2834 7600 GGCUUGUGGUGUAAUUGGCdTdT 540 7601 UCCAAUUACACCACAAGCCdTdT 541
584 D-2835 7602 GCUUGUGGUGUAAUUGGGCdTdT 542 7603 UCCCAAUUACACCACAAGCdTdT 543
585 D-2836 7604 CUUGUGGUGUAAUUGGGACdTdT 544 7605 UUCCCAAUUACACCACAAGdTdT 545
587 D-2837 7606 UGUGGUGUAAUUGGGAUCCdTdT 546 7607 UGAUCCCAAUUACACCACAdTdT 547
588 D-2838 7608 GUGGUGUAAUUGGGAUCGCdTdT 548 7609 UCGAUCCCAAUUACACCACdTdT 549
589 D-2839 7610 UGGUGUAAUUGGGAUCGCCdTdT 550 7611 UGCGAUCCCAAUUACACCAdTdT 551
593 D-2840 7612 GUAAUUGGGAUCGCCCAACdTdT 552 7613 UUUGGGCGAUCCCAAUUACdTdT 553
594 D-2841 7614 UAAUUGGGAUCGCCCAAUCdTdT 554 7615 UAUUGGGCGAUCCCAAUUAdTdT 555
595 D-2842 7616 AAUUGGGAUCGCCCAAUACdTdT 556 7617 UUAUUGGGCGAUCCCAAUUdTdT 557
596 D-2843 7618 AUUGGGAUCGCCCAAUAACdTdT 558 7619 UUUAUUGGGCGAUCCCAAUdTdT 559
597 D-2844 7620 UUGGGAUCGCCCAAUAAACdTdT 560 7621 UUUUAUUGGGCGAUCCCAAdTdT 561
598 D-2845 7622 UGGGAUCGCCCAAUAAACCdTdT 562 7623 UGUUUAUUGGGCGAUCCCAdTdT 563
599 D-2846 7624 GGGAUCGCCCAAUAAACACdTdT 564 7625 UUGUUUAUUGGGCGAUCCCdTdT 565
602 D-2847 7626 AUCGCCCAAUAAACAUUCCdTdT 566 7627 UGAAUGUUUAUUGGGCGAUdTdT 567
607 D-2848 7628 CCAAUAAACAUUCCCUUGCdTdT 568 7629 UCAAGGGAAUGUUUAUUGGdTdT 569
608 D-2849 7630 CAAUAAACAUUCCCUUGGCdTdT 570 7631 UCCAAGGGAAUGUUUAUUGdTdT 571
609 D-2850 7632 AAUAAACAUUCCCUUGGACdTdT 572 7633 UUCCAAGGGAAUGUUUAUUdTdT 573
610 D-2851 7634 AUAAACAUUCCCUUGGAUCdTdT 574 7635 UAUCCAAGGGAAUGUUUAUdTdT 575
611 D-2852 7636 UAAACAUUCCCUUGGAUGCdTdT 576 7637 UCAUCCAAGGGAAUGUUUAdTdT 577
612 D-2853 7638 AAACAUUCCCUUGGAUGUCdTdT 578 7639 UACAUCCAAGGGAAUGUUUdTdT 579
613 D-2854 7640 AACAUUCCCUUGGAUGUACdTdT 580 7641 UUACAUCCAAGGGAAUGUUdTdT 581
616 D-2855 7642 AUUCCCUUGGAUGUAGUCCdTdT 582 7643 UGACUACAUCCAAGGGAAUdTdT 583
621 D-2856 7644 CUUGGAUGUAGUCUGAGGCdTdT 584 7645 UCCUCAGACUACAUCCAAGdTdT 585
633 D-2857 7646 CUGAGGCCCCUUAACUCACdTdT 586 7647 UUGAGUUAAGGGGCCUCAGdTdT 587
635 D-2858 7648 GAGGCCCCUUAACUCAUCCdTdT 588 7649 UGAUGAGUUAAGGGGCCUCdTdT 589
636 D-2859 7650 AGGCCCCUUAACUCAUCUCdTdT 590 7651 UAGAUGAGUUAAGGGGCCUdTdT 591
639 D-2860 7652 CCCCUUAACUCAUCUGUUCdTdT 592 7653 UAACAGAUGAGUUAAGGGGdTdT 593
640 D-2861 7654 CCCUUAACUCAUCUGUUACdTdT 594 7655 UUAACAGAUGAGUUAAGGGdTdT 595
641 D-2862 7656 CCUUAACUCAUCUGUUAUCdTdT 596 7657 UAUAACAGAUGAGUUAAGGdTdT 597
642 D-2863 7658 CUUAACUCAUCUGUUAUCCdTdT 598 7659 UGAUAACAGAUGAGUUAAGdTdT 599
643 D-2864 7660 UUAACUCAUCUGUUAUCCCdTdT 600 7661 UGGAUAACAGAUGAGUUAAdTdT 601
644 D-2865 7662 UAACUCAUCUGUUAUCCUCdTdT 602 7663 UAGGAUAACAGAUGAGUUAdTdT 603
645 D-2866 7664 AACUCAUCUGUUAUCCUGCdTdT 604 7665 UCAGGAUAACAGAUGAGUUdTdT 605
654 D-2867 7666 GUUAUCCUGCUAGCUGUACdTdT 606 7667 UUACAGCUAGCAGGAUAACdTdT 607
660 D-2868 7668 CUGCUAGCUGUAGAAAUGCdTdT 608 7669 UCAUUUCUACAGCUAGCAGdTdT 609
661 D-2869 7670 UGCUAGCUGUAGAAAUGUCdTdT 610 7671 UACAUUUCUACAGCUAGCAdTdT 611
666 D-2870 7672 GCUGUAGAAAUGUAUCCUCdTdT 612 7673 UAGGAUACAUUUCUACAGCdTdT 613
667 D-2871 7674 CUGUAGAAAUGUAUCCUGCdTdT 614 7675 UCAGGAUACAUUUCUACAGdTdT 615
668 D-2872 7676 UGUAGAAAUGUAUCCUGACdTdT 616 7677 UUCAGGAUACAUUUCUACAdTdT 617
669 D-2873 7678 GUAGAAAUGUAUCCUGAUCdTdT 618 7679 UAUCAGGAUACAUUUCUACdTdT 619
673 D-2874 7680 AAAUGUAUCCUGAUAAACCdTdT 620 7681 UGUUUAUCAGGAUACAUUUdTdT 621
677 D-2875 7682 GUAUCCUGAUAAACAUUACdTdT 622 7683 UUAAUGUUUAUCAGGAUACdTdT 623
692 D-2876 7684 UUAAACACUGUAAUCUUACdTdT 624 7685 UUAAGAUUACAGUGUUUAAdTdT 625
698 D-2877 7686 ACUGUAAUCUUAAAAGUGCdTdT 626 7687 UCACUUUUAAGAUUACAGUdTdT 627
699 D-2878 7688 CUGUAAUCUUAAAAGUGUCdTdT 628 7689 UACACUUUUAAGAUUACAGdTdT 629
700 D-2879 7690 UGUAAUCUUAAAAGUGUACdTdT 630 7691 UUACACUUUUAAGAUUACAdTdT 631
701 D-2880 7692 GUAAUCUUAAAAGUGUAACdTdT 632 7693 UUUACACUUUUAAGAUUACdTdT 633
706 D-2881 7694 CUUAAAAGUGUAAUUGUGCdTdT 634 7695 UCACAAUUACACUUUUAAGdTdT 635
749 D-2882 7696 UACCUGUAGUGAGAAACUCdTdT 636 7697 UAGUUUCUCACUACAGGUAdTdT 637
770 D-2883 7698 UUAUGAUCACUUGGAAGACdTdT 638 7699 UUCUUCCAAGUGAUCAUAAdTdT 639
772 D-2884 7700 AUGAUCACUUGGAAGAUUCdTdT 640 7701 UAAUCUUCCAAGUGAUCAUdTdT 641
775 D-2885 7702 AUCACUUGGAAGAUUUGUCdTdT 642 7703 UACAAAUCUUCCAAGUGAUdTdT 643
781 D-2886 7704 UGGAAGAUUUGUAUAGUUCdTdT 644 7705 UAACUAUACAAAUCUUCCAdTdT 645
800 D-2887 7706 UAUAAAACUCAGUUAAAACdTdT 646 7707 UUUUUAACUGAGUUUUAUAdTdT 647
804 D-2888 7708 AAACUCAGUUAAAAUGUCCdTdT 648 7709 UGACAUUUUAACUGAGUUUdTdT 649
819 D-2889 7710 GUCUGUUUCAAUGACCUGCdTdT 650 7711 UCAGGUCAUUGAAACAGACdTdT 651
829 D-2890 7712 AUGACCUGUAUUUUGCCACdTdT 652 7713 UUGGCAAAAUACAGGUCAUdTdT 653
832 D-2891 7714 ACCUGUAUUUUGCCAGACCdTdT 654 7715 UGUCUGGCAAAAUACAGGUdTdT 655
833 D-2892 7716 CCUGUAUUUUGCCAGACUCdTdT 656 7717 UAGUCUGGCAAAAUACAGGdTdT 657
851 D-2893 7718 UAAAUCACAGAUGGGUAUCdTdT 658 7719 UAUACCCAUCUGUGAUUUAdTdT 659
854 D-2894 7720 AUCACAGAUGGGUAUUAACdTdT 660 7721 UUUAAUACCCAUCUGUGAUdTdT 661
855 D-2895 7722 UCACAGAUGGGUAUUAAACdTdT 662 7723 UUUUAAUACCCAUCUGUGAdTdT 663
857 D-2896 7724 ACAGAUGGGUAUUAAACUCdTdT 664 7725 UAGUUUAAUACCCAUCUGUdTdT 665
858 D-2897 7726 CAGAUGGGUAUUAAACUUCdTdT 666 7727 UAAGUUUAAUACCCAUCUGdTdT 667
859 D-2898 7728 AGAUGGGUAUUAAACUUGCdTdT 668 7729 UCAAGUUUAAUACCCAUCUdTdT 669
861 D-2899 7730 AUGGGUAUUAAACUUGUCCdTdT 670 7731 UGACAAGUUUAAUACCCAUdTdT 671
869 D-2900 7732 UAAACUUGUCAGAAUUUCCdTdT 672 7733 UGAAAUUCUGACAAGUUUAdTdT 673
891 D-2901 7734 UCAUUCAAGCCUGUGAAUCdTdT 674 7735 UAUUCACAGGCUUGAAUGAdTdT 675
892 D-2902 7736 CAUUCAAGCCUGUGAAUACdTdT 676 7737 UUAUUCACAGGCUUGAAUGdTdT 677
906 D-2903 7738 AAUAAAAACCCUGUAUGGCdTdT 678 7739 UCCAUACAGGGUUUUUAUUdTdT 679
907 D-2904 7740 AUAAAAACCCUGUAUGGCCdTdT 680 7741 UGCCAUACAGGGUUUUUAUdTdT 681
912 D-2905 7742 AACCCUGUAUGGCACUUACdTdT 682 7743 UUAAGUGCCAUACAGGGUUdTdT 683
913 D-2906 7744 ACCCUGUAUGGCACUUAUCdTdT 684 7745 UAUAAGUGCCAUACAGGGUdTdT 685
934 D-2907 7746 GAGGCUAUUAAAAGAAUCCdTdT 686 7747 UGAUUCUUUUAAUAGCCUCdTdT 687
944 D-2908 7748 AAAGAAUCCAAAUUCAAACdTdT 688 7749 UUUUGAAUUUGGAUUCUUUdTdT 689
947 D-2909 7750 GAAUCCAAAUUCAAACUACdTdT 690 7751 UUAGUUUGAAUUUGGAUUCdTdT 691

siRNA затем гибридизировали и исследовали в отношении нокдауна SOD1.

Пример 4. Pri и pre-микроРНК, нацеленные на SOD1

Дуплексы из сопровождающей цепи и направляющей цепи siRNA для SOD1, оказавшиеся эффективными, исходя из результатов экспериментов, представленных в примере 3, встраивали в векторы экспрессии с помощью методов генной инженерии и трансфицировали в клетки центральной нервной системы или линии нервных клеток. Даже если выступающий конец, используемый в исследовании нокдауна под действием siRNA, являлся каноническим dTdT для siRNA, выступающий конец в синтетической pri- или pre-miR может содержать любой динуклеотидный выступающий конец.

Используемые клетки могут представлять собой первичные клетки, или их можно получить из индуцированных плюрипотентных стволовых клеток (iPS клеток).

Нокдаун SOD1 затем измеряли и осуществляли глубокое секвенирование для определения точных сопровождающей цепи и направляющей цепи, получаемых в результате процессинга из каждой pri- или pre-микроРНК, введенной в векторе экспрессии.

Соотношение направляющей цепи и сопровождающей цепи рассчитывали для определения эффективности нокдауна, например, обработки РНК-индуцированным комплексом сайленсинга (RISC).

N-конец секвенировали для определения сайта расщепления и для определения процента равномерного расщепления мишени. Ожидалось, что расщепление составит более 90 процентов.

HeLa клетки подвергали совместной трансфекции в параллельном исследовании для in vitro анализа нокдауна SOD1. Конструкцию для люциферазы использовали в качестве контроля для определения нецелевых эффектов.

Снова осуществляли глубокое секвенирование.

Пример 5. Pri и pre-микроРНК, нацеленные на SOD1

В соответствии с настоящим изобретением разрабатывали pri и pre-микроРНК. Они приведены в таблицах 6A, 6B, 7A и 7B. Последовательности описаны в направлении от 5' к 3', и участки структуры «петля на стебле» разделены в таблице в этом порядке. В таблицах 7A и 7B составляющая «miR» в названии последовательности не обязательно соответствует нумерации последовательности генов miRNA (например, VOYmiR-101 является названием последовательности и не обязательно означает, что miR-101 является частью последовательности).

Таблица 6A. Последовательности pre-miR (5'-3')

Последовательность pre-miR (5'-3')
Название и
кратность активности (E)
Сопровождающая цепь SEQ ID NO Петля SEQ ID NO Направляющая цепь SEQ ID NO
VOYpre-001_D-2806_исходная конструкция
(18 нативных нуклеотидов, и в положении 19 находится C; 3'-концевой динуклеотид CC)
E= -33,8
CAAUGUGACUGCUGACAACCC 692 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-002_D-2806_p19MMU (в положении 19 находится U для образования несовпадения)
E= -34,2
CAAUGUGACUGCUGACAAUCC 694 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-003_D-2806_p19GU-пара (в положении 19 находится G для образования GU пары)
E= -38,1
CAAUGUGACUGCUGACAAGCC 695 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-004_D-2806_p19AU-пара (в положении 19 находится A для образования AU пары)
E= -38,1
CAAUGUGACUGCUGACAAGCC 696 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-005_D-2806_CMM (несовпадение в центре)
E= -33,0
CAAUGUGACAGCUGACAAACC 697 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-006_D-2806_p19DEL (положение 19 удалено)
E= -34,0
CAAUGUGACUGCUGACAACC 698 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-007_D-2806_p19ADD (нуклеотид добавлен в положении 19; добавлен U; сохранен C и концевой динуклеотид CC)
E= -32,8
CAAUGUGACUGCUGACAAUCCC 699 UGUGACCUGG 5 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-008_D-2806_Uпетля (повышенное содержание U в петле)
E= -33,8
CAAUGUGACUGCUGACAACCC 692 UGUGAUUUGG 6 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-009_D-2806_AUпетля (повышенное содержание AU в петле)
E= -33,8
CAAUGUGACUGCUGACAACCC 692 UAUAAUUUGG 7 UUUGUCAGCAGUCACAUUGUU 693
VOYpre-010_D-2806_mir-22-петля (обмен в петле из miR-22)
E= -30,0
CAAUGUGACUGCUGACAACAC 700 CCUGACCCAGU 8 UUUGUCAGCAGUCACAUUGUU 693

Таблица 6B. Последовательности pre-miR (5'-3')

Название и
кратность активности (E)
Направляющая цепь SEQ ID NO Петля SEQ ID NO Сопровождающая цепь SEQ ID NO
VOYpre-011_D-2806_замена местами сопровождающей цепи и направляющей цепи с концевым 3' C на сопровождающей цепи
E= -36,1
UUUGUCAGCAGUCACAUUGUC 701 UGUGACCUGG 5 CAAUGUGACUGCUGACAAAUC 702
VOYpre-012_D-2806_ замена местами сопровождающей цепи и направляющей цепи с концевым 3' C на сопровождающей цепи
E= -35,4
UUUGUCAGCAGUCACAUUGUC 701 UGUGACCUGG 5 CAAUGUGACUGCUGACAAUUC 703
VOYpre-013_D-2806_ замена местами сопровождающей цепи и направляющей цепи с концевым 3' C на сопровождающей цепи
E= -34,7
UUUGUCAGCAGUCACAUUGAC 704 CCUGACCCAGU 8 CAAUGUGACUGCUGACAAAUC 702

Таблица 7A. Последовательности pri-miR (5'-3')

Компоненты конструкции pri-miR 5' - 3'
Название и кратность активности (E) SEQ ID NO 5'-фланкирующего участка SEQ ID NO сопровождающей цепи SEQ ID NO петли SEQ ID NO направляющей цепи SEQ ID NO 3'-фланкирующего участка 5'-фланкирующие-3'-фланкирующие участки
SEQ ID NO
VOYmiR-101_pre-001 hsa-mir-155; D-2806
E= -63.7
1 692 5 693 10 747
VOYmiR-102_pre-001 сконструирован-ная; D-2806; стебель let-7b
E= -106.0
2 692 5 693 11 748
VOYmiR-103_pre-002 сконструирован-ная; D-2806_p19MMU; стебель let-7b
E= -106.4
2 694 5 693 11 749
VOYmiR-104_pre-003 сконструирован-ная; D-2806_p19GU-пара; стебель let-7b
E= -110.3
2 695 5 693 11 750
VOYmiR-105_pre-004 сконструирован-ная; D-2806_p19AU-пара; стебель let-7b
E= -110.3
2 696 5 693 11 751
VOYmiR-106_pre-005 сконструирован-ная; D-2806_CMM; стебель let-7b
E= -105.2
2 697 5 693 11 752
VOYmiR-107_pre-006 сконструирован-ная; D-2806_p19DEL; стебель let-7b
E= -106.2
2 698 5 693 11 753
VOYmiR-108_pre-007 сконструирован-ная; D-2806_p19ADD; стебель let-7b
E= -105.0
2 705 5 693 11 754
VOYmiR-109_pre-008 сконструирован-ная; D-2806_Uпетля; стебель let-7b
E= -106.0
2 692 6 693 11 755
VOYmiR-110_pre-009 сконструирован-ная; D-2806_AUпетля; стебель let-7b
E= -106.0
2 692 7 693 11 756
VOYmiR-111_pre-010 сконструирован-ная; D-2806_mir-22-петля; стебель let-7b
E= -102.2
2 700 8 693 11 757
VOYmiR-112_pre-001 сконструирован-ная; PD; D-2806; нестабильность базового стебля let-7b
E= -102.3
2 692 5 693 12 758
VOYmiR-113_pre-002 сконструирован-ная; D-2806_p19MMU; нестабильность базового стебля let-7b
E= -102.7
2 694 5 693 12 759
VOYmiR-114_pre-005 сконструирован-ная; D-2806_CMM; нестабильность базового стебля let-7b
E= -101.5
2 697 5 693 12 760
VOYmiR-115_pre-010 сконструирован-ная; D-2806_mir-22-петля; нестабильность базового стебля let-7b
E= -98.5
2 700 8 693 12 761
VOYmiR-116_pre-003 сконструирован-ная; D-2806_p19GU-пара; нестабильность базового стебля let-7b
E= -110.1
2 695 5 693 12 762
VOYmiR-117_pre-001 сконструирован-ная; D-2757; стебель let-7b
E= -106.9
2 706 5 707 11 763
VOYmiR-118_pre-001 сконструирован-ная; D-2823; стебель let-7b
E= -108.7
2 708 5 709 11 764
VOYmiR-119_pre-001 сконструирован-ная; D-2866; стебель let-7b 2 710 5 711 11 765
VOYmiR-127 3 692 9 693 13 766
VOYmiR-102.860 2 712 5 713 11 767
VOYmiR102.861 2 714 5 715 11 768
VOYmiR-102.866 2 716 5 711 11 769
VOYmiR-102.870 2 717 5 718 11 770
VOYmiR-102.823 2 719 5 709 11 771
VOYmiR-104.860 2 720 5 713 11 772
VOYmiR-104.861 2 721 5 715 11 773
VOYmiR-104.866 2 722 5 711 11 774
VOYmiR-104.870 2 723 5 718 11 775
VOYmiR-104.823 2 724 5 709 11 776
VOYmiR-109.860 2 712 6 713 11 777
VOYmiR-104.861 2 714 6 715 11 778
VOYmiR-104.866 2 716 6 711 11 779
VOYmiR-109.870 2 717 6 718 11 780
VOYmiR-109.823 2 719 6 709 11 781
VOYmiR-114.860 2 725 5 713 12 782
VOYmiR-114.861 2 726 5 715 12 783
VOYmiR-114.866 2 727 5 711 12 784
VOYmiR-114.870 2 728 5 718 12 785
VOYmiR-114.823 2 729 5 709 12 786
VOYmiR-116.860 2 720 5 713 12 787
VOYmiR-116.861 2 721 5 715 12 788
VOYmiR-116.866 2 730 5 711 12 789
VOYmiR-116.870 2 723 5 718 12 790
VOYmiR-116.823 2 724 5 709 12 791
VOYmiR-127.860 3 731 9 713 13 792
VOYmiR-127.861 3 714 9 715 13 793
VOYmiR-127.866 3 716 9 711 13 794
VOYmiR-127.870 3 717 9 718 13 795
VOYmiR-127.823 3 732 9 709 13 796

Таблица 7B. Последовательности pri-miR (5'-3')

Название SEQ ID NO 5'-фланкирующего участка SEQ ID NO направляющей цепи SEQ ID NO петли SEQ ID NO сопровождающей цепи SEQ ID NO 3'-фланкирующего участка 5'-фланкирующие-3'-фланкирующие участки
SEQ ID NO
VOYmiR-120 4 733 5 734 810 797

Пример 6. Pri и pre-микроРНК, нацеленные на SOD1; исследование in vivo

Исследования in vivo осуществляли для оценки эффективности конструкций pri- или pre-микроРНК из примера 5.

В таблице 8 приведены подлежащие исследованию переменные схемы эксперимента.

Конструкция модулирующих нуклеиновых кислот (pri или pre-микроРНК) включала петлевой участок, полученный из miR30, стеблевой участок, полученный из let7, и различные комбинации сопровождающих цепей, которые варьировали в участках вздутий, ошибочно спаренных оснований и асимметричных участках.

Таблица 8. Схема эксперимента

Переменная Варианты выбора
Серотип AAV AAVrh10, AAV9
Вид NHP (отличный от человека примат), свинья, овца, грызун
Путь доставки Внутрипоясничный, внутригрудной, внутрицервикальный; CM
В одно место, несколько мест
Концентрация вектора 1×1013 вг/мл
Скорость инфузии Струйное вливание (0,3-1 мл/мин), 1 мл/час
Длительность инфузии 1-3 минуты, 1 час, 10 часов
Общая доза 3×1013 вг (векторных геномов)
Положение животного Лежа, стоя
Катетер Имплантируемый, кратковременный/регулируемый
Мечение вектора Без метки, MRI - гадолиний; PET - 124I или -цирконий

Пример 7. Конструкции pri-miRNA в AAV-miRNA векторах

Дуплексы из сопровождающей цепи и направляющей цепи siRNA для SOD1, приведенные в таблице 7, встраивали с помощью методов генной инженерии в AAV-miRNA векторы экспрессии. Конструкция при перечислении от ITR к ITR в направлении от 5' к 3' содержит мутантный ITR, промотор (любой из промотора CMV, U6 или CB6 (который включает в себя энхансер CMVie, промотор CBA и интрон SV40), конструкцию pri-miRNA из таблицы 7, полиА из гена глобина кролика и ITR дикого типа. In vitro и in vivo исследования осуществляли для оценки эффективности AAV-miRNA векторов экспрессии.

Пример 8. Активность конструкций pri-miRNA в клетках HeLa

Семь конструкций pri-miRNA, описанных в примере 7 (VOYmiR-103, VOYmiR-105, VOYmiR-108, VOYmiR-114, VOYmiR-119, VOYmiR-120 и VOYmiR-127), и контроль в виде двухцепочечного вектора с mCherry трансфицировали в HeLa для исследования активности конструкций.

A. Активность сопровождающей цепи и направляющей цепи

Семь конструкций pri-miRNA и контроль в виде двухцепочечного вектора с mCherry трансфицировали в клетки HeLa. Спустя 48 часов оценивали экспрессию эндогенной мРНК. Все семь конструкций pri-miRNA показывали высокую активность направляющей цепи с 75-80% нокдауном и низкую или отсутствующую активность сопровождающей цепи. Ведущие цепи кандидатных векторов miRNA показывали высокую активность, обеспечивая результат с 75-80% нокдауном SOD1, тогда как сопровождающие цепи демонстрировали незначительную активность или ее отсутствие.

B. Активность miRNA в отношении SOD1

Семь конструкций pri-miRNA и контроль в виде двухцепочечного вектора с mCherry (dsmCherry) трансфицировали в HeLa клетки при MOI (множественность заражения) 1e4 вг/клетку, 1e3 вг/клетку или 1e2 вг/клетку. Спустя 72 часа оценивали экспрессию эндогенной мРНК. Все семь из конструкций pri-miRNA показывали эффективный нокдаун при 1e3 вг/клетку. Большинство конструкций pri-мРНК показывали высокую активность (75-80% нокдаун), что показано на фиг. 2.

Пример 9. Активность конструкций pri-miRNA

Тридцать конструкций pri-miRNA, описанных в примере 7 (VOYmiR-102.860, VOYmiR-102.861, VOYmiR-102.866, VOYmiR-102.870, VOYmiR-102.823, VOYmiR-104.860, VOYmiR-104.861, VOYmiR-104.866, VOYmiR-104.870, VOYmiR-104.823, VOYmiR-109.860, VOYmiR-109.861, VOYmiR-109.866, VOYmiR-109.870, VOYmiR-109.823, VOYmiR-114.860, VOYmiR-114.861, VOYmiR-114.866, VOYmiR-114.870, VOYmiR-114.823, VOYmiR-116.860, VOYmiR-116.861, VOYmiR-116.866, VOYmiR-116.870, VOYmiR-116.823, VOYmiR-127.860, VOYmiR-127.861, VOYmiR-127.866, VOYmiR-127.870, VOYmiR-127.823) и контроль в виде VOYmiR-114 и двухцепочечного вектора с mCherry трансфицировали в клетки для исследования активности конструкций.

A. Активность сопровождающей цепи и направляющей цепи в HEK293

Тридцать конструкций pri-miRNA и два контроля трансфицировали в клетки HEK293T. Спустя 24 часа оценивали экспрессию эндогенной мРНК. Большинство конструкций pri-мРНК показывали высокую активность направляющей цепи (фиг. 3) и низкую или отсутствующую активность сопровождающей цепи (фиг. 4).

B. Активность сопровождающей цепи и направляющей цепи в HeLa

Тридцать конструкций pri-miRNA и два контроля трансфицировали в клетки HeLa. Спустя 48 часов оценивали экспрессию эндогенной мРНК. Большинство конструкций pri-мРНК показывали высокую активность направляющей цепи (фиг. 5) и низкую или отсутствующую активность сопровождающей цепи (фиг. 6).

C. Корреляция HeLa и HEK293

Нокдаун тридцати pri-miRNA был подобным у клеток HeLa и HEK293. Тридцать конструкций pri-miRNA показывали нокдаун для направляющей цепи для конструкций (см. фиг. 3 и фиг. 5). Большинство направляющих цепей конструкций pri-miRNA показывали 70-90% нокдаун.

D. Выбор капсида

Лучшие конструкции pri-miRNA из клеток HeLa и HEK293 упаковывали в AAV и инфицированию ими подвергали HeLa. Для определения лучшего AAV для упаковки конструкций вектор с mCherry, упакованный либо в AAV2, либо в AAV-DJ8, инфицировали в HeLa при MOI 10 вг/клетку, 1e2 вг/клетку, 1e3 вг/клетку, 1e4 вг/клетку или 1e5 вг/клетку и экспрессию оценивали через 40 часов. AAV2 выбрали в качестве капсида для упаковки лучших конструкций pri-miR.

E. Получение AAV2

Лучшие конструкции pri-miRNA из HeLa и HEK293 упаковывали в AAV2 (1,6 т. о.), также упаковывали и контроль в виде двухцепочечного вектора с mCherry (dsmCherry). Упакованные конструкции подвергали очистке с использованием йодиксанола перед анализом. Титр AAV показан в таблице 9.

Таблица 9. Титр AAV

Конструкция Титр AAV (геномов на мкл)
VOYmir-102.860 5,5E+08
VOYmir-102.861 1,0E+09
VOYmir-102.823 9,1E+08
VOYmir-104.861 1,2E+09
VOYmir-104.866 8,0E+08
VOYmir-104.823 5,7E+08
VOYmir-109.860 3,1E+08
VOYmir-109.861 8,9E+08
VOYmir-109.866 6,0E+08
VOYmir-109.823 6,0E+08
VOYmir-114.860 4,7E+08
VOYmir-114.861 3,7E+08
VOYmir-114.866 1,0E+09
VOYmir-144.823 1,7E+09
VOYmir-116.860 1,0E+09
VOYmir-116.866 9,1E+08
VOYmir-127.860 1,2E+09
VOYmir-127.866 9,0E+08
dsmCherry 1,2E+09

Влияние трансдукции на нокдаун SOD1 в клетках HeLa показано на фиг. 7. Кроме того, в HeLa клетках большая MOI (1,0E+04 по сравнению с 1,0E+05) не показывала повышенный нокдаун для каждой конструкции.

F. Активность конструкций в предшественниках двигательных нейронов человека (HMNP)

Лучшие 18 конструкций с pri-miRNA, которые описаны в примере 9E, и контроль с mCherry инфицировали в клетки-предшественники двигательных нейронов человека (HMNP) при MOI 10E5. Спустя 48 часов оценивали экспрессию эндогенной мРНК. Приблизительно половина конструкций давали более чем 50% сайленсинг SOD1 в HMNP, и 4 из них давали более чем 70% сайленсинг (фиг. 8).

G. Выбор конструкции для in vivo исследований

Выбирали лучшие двенадцать конструкций с упакованными pri-miRNA, которые оказывали значительное влияние на целевую последовательность и незначительное влияние на кассету. Эти конструкции, упакованные в капсиды AAV-rh10, составляли для инъекции и вводили млекопитающим для изучения in vivo эффектов конструкций.

H. Активность в различных линиях клеток

Активность конструкций с упакованными pri-miRNA изучали в клетках HeLa, SH-SY5Y, U87MG и первичных астроцитах человека. Активность в клетках HeLa варьировала от 1 до 5 пМ. Активность в клетках SH-SY5Y варьировала от 13 до 17 пМ. Активность в клетках U87MG составляла приблизительно 1 пМ. Активность в первичных астроцитах человека варьировала от 49 до 123 пМ.

Пример 10. in Vitro исследование pri-miRNA

18 pri-miRNA и контроль mCherry, описанные в примере 9D, упакованные в AAV2, использовали для этого исследования. Для этого исследования HEK293T клетки (Fisher Scientific, кат. № HCL4517) в среде культивирования (500 мл DMEM/F-12 с добавкой GLUTAMAXTM (Life Technologies, кат. № 10565-018), 50 мл FBS (Life Technologies, кат. № 16000-044, партия:1347556), 5 мл раствора заменимых аминокислот в MEM (100x) (кат. № 11140-050) и 5 мл HEPES (1 М) (Life Technologies, кат. № 15630-080)), U251MG клетки (P18) (Sigma, кат. № 09063001-1VL) в среде культивирования (500 мл DMEM/F-12 с добавкой GLUTAMAXTM (Life Technologies, кат. № 10565-018), 50 мл FBS (Life Technologies, кат. № 16000-044, партия:1347556), 5 мл раствора заменимых аминокислот в MEM (100x) (кат. № 11140-050) и 5 мл HEPES (1 М) (Life Technologies, кат. № 15630-080)) или нормальные астроциты человека (HA) (Lonza, кат. № CC-2565) в среде культивирования (базовая среда ABM, 500 мл (Lonza, кат. № CC-3186), дополненной набором AGM SingleQuot Kit Suppl. и ростовыми факторами (Lonza, кат. № CC-4123)) использовали для исследования конструкций. Высевали HEK293T клетки (5×10E4 клеток/лунку в 96-луночном планшете), U251MG клетки (2×10E4 клеток/лунку в 96-луночном планшете) и HA клетки (2×10E4 клеток/лунку в 96-луночном планшете) и значение MOI, используемое для инфицирования клеток, составляло 1,0E+05. Спустя 48 часов клетки анализировали, и результаты показаны в таблице 10.

Таблица 10. Относительный уровень мРНК SOD1

Конструкция Относительный уровень мРНК SOD1 (%) (нормализован к GAPDH)
HEK293T U251MG HA
VOYmiR-102.823 19.5 49.6 87.3
VOYmiR-102.860 1.7 5.3 19.2
VOYmiR-102.861 1.1 13.9 42.6
VOYmiR-104.823 49.9 69.6 102.7
VOYmiR-104.861 1.0 10.7 36.3
VOYmiR-104.866 12.3 54.6 85.5
VOYmiR-109.823 23.0 46.1 84.6
VOYmiR-109.860 1.9 8.3 35.6
VOYmiR-109.861 1.9 22.7 57.3
VOYmiR-109.866 4.1 38.5 67.9
VOYmiR-114.823 19.3 44.7 82.3
VOYmiR-114.860 1.4 4.7 17.6
VOYmiR-114.861 1.1 9.7 48.1
VOYmiR-114.866 4.0 38.7 78.2
VOYmiR-116.860 1.1 4.8 15.8
VOYmiR-116.866 5.5 40.2 73.7
VOYmiR-127.860 1.0 2.1 7.4
VOYmiR-127.866 1.0 15.4 43.8
mCherry 100.0 100.2 100.1

Более чем 80% нокдаун наблюдали в HEK293T клетках для большинства конструкций. Более чем половина конструкций показывала более чем 80% нокдаун в U251MG клетках и в HA клетках.

Пример 11. Дозозависимое снижение уровня SOD1

Четыре из лучших 18 конструкций с pri-miRNA, которые описаны в примере 9E, и контроль с mCherry трансфицировали в клеточную линию астроцитов человека (U251MG) или первичные астроциты человека (HA) при MOI 1,0E+02, 1,0E+03, 1,0E+04, 1,0E+05 или 1,0E+06. Спустя 48 часов оценивали экспрессию эндогенной мРНК, и дозозависимый сайленсинг показан на фиг. 9 (U251MG) и фиг. 10 (HA). Для всех конструкций повышение дозы также коррелировало с повышением количества мРНК SOD1, которая подверглась нокдауну.

Пример 12. Длительность нокдауна SOD1

Две конструкции с pri-miRNA (VOYmiR-120 и VOYmiR-122), отрицательный контроль и положительный контроль с siRNA для SOD1 трансфицировали в клеточную линию астроцитов человека (U251MG). Относительное количество мРНК SOD1 определяли в течение 60 часов, как показано на фиг. 11. 70-75% нокдаун hSOD1 наблюдали в случае обеих конструкций с pri-miR после трансфекции с использованием нуклеофектора, причем наибольший нокдаун наблюдали во временном интервале 12-24 часа.

Пример 13. Нокдаун SOD1 и процентные соотношения цепей

OYmiR-104 трансфицировали в клетки HeLa в концентрации 50 пМ, 100 пМ и 150 пМ и сравнивали с необработанными (UT) клетками. Относительное количество мРНК SOD1, процент направляющей цепи и процент сопровождающей цепи определяли через 36, 72, 108 и 144 часа, как показано на фиг. 12A-12C. Наиболее высокая концентрация (150 пМ) показывала наибольшее снижение экспрессии, но все три дозы показывали значительное снижение экспрессии SOD1.

Пример 14. Pri-miRNA, нацеленные на SOD1

Разрабатывали pri-miRNA для SOD1 собаки, и конструкции приводены в таблице 11. SOD1 собаки является на 100% консервативной с человеческой в участке, подвергающемся целенаправленному воздействию согласно настоящему изобретению. Последовательности описаны в направлении от 5' к 3', и участки структуры «петля на стебле» разделены в таблице в этом порядке. В таблице 11 составляющая «miR» в названии последовательности не обязательно соответствует нумерации последовательности генов miRNA (например, dVOYmiR-102 является названием последовательности и не обязательно означает, что miR-102 является частью последовательности).

Таблица 11. Последовательности pri-miR собаки (5'-3')

Компоненты конструкции pri-miR 5' - 3'
Название SEQ ID NO 5'-фланкирующего участка SEQ ID NO сопровождающей цепи SEQ ID NO петли SEQ ID NO направляющей цепи SEQ ID NO 3'-фланкирующего участка 5'-фланкирующие-3'-фланкирующие участки
SEQ ID NO
dVOYmiR-102.788 2 735 5 736 11 798
dVOYmiR-102.805 2 737 5 738 11 799
dVOYmiR-104.788 2 739 5 736 11 800
dVOYmiR-104.805 2 740 5 738 11 801
dVOYmiR-109.788 2 741 6 736 11 802
dVOYmiR-109.805 2 742 6 738 11 803
dVOYmiR-114.788 2 743 5 736 12 804
dVOYmiR-114.805 2 744 5 738 12 805
dVOYmiR-116.788 2 741 5 736 12 806
dVOYmiR-116.805 2 742 5 738 12 807
dVoymiR-127.788 3 741 9 745 14 808
dVoymiR-127.805 3 742 9 746 14 809

Пример 15. Эффект положения модулирующих полинуклеотидов

A. Эффект в отношении титров вируса

Модулирующий полинуклеотид (VOYmiR-114 или VOYmiR-126) внедряли в вектор экспрессии (размер генома примерно 2400 нуклеотидов; scAAV) в шести различных положениях, как показано на фиг. 13. На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Титры вируса оценивали с использованием ПЦР TaqMan для 6 положений и для контроля (конструкция без модулирующего полинуклеотида; scAAV), и результаты показаны в таблице 12.

Таблица 12. Титры вируса

Модулирующий полинуклеотид Положение модулирующего полинуклеотида Титр вируса
(вг на 15 см чашку)
VOYmiR-114 Положение 1 5,5E+10
VOYmiR-114 Положение 2 5,5E+10
VOYmiR-114 Положение 3 4,5E+10
VOYmiR-114 Положение 4 3,7E+10
VOYmiR-114 Положение 5 6,5E+10
VOYmiR-114 Положение 6 2,5E+10
VOYmiR-126 Положение 1 1,6E+10
VOYmiR-126 Положение 2 3,2E+10
VOYmiR-126 Положение 3 6,0E+10
VOYmiR-126 Положение 4 1,6E+10
VOYmiR-126 Положение 5 9,5E+09
VOYmiR-126 Положение 6 6,0E+10
- Контроль 2,1E+11

B. Эффект в отношении целостности генома

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (размер генома 2400 нуклеотидов; scAAV) в шести разных положениях, а также использовали контроль без модулирующего полинуклеотида (scAAV), как показано на фиг. 13. На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Вирусные геномы экстрагировали из очищенных препаратов AAV и разгоняли на нейтральном агарозном геле. Усеченные геномы наблюдали во всех конструкциях, и примерный процент усеченных геномов (процент от общего числа) показан в таблице 13.

Таблица 13. Усеченные геномы

Конструкция % от общего числа
Положение 1 50
Положение 2 42
Положение 3 49
Положение 4 34
Положение 5 33
Положение 6 59
Контроль 9

Положение 6 характеризовалось наибольшим числом усеченных геномов, в то время как положения 4 и 5 характеризовались наименьшим количеством усеченных геномов.

C. Эффект в отношении эффективности нокдауна

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (AAV2) (размер генома 2400 нуклеотидов; scAAV) в шести разных положениях, как показано на фиг. 13. На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Трансдукцию HeLa клеток проводили при 1×104 вг/клетку, 1×103 вг/клетку и 1×102 вг/клетку. Экспрессию мРНК SOD1 (в виде % от контроля (eGFP)) определяли через 72 часа после инфицирования, и результаты показаны в таблице 14.

Таблица 14. Экспрессия SOD1

Конструкция Экспрессия мРНК SOD1 (% от контроля)
1×104 вг/клетка 1×103 вг/клетка 1×102 вг/клетка
Положение 1 40 59 69
Положение 2 31 46 75
Положение 3 50 66 81
Положение 4 21 34 55
Положение 5 49 52 67
Положение 6 31 37 62
Контроль (eGFP) 100 100 94

Положение 3 характеризовалось наивысшей экспрессией мРНК SOD1 (в виде % от контроля), а положение 4 характеризовалось самой низкой экспрессией мРНК SOD1 (в виде % от контроля).

Пример 16. Эффект в отношении размера генома

A. Эффект в отношении титров вируса

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (размер генома 2 т. о.; scAAV) в положениях 1, 2, 5 и 6, как показано на фиг. 13. На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Сравнивали контроль в виде двухцепочечного вектора без модулирующего полинуклеотида (размер генома 1,6 т. о.; scAAV ctrl) и двухцепочечный вектор экспрессии (scAAV miR114; ITR (105 нуклеотидов) -промотор (~900 нуклеотидов)-модулирующий полинуклеотид (158 нуклеотидов)- последовательность полиA (127 нуклеотидов) и ITR), а также контроль (eGFP; scAAV) без молекулы siRNA. Титры вируса оценивали с использованием ПЦР TaqMan, и результаты показаны в таблице 15.

Таблица 15. Титры вируса

Конструкция Размер Титр вируса (вг на 15 см чашку)
Положение 1 2 т. о. 9,5E+10
Положение 2 2 т. о. 1,2E+11
scAAV miR114 1,6 т. о. 1,1E+11
Положение 5 2 т. о. 2,4E+10
Положение 6 2 т. о. 1,1E+11
Контроль 2 т. о. 2,2E+11

Самые низкие титры вируса наблюдали с конструкцией в положении 5, а самые высокие - с конструкцией в положении 2.

B. Эффект в отношении целостности генома

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (размер генома 2 т. о.; scAAV) в положениях 1, 2, 5 и 6, как показано на фиг. 13. На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Сравнивали контроль в виде двухцепочечного вектора без модулирующего полинуклеотида (размер генома 1,6 т. о.; scAAV ctrl) и двухцепочечный вектор экспрессии (scAAV miR114; ITR (105 нуклеотидов) -промотор (~900 нуклеотидов)-модулирующий полинуклеотид (158 нуклеотидов)- последовательность полиA (127 нуклеотидов) и ITR), а также контроль (eGFP; scAAV) без молекулы siRNA. Усеченные геномы наблюдали во всех конструкциях, и примерный процент усеченных геномов (процент от общего числа) показан в таблице 16.

Таблица 16. Усеченные геномы

Конструкция Размер % от общего числа
Положение 1 2 т. о. 34
Положение 2 2 т. о. 30
scAAV miR114 1,6 т. о. 20
Положение 5 2 т. о. 21
Положение 6 2 т. о. 46
Контроль 2 т. о. 5

Было определено, что у все конструкции имели некоторое количество усеченных геномов.

Проводили дополнительное исследование для определения эффекта разных модулирующих полинуклеотидов. VOYmiR-114 и VOYmiR-126 внедряли в отдельные векторы экспресси (размер генома 1,6 т. о.; scAAV) с модулирующим полинуклеотидом возле 3'-ITR (прямая ориентация). В случае конструкции с VOYmiR-114 расстояние между 5'-концом векторного генома (1526 нуклеотидов) и центром модулирующего полинуклеотида (серединой гибкой петли) составляло 1115 нуклеотидов. В случае конструкции с VOYmiR-126 расстояние между 5'-концом векторного генома (1626 нуклеотидов) и центром модулирующего полинуклеотида (серединой гибкой петли) составляло 1164 нуклеотидов.

В случае конструкции с VOYmiR-114 титр вируса (вг на 15 см чашку) составлял приблизительно 1,1E+11. В случае конструкции с VOYmiR-126 титр вируса с зондом-интроном (вг на 15 см чашку) составлял приблизительно 1,2E+12. У контроля он составлял приблизительно 2,1E+11 (вг на 15 см чашку). VOYmir-114 имел приблизительно 20% усеченных геномов, VOYmiR-126 имел приблизительно 15% усеченных геномов, и контроль имел приблизительно 5% усеченных геномов.

Пример 17. Эффект одноцепочечных конструкций

A. Эффект в отношении титров вируса

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (размер генома 4,7 т. о.; ssAAV) в 1, 3 и 5 положениях, как показано на фиг. 13, а также исследовали контроль без модулирующего полинуклеотида (размер генома 2 т. о.; ssAAV). На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Титры вируса оценивали с использованием ПЦР TaqMan, и результаты показаны в таблице 17.

Таблица 17. Титры вируса

Конструкция Титр вируса (вг на 15 см чашку)
Положение 1 5,0E+11
Положение 3 7,5E+11
Положение 5 3,5E+11
Контроль 2,5E+11

Положение 3 показывало наибольшие титры вируса, за ним следовало положение 1, а затем положение 5.

B. Эффект в отношении целостности генома

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (размер генома 4,7 т. о.; ssAAV) в 1, 3 и 5 положениях, как показано на фиг. 13, а также исследовали контроль без модулирующего полинуклеотида (размер генома 2 т. о.; ssAAV). На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Вирусные геномы экстрагировали из очищенных препаратов AAV и разгоняли на нейтральном агарозном геле. Усеченные геномы наблюдали во всех конструкциях, и примерный процент усеченных геномов (процент от общего числа) показан в таблице 18.

Таблица 18. Усеченные геномы

Конструкция % от общего числа
Положение 1 48
Положение 3 30
Положение 5 72
Контроль 0

Положение 5 характеризовалось наибольшим числом усеченных геномов, в то время как положение 3 характеризовалось наименьшим количеством усеченных геномов.

C. Эффект в отношении эффективности нокдауна

Модулирующий полинуклеотид (VOYmiR-114) внедряли в вектор экспрессии (размер генома 4,7 т. о.; ssAAV) в 1, 3 и 5 положениях, как показано на фиг. 13, и также присутствовал одноцепочечный контроль без модулирующего полинуклеотида (размер генома 2 т. о.; контроль ssAAV), двухцепочечной контроль без модулирующего полинуклеотида (размер генома 1,6 т. о.; контроль scAAV) и контроль в виде двухцепочечного вектора экспрессии (scAAV miR114; ITR (105 нуклеотидов) -промотор (~900 нуклеотидов) -модулирующий полинуклеотид (158 нуклеотидов) -последовательность полиА (127 нуклеотидов) и ITR). На фиг. 13 «ITR» представляет собой инвертированный концевой повтор, «I» представляет собой интрон, «P» представляет собой полиA, и «MP» представляет собой модулирующий полинуклеотид. Трансдукцию HeLa клеток проводили при 1×104 вг/клетку, 1×103 вг/клетку и 1×102 вг/клетку. Экспрессию мРНК SOD1 (в виде % от контроля (eGFP)) определяли через 72 часа после инфицирования, и результаты показаны в таблице 19.

Таблица 19. Экспрессия SOD1

Конструкция Экспрессия мРНК SOD1 (% от контроля)
1×104 вг/клетка 1×103 вг/клетка 1×102 вг/клетка
Положение 1 62 85 87
Положение 3 77 93 99
Положение 5 59 82 84
ssAAV ctrl 100 101 108
scAAV ctrl 95 97 102
scAAV miR114 23 33 62

Положение 3 характеризовалось наивысшей экспрессией мРНК SOD1 (в виде % от контроля), затем следовало положение 1, и у одноцепочечных конструкций самая низкая экспрессия мРНК SOD1 (в виде % от контроля) была в положении 5. Ни одна из одноцепочечных конструкций не характеризовалась эффективностью нокдауна, которая была не ниже чем у контроля в виде двухцепочечного вектора с модулирующим полинуклеотидом.

Пример 18. Нокдаун SOD1 in vivo

Для оценки in vivo биологической активности pri-miRNA самокомплементарные pri-miRNA (VOYmiR-114.806, VOYmiR127.806, VOYmiR102.860, VOYmiR109.860, VOYmiR114.860, VOYmiR116.860, VOYmiR127.860, VOYmiR102.861, VOYmiR104.861, VOYmiR109.861, VOYmiR114.861, VOYmiR109.866, VOYmiR116.866 или VOYmiR127.866) упаковывали в AAV-DJ с промотором CBA.

У мышей эти упакованные pri-miRNA или контроль, содержащий только среду (фосфатно-солевой буферный раствор с 5% сорбита и 0,001% F-68), вводили посредством 10-минутной интрастриарной инфузии. Самки или самцы Tg(SOD1)3Cje/J мышей (Jackson Laboratory, Бар Харбор, Мэн), у которых экспрессировалась SOD1 человека и которые имели массу тела примерно 20-30 г, получали односторонние инъекции 5 мкл исследуемого препарата, которые были нацелены на стриатум (+0,5 мм в передне-заднем направлении,+2 мм в срединно-боковом направлении относительно брегмы; 3,8 мм в спинно-брюшном направлении относительно поверхности черепа). Исследуемые препараты вводили инъекцией (5 животных на исследуемый препарат) со скоростью 0,5 мкл/мин. с использованием предварительно заполненных, регулируемых насосом микрошприцов Hamilton (модель 1701, 10 μмкл) с иглами 33 калибра. Через 1, 2, 3, 4 или 6 недель после инъекции животных умерщвляли, головной мозг удаляли и ипсилатеральный стриатум, охватывающий места инфузии из 1 мм слоя в коронарной проекции, а также ткань стриатума из смежных 1 мм слоев в коронарной проекции, вырезали и подвергали быстрой заморозке. Образцы ткани мышей лизировали и проводили количественное определение уровней белка SOD1 человека и уровней мРНК SOD1 и GAPDH мыши (mGAPDH). Уровни белка SOD1 количественно определяли с помощью ELISA (eBioscience (Affymetrix, Сан-Диего, Калифорния)) и уровни общего белка количественно определяли с помощью BCA анализа (ThermoFisher Scientific, Уолтем, Массачусетс). Для каждого образца ткани уровень белка SOD1, нормализованный к общему белку, рассчитывали в виде среднего значения от 2 определений. Эти нормализованные уровни белка SOD1 дополнительно нормализовали к группе, получавшей среду, затем усредняли с получением среднего значения для группы (подвергавшейся обработке). Уровни мРНК SOD1 и mGAPDH количественно определяли с помощью qRT-PCR (количественная ПЦР в реальном времени). Для каждого образца ткани соотношение SOD1/mGAPDH (нормализованный уровень мРНК SOD1) рассчитывали в виде среднего значения от 3 определений. Эти соотношения затем усредняли с получением среднего значения для группы (подвергавшейся обработке). Эти средние значения для групп дополнительно нормализовали к группе, получавшей среду.

У приматов, за исключением человека, исследуемые препараты (1×1013-3×1013вг с pri-miRNA, упакованных в AAV-DJ с промотором CBA) или среду вводили посредством интратекальной струйной инъекции в позвоночный отдел. Самкам яванского макака (Macaca fascicularis, CR Research Model Houston, Хьюстон, Техас) с массой тела примерно 2,5-8,5 кг имплантировали один интратекальный катетер, причем кончик катетера располагался в поясничном отделе позвоночника. Вводили исследуемые препараты (4 животных на исследуемый препарат), причем введение предусматривало три струйные инъекции 1 мл (1 мл/минуту) с интервалами примерно 60 минут. Через 4-6 недель после введения животных умерщвляли и выбранные ткани собирали для биоаналитической и гистологической оценки. Уровни белка SOD1 и мРНК оценивали в отношении супрессии после обработки pri-miRNA, упакованной в AAV-DJ с промотором CBA в сравнении с группой, получавшей среду.

Пример 19. Нокдаун SOD1 in vivo с использованием VOYmiR-114.806

Мышам линии Tg(SOD1)3Cje/J VOYmiR-114.806, вводили упакованный в AAVDJ с промотором CBA, как описано в примере 18. Мышам вводили посредством одностороннего интрастриатарного введения дозу 3,7×109 вг. Спустя 1 или 2 недели не наблюдалось существенного снижения нормализованных уровней белка SOD1; нормализованные уровни белка SOD1 составляли 98+11% (стандартное отклонение) и 98+10% от уровня у контрольной группы, получавшей среду, спустя 1 и 2 недели, соответственно. К 3 неделе VOYmiR-114.806 снижала нормализованный уровень белка SOD1 до 84+9,0% относительно контрольной группы, получавшей среду, что было статистически значимым (p<0,05, однофакторный дисперсионный анализ с апостериорным анализом с использованием критерия Даннетта). К 4 и 6 неделям VOYmiR-114.806 снижала нормализованный уровень белка SOD1 до 73+7,9% (p < 0,0001) и 75+7,4% (p<0,0001), соответственно, от уровня у контрольной группы, получавшей среду. Эти результаты демонстрируют, что VOYmiR-114.806, упакованная в AAV-DJ с промотором CBA, является эффективной in vivo в понижающей модуляции уровней белка SOD1. Кроме того, эти результаты демонстрируют, что суммарная интрастриарная доза от 3,7×109 вг с VOYmiR-114.806, упакованной в AAVDJ с промотором CBA, приводила в результате к значительной понижающей модуляции уровней белка SOD1.

Хотя настоящее изобретение было описано в некотором объеме и с некоторыми подробностями в отношении нескольких описанных вариантов осуществления, не предполагается, что оно должно ограничиваться любыми такими подробностями или вариантами осуществления или любым конкретным вариантом осуществления, а его следует толковать с учетом прилагаемой формулы изобретения для того, чтобы обеспечить наиболее широкую возможную интерпретацию таких пунктов формулы изобретения в связи с уровнем техники и, следовательно, чтобы эффективно охватить предусмотренный объем настоящего изобретения.

Все публикации, патентные заявки, патенты и другие источники, упомянутые в данном документе, включены во всей своей полноте посредством ссылки. В случае конфликта настоящее описание, в том числе определения, будет иметь преимущество. Кроме того, заголовки разделов, материалы, способы и примеры являются лишь иллюстративными и не предназначены для ограничения.

--->

СПИСОК ПОСЛЕДОВАТЕЛЬНОСТЕЙ

<110> VOYAGER THERAPEUTICS, INC.

<120> МОДУЛИРУЮЩИЕ ПОЛИНУКЛЕОТИДЫ

<130> 2057.1014PCT

<140> PCT/US2015/XXXXXX

<141> 2015-11-13

<150> 62/234,477

<151> 2015-09-29

<150> 62/212,004

<151> 2015-08-31

<150> 62/079,590

<151> 2014-11-14

<160> 810

<170> PatentIn, версия 3.5

<210> 1

<211> 50

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 1

uuuaugccuc auccucugag ugcugaaggc uugcuguagg cuguaugcug 50

<210> 2

<211> 54

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 2

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaa 54

<210> 3

<211> 100

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 3

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga 100

<210> 4

<211> 54

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 4

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggga 54

<210> 5

<211> 10

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 5

ugugaccugg 10

<210> 6

<211> 10

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 6

ugugauuugg 10

<210> 7

<211> 10

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 7

uauaauuugg 10

<210> 8

<211> 11

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 8

ccugacccag u 11

<210> 9

<211> 18

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 9

gucugcaccu gucacuag 18

<210> 10

<211> 50

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 10

aguguaugau gccuguuacu agcauucaca uggaacaaau ugcugccgug 50

<210> 11

<211> 52

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 11

cugaggagcg ccuugacagc agccauggga gggccgcccc cuaccucagu ga 52

<210> 12

<211> 52

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 12

cuguggagcg ccuugacagc agccauggga gggccgcccc cuaccucagu ga 52

<210> 13

<211> 100

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 13

uggccgugua gugcuaccca gcgcuggcug ccuccucagc auugcaauuc cucucccauc 60

ugggcaccag ucagcuaccc uggugggaau cuggguagcc 100

<210> 14

<211> 99

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 14

ggccguguag ugcuacccag cgcuggcugc cuccucagca uugcaauucc ucucccaucu 60

gggcaccagu cagcuacccu ggugggaauc uggguagcc 99

<210> 15

<211> 981

<212> ДНК

<213> Homo sapiens

<400> 15

gtttggggcc agagtgggcg aggcgcggag gtctggccta taaagtagtc gcggagacgg 60

ggtgctggtt tgcgtcgtag tctcctgcag cgtctggggt ttccgttgca gtcctcggaa 120

ccaggacctc ggcgtggcct agcgagttat ggcgacgaag gccgtgtgcg tgctgaaggg 180

cgacggccca gtgcagggca tcatcaattt cgagcagaag gaaagtaatg gaccagtgaa 240

ggtgtgggga agcattaaag gactgactga aggcctgcat ggattccatg ttcatgagtt 300

tggagataat acagcaggct gtaccagtgc aggtcctcac tttaatcctc tatccagaaa 360

acacggtggg ccaaaggatg aagagaggca tgttggagac ttgggcaatg tgactgctga 420

caaagatggt gtggccgatg tgtctattga agattctgtg atctcactct caggagacca 480

ttgcatcatt ggccgcacac tggtggtcca tgaaaaagca gatgacttgg gcaaaggtgg 540

aaatgaagaa agtacaaaga caggaaacgc tggaagtcgt ttggcttgtg gtgtaattgg 600

gatcgcccaa taaacattcc cttggatgta gtctgaggcc ccttaactca tctgttatcc 660

tgctagctgt agaaatgtat cctgataaac attaaacact gtaatcttaa aagtgtaatt 720

gtgtgacttt ttcagagttg ctttaaagta cctgtagtga gaaactgatt tatgatcact 780

tggaagattt gtatagtttt ataaaactca gttaaaatgt ctgtttcaat gacctgtatt 840

ttgccagact taaatcacag atgggtatta aacttgtcag aatttctttg tcattcaagc 900

ctgtgaataa aaaccctgta tggcacttat tatgaggcta ttaaaagaat ccaaattcaa 960

actaaaaaaa aaaaaaaaaa a 981

<210> 16

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 16

cggaggucug gccuauaaa 19

<210> 17

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 17

uuuauaggcc agaccuccg 19

<210> 18

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 18

ggaggucugg ccuauaaag 19

<210> 19

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 19

cuuuauaggc cagaccucc 19

<210> 20

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 20

gaggucuggc cuauaaagu 19

<210> 21

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 21

acuuuauagg ccagaccuc 19

<210> 22

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 22

aggucuggcc uauaaagua 19

<210> 23

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 23

uacuuuauag gccagaccu 19

<210> 24

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 24

ggucuggccu auaaaguag 19

<210> 25

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 25

cuacuuuaua ggccagacc 19

<210> 26

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 26

ucuggccuau aaaguaguc 19

<210> 27

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 27

gacuacuuua uaggccaga 19

<210> 28

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 28

cuggccuaua aaguagucg 19

<210> 29

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 29

cgacuacuuu auaggccag 19

<210> 30

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 30

uggccuauaa aguagucgc 19

<210> 31

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 31

gcgacuacuu uauaggcca 19

<210> 32

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 32

ggccuauaaa guagucgcg 19

<210> 33

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 33

cgcgacuacu uuauaggcc 19

<210> 34

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 34

gccuauaaag uagucgcgg 19

<210> 35

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 35

ccgcgacuac uuuauaggc 19

<210> 36

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 36

ccuauaaagu agucgcgga 19

<210> 37

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 37

uccgcgacua cuuuauagg 19

<210> 38

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 38

gucguagucu ccugcagcg 19

<210> 39

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 39

cgcugcagga gacuacgac 19

<210> 40

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 40

cguagucucc ugcagcguc 19

<210> 41

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 41

gacgcugcag gagacuacg 19

<210> 42

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 42

guagucuccu gcagcgucu 19

<210> 43

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 43

agacgcugca ggagacuac 19

<210> 44

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 44

uagucuccug cagcgucug 19

<210> 45

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 45

cagacgcugc aggagacua 19

<210> 46

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 46

auggcgacga aggccgugu 19

<210> 47

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 47

acacggccuu cgucgccau 19

<210> 48

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 48

cgacgaaggc cgugugcgu 19

<210> 49

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 49

acgcacacgg ccuucgucg 19

<210> 50

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 50

gaaggccgug ugcgugcug 19

<210> 51

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 51

cagcacgcac acggccuuc 19

<210> 52

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 52

ggccgugugc gugcugaag 19

<210> 53

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 53

cuucagcacg cacacggcc 19

<210> 54

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 54

agggcgacgg cccagugca 19

<210> 55

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 55

ugcacugggc cgucgcccu 19

<210> 56

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 56

ugcagggcau caucaauuu 19

<210> 57

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 57

aaauugauga ugcccugca 19

<210> 58

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 58

gcagggcauc aucaauuuc 19

<210> 59

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 59

gaaauugaug augcccugc 19

<210> 60

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 60

agggcaucau caauuucga 19

<210> 61

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 61

ucgaaauuga ugaugcccu 19

<210> 62

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 62

gggcaucauc aauuucgag 19

<210> 63

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 63

cucgaaauug augaugccc 19

<210> 64

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 64

ggcaucauca auuucgagc 19

<210> 65

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 65

gcucgaaauu gaugaugcc 19

<210> 66

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 66

gcaucaucaa uuucgagca 19

<210> 67

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 67

ugcucgaaau ugaugaugc 19

<210> 68

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 68

caucaucaau uucgagcag 19

<210> 69

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 69

cugcucgaaa uugaugaug 19

<210> 70

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 70

aauuucgagc agaaggaaa 19

<210> 71

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 71

uuuccuucug cucgaaauu 19

<210> 72

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 72

uucgagcaga aggaaagua 19

<210> 73

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 73

uacuuuccuu cugcucgaa 19

<210> 74

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 74

ucgagcagaa ggaaaguaa 19

<210> 75

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 75

uuacuuuccu ucugcucga 19

<210> 76

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 76

aagguguggg gaagcauua 19

<210> 77

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 77

uaaugcuucc ccacaccuu 19

<210> 78

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 78

ggugugggga agcauuaaa 19

<210> 79

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 79

uuuaaugcuu ccccacacc 19

<210> 80

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 80

gacugacuga aggccugca 19

<210> 81

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 81

ugcaggccuu cagucaguc 19

<210> 82

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 82

cugacugaag gccugcaug 19

<210> 83

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 83

caugcaggcc uucagucag 19

<210> 84

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 84

ugacugaagg ccugcaugg 19

<210> 85

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 85

ccaugcaggc cuucaguca 19

<210> 86

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 86

ugaaggccug cauggauuc 19

<210> 87

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 87

gaauccaugc aggccuuca 19

<210> 88

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 88

gaaggccugc auggauucc 19

<210> 89

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 89

ggaauccaug caggccuuc 19

<210> 90

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 90

ugcauggauu ccauguuca 19

<210> 91

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 91

ugaacaugga auccaugca 19

<210> 92

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 92

cauggauucc auguucaug 19

<210> 93

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 93

caugaacaug gaauccaug 19

<210> 94

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 94

ggauuccaug uucaugagu 19

<210> 95

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 95

acucaugaac auggaaucc 19

<210> 96

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 96

uuccauguuc augaguuug 19

<210> 97

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 97

caaacucaug aacauggaa 19

<210> 98

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 98

guucaugagu uuggagaua 19

<210> 99

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 99

uaucuccaaa cucaugaac 19

<210> 100

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 100

uucaugaguu uggagauaa 19

<210> 101

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 101

uuaucuccaa acucaugaa 19

<210> 102

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 102

ugaguuugga gauaauaca 19

<210> 103

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 103

uguauuaucu ccaaacuca 19

<210> 104

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 104

gaguuuggag auaauacag 19

<210> 105

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 105

cuguauuauc uccaaacuc 19

<210> 106

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 106

aggcuguacc agugcaggu 19

<210> 107

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 107

accugcacug guacagccu 19

<210> 108

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 108

ggcuguacca gugcagguc 19

<210> 109

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 109

gaccugcacu gguacagcc 19

<210> 110

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 110

gcagguccuc acuuuaauc 19

<210> 111

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 111

gauuaaagug aggaccugc 19

<210> 112

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 112

cagguccuca cuuuaaucc 19

<210> 113

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 113

ggauuaaagu gaggaccug 19

<210> 114

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 114

ucacuuuaau ccucuaucc 19

<210> 115

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 115

ggauagagga uuaaaguga 19

<210> 116

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 116

cuauccagaa aacacggug 19

<210> 117

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 117

caccguguuu ucuggauag 19

<210> 118

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 118

uauccagaaa acacggugg 19

<210> 119

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 119

ccaccguguu uucuggaua 19

<210> 120

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 120

auccagaaaa cacgguggg 19

<210> 121

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 121

cccaccgugu uuucuggau 19

<210> 122

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 122

ccagaaaaca cggugggcc 19

<210> 123

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 123

ggcccaccgu guuuucugg 19

<210> 124

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 124

gaaaacacgg ugggccaaa 19

<210> 125

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 125

uuuggcccac cguguuuuc 19

<210> 126

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 126

aaaacacggu gggccaaag 19

<210> 127

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 127

cuuuggccca ccguguuuu 19

<210> 128

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 128

cggugggcca aaggaugaa 19

<210> 129

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 129

uucauccuuu ggcccaccg 19

<210> 130

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 130

aggaugaaga gaggcaugu 19

<210> 131

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 131

acaugccucu cuucauccu 19

<210> 132

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 132

augaagagag gcauguugg 19

<210> 133

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 133

ccaacaugcc ucucuucau 19

<210> 134

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 134

gagaggcaug uuggagacu 19

<210> 135

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 135

agucuccaac augccucuc 19

<210> 136

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 136

agaggcaugu uggagacuu 19

<210> 137

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 137

aagucuccaa caugccucu 19

<210> 138

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 138

auguuggaga cuugggcaa 19

<210> 139

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 139

uugcccaagu cuccaacau 19

<210> 140

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 140

guuggagacu ugggcaaug 19

<210> 141

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 141

cauugcccaa gucuccaac 19

<210> 142

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 142

ggagacuugg gcaauguga 19

<210> 143

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 143

ucacauugcc caagucucc 19

<210> 144

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 144

ggcaauguga cugcugaca 19

<210> 145

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 145

ugucagcagu cacauugcc 19

<210> 146

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 146

caaugugacu gcugacaaa 19

<210> 147

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 147

uuugucagca gucacauug 19

<210> 148

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 148

cugacaaaga ugguguggc 19

<210> 149

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 149

gccacaccau cuuugucag 19

<210> 150

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 150

ugacaaagau gguguggcc 19

<210> 151

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 151

ggccacacca ucuuuguca 19

<210> 152

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 152

cucaggagac cauugcauc 19

<210> 153

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 153

gaugcaaugg ucuccugag 19

<210> 154

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 154

ucaggagacc auugcauca 19

<210> 155

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 155

ugaugcaaug gucuccuga 19

<210> 156

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 156

agaccauugc aucauuggc 19

<210> 157

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 157

gccaaugaug caauggucu 19

<210> 158

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 158

gaccauugca ucauuggcc 19

<210> 159

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 159

ggccaaugau gcaaugguc 19

<210> 160

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 160

auugcaucau uggccgcac 19

<210> 161

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 161

gugcggccaa ugaugcaau 19

<210> 162

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 162

cauuggccgc acacuggug 19

<210> 163

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 163

caccagugug cggccaaug 19

<210> 164

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 164

cgcacacugg ugguccaug 19

<210> 165

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 165

cauggaccac cagugugcg 19

<210> 166

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 166

cacacuggug guccaugaa 19

<210> 167

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 167

uucauggacc accagugug 19

<210> 168

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 168

acacuggugg uccaugaaa 19

<210> 169

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 169

uuucauggac caccagugu 19

<210> 170

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 170

ugguggucca ugaaaaagc 19

<210> 171

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 171

gcuuuuucau ggaccacca 19

<210> 172

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 172

ugguccauga aaaagcaga 19

<210> 173

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 173

ucugcuuuuu cauggacca 19

<210> 174

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 174

aaagcagaug acuugggca 19

<210> 175

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 175

ugcccaaguc aucugcuuu 19

<210> 176

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 176

gcagaugacu ugggcaaag 19

<210> 177

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 177

cuuugcccaa gucaucugc 19

<210> 178

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 178

augacuuggg caaaggugg 19

<210> 179

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 179

ccaccuuugc ccaagucau 19

<210> 180

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 180

ugacuugggc aaaggugga 19

<210> 181

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 181

uccaccuuug cccaaguca 19

<210> 182

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 182

gacuugggca aagguggaa 19

<210> 183

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 183

uuccaccuuu gcccaaguc 19

<210> 184

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 184

guacaaagac aggaaacgc 19

<210> 185

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 185

gcguuuccug ucuuuguac 19

<210> 186

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 186

acaaagacag gaaacgcug 19

<210> 187

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 187

cagcguuucc ugucuuugu 19

<210> 188

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 188

caaagacagg aaacgcugg 19

<210> 189

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 189

ccagcguuuc cugucuuug 19

<210> 190

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 190

aggaaacgcu ggaagucgu 19

<210> 191

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 191

acgacuucca gcguuuccu 19

<210> 192

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 192

gucguuuggc uuguggugu 19

<210> 193

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 193

acaccacaag ccaaacgac 19

<210> 194

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 194

ucguuuggcu uguggugua 19

<210> 195

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 195

uacaccacaa gccaaacga 19

<210> 196

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 196

cguuuggcuu gugguguaa 19

<210> 197

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 197

uuacaccaca agccaaacg 19

<210> 198

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 198

guuuggcuug ugguguaau 19

<210> 199

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 199

auuacaccac aagccaaac 19

<210> 200

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 200

uuggcuugug guguaauug 19

<210> 201

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 201

caauuacacc acaagccaa 19

<210> 202

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 202

ggcuuguggu guaauuggg 19

<210> 203

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 203

cccaauuaca ccacaagcc 19

<210> 204

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 204

gcuuguggug uaauuggga 19

<210> 205

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 205

ucccaauuac accacaagc 19

<210> 206

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 206

cuuguggugu aauugggau 19

<210> 207

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 207

aucccaauua caccacaag 19

<210> 208

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 208

ugugguguaa uugggaucg 19

<210> 209

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 209

cgaucccaau uacaccaca 19

<210> 210

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 210

gugguguaau ugggaucgc 19

<210> 211

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 211

gcgaucccaa uuacaccac 19

<210> 212

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 212

ugguguaauu gggaucgcc 19

<210> 213

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 213

ggcgauccca auuacacca 19

<210> 214

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 214

guaauuggga ucgcccaau 19

<210> 215

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 215

auugggcgau cccaauuac 19

<210> 216

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 216

uaauugggau cgcccaaua 19

<210> 217

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 217

uauugggcga ucccaauua 19

<210> 218

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 218

aauugggauc gcccaauaa 19

<210> 219

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 219

uuauugggcg aucccaauu 19

<210> 220

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 220

auugggaucg cccaauaaa 19

<210> 221

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 221

uuuauugggc gaucccaau 19

<210> 222

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 222

uugggaucgc ccaauaaac 19

<210> 223

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 223

guuuauuggg cgaucccaa 19

<210> 224

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 224

ugggaucgcc caauaaaca 19

<210> 225

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 225

uguuuauugg gcgauccca 19

<210> 226

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 226

gggaucgccc aauaaacau 19

<210> 227

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 227

auguuuauug ggcgauccc 19

<210> 228

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 228

aucgcccaau aaacauucc 19

<210> 229

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 229

ggaauguuua uugggcgau 19

<210> 230

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 230

ccaauaaaca uucccuugg 19

<210> 231

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 231

ccaagggaau guuuauugg 19

<210> 232

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 232

caauaaacau ucccuugga 19

<210> 233

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 233

uccaagggaa uguuuauug 19

<210> 234

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 234

aauaaacauu cccuuggau 19

<210> 235

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 235

auccaaggga auguuuauu 19

<210> 236

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 236

auaaacauuc ccuuggaug 19

<210> 237

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 237

cauccaaggg aauguuuau 19

<210> 238

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 238

uaaacauucc cuuggaugu 19

<210> 239

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 239

acauccaagg gaauguuua 19

<210> 240

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 240

aaacauuccc uuggaugua 19

<210> 241

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 241

uacauccaag ggaauguuu 19

<210> 242

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 242

aacauucccu uggauguag 19

<210> 243

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 243

cuacauccaa gggaauguu 19

<210> 244

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 244

auucccuugg auguagucu 19

<210> 245

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 245

agacuacauc caagggaau 19

<210> 246

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 246

cuuggaugua gucugaggc 19

<210> 247

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 247

gccucagacu acauccaag 19

<210> 248

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 248

cugaggcccc uuaacucau 19

<210> 249

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 249

augaguuaag gggccucag 19

<210> 250

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 250

gaggccccuu aacucaucu 19

<210> 251

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 251

agaugaguua aggggccuc 19

<210> 252

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 252

aggccccuua acucaucug 19

<210> 253

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 253

cagaugaguu aaggggccu 19

<210> 254

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 254

ccccuuaacu caucuguua 19

<210> 255

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 255

uaacagauga guuaagggg 19

<210> 256

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 256

cccuuaacuc aucuguuau 19

<210> 257

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 257

auaacagaug aguuaaggg 19

<210> 258

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 258

ccuuaacuca ucuguuauc 19

<210> 259

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 259

gauaacagau gaguuaagg 19

<210> 260

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 260

cuuaacucau cuguuaucc 19

<210> 261

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 261

ggauaacaga ugaguuaag 19

<210> 262

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 262

uuaacucauc uguuauccu 19

<210> 263

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 263

aggauaacag augaguuaa 19

<210> 264

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 264

uaacucaucu guuauccug 19

<210> 265

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 265

caggauaaca gaugaguua 19

<210> 266

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 266

aacucaucug uuauccugc 19

<210> 267

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 267

gcaggauaac agaugaguu 19

<210> 268

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 268

guuauccugc uagcuguag 19

<210> 269

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 269

cuacagcuag caggauaac 19

<210> 270

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 270

cugcuagcug uagaaaugu 19

<210> 271

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 271

acauuucuac agcuagcag 19

<210> 272

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 272

ugcuagcugu agaaaugua 19

<210> 273

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 273

uacauuucua cagcuagca 19

<210> 274

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 274

gcuguagaaa uguauccug 19

<210> 275

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 275

caggauacau uucuacagc 19

<210> 276

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 276

cuguagaaau guauccuga 19

<210> 277

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 277

ucaggauaca uuucuacag 19

<210> 278

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 278

uguagaaaug uauccugau 19

<210> 279

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 279

aucaggauac auuucuaca 19

<210> 280

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 280

guagaaaugu auccugaua 19

<210> 281

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 281

uaucaggaua cauuucuac 19

<210> 282

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 282

aaauguaucc ugauaaaca 19

<210> 283

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 283

uguuuaucag gauacauuu 19

<210> 284

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 284

guauccugau aaacauuaa 19

<210> 285

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 285

uuaauguuua ucaggauac 19

<210> 286

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 286

uuaaacacug uaaucuuaa 19

<210> 287

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 287

uuaagauuac aguguuuaa 19

<210> 288

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 288

acuguaaucu uaaaagugu 19

<210> 289

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 289

acacuuuuaa gauuacagu 19

<210> 290

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 290

cuguaaucuu aaaagugua 19

<210> 291

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 291

uacacuuuua agauuacag 19

<210> 292

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 292

uguaaucuua aaaguguaa 19

<210> 293

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 293

uuacacuuuu aagauuaca 19

<210> 294

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 294

guaaucuuaa aaguguaau 19

<210> 295

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 295

auuacacuuu uaagauuac 19

<210> 296

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 296

cuuaaaagug uaauugugu 19

<210> 297

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 297

acacaauuac acuuuuaag 19

<210> 298

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 298

uaccuguagu gagaaacug 19

<210> 299

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 299

caguuucuca cuacaggua 19

<210> 300

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 300

uuaugaucac uuggaagau 19

<210> 301

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 301

aucuuccaag ugaucauaa 19

<210> 302

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 302

augaucacuu ggaagauuu 19

<210> 303

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 303

aaaucuucca agugaucau 19

<210> 304

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 304

aucacuugga agauuugua 19

<210> 305

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 305

uacaaaucuu ccaagugau 19

<210> 306

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 306

uggaagauuu guauaguuu 19

<210> 307

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 307

aaacuauaca aaucuucca 19

<210> 308

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 308

uauaaaacuc aguuaaaau 19

<210> 309

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 309

auuuuaacug aguuuuaua 19

<210> 310

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 310

aaacucaguu aaaaugucu 19

<210> 311

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 311

agacauuuua acugaguuu 19

<210> 312

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 312

gucuguuuca augaccugu 19

<210> 313

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 313

acaggucauu gaaacagac 19

<210> 314

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 314

augaccugua uuuugccag 19

<210> 315

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 315

cuggcaaaau acaggucau 19

<210> 316

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 316

accuguauuu ugccagacu 19

<210> 317

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 317

agucuggcaa aauacaggu 19

<210> 318

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 318

ccuguauuuu gccagacuu 19

<210> 319

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 319

aagucuggca aaauacagg 19

<210> 320

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 320

uaaaucacag auggguauu 19

<210> 321

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 321

aauacccauc ugugauuua 19

<210> 322

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 322

aucacagaug gguauuaaa 19

<210> 323

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 323

uuuaauaccc aucugugau 19

<210> 324

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 324

ucacagaugg guauuaaac 19

<210> 325

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 325

guuuaauacc caucuguga 19

<210> 326

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 326

acagaugggu auuaaacuu 19

<210> 327

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 327

aaguuuaaua cccaucugu 19

<210> 328

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 328

cagaugggua uuaaacuug 19

<210> 329

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 329

caaguuuaau acccaucug 19

<210> 330

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 330

agauggguau uaaacuugu 19

<210> 331

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 331

acaaguuuaa uacccaucu 19

<210> 332

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 332

auggguauua aacuuguca 19

<210> 333

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 333

ugacaaguuu aauacccau 19

<210> 334

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 334

uaaacuuguc agaauuucu 19

<210> 335

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 335

agaaauucug acaaguuua 19

<210> 336

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 336

ucauucaagc cugugaaua 19

<210> 337

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 337

uauucacagg cuugaauga 19

<210> 338

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 338

cauucaagcc ugugaauaa 19

<210> 339

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 339

uuauucacag gcuugaaug 19

<210> 340

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 340

aauaaaaacc cuguauggc 19

<210> 341

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 341

gccauacagg guuuuuauu 19

<210> 342

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 342

auaaaaaccc uguauggca 19

<210> 343

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 343

ugccauacag gguuuuuau 19

<210> 344

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 344

aacccuguau ggcacuuau 19

<210> 345

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 345

auaagugcca uacaggguu 19

<210> 346

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 346

acccuguaug gcacuuauu 19

<210> 347

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 347

aauaagugcc auacagggu 19

<210> 348

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 348

gaggcuauua aaagaaucc 19

<210> 349

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 349

ggauucuuuu aauagccuc 19

<210> 350

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 350

aaagaaucca aauucaaac 19

<210> 351

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 351

guuugaauuu ggauucuuu 19

<210> 352

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 352

gaauccaaau ucaaacuaa 19

<210> 353

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 353

uuaguuugaa uuuggauuc 19

<210> 354

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 354

cggaggucug gccuauaact t 21

<210> 355

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 355

uuuauaggcc agaccuccgt t 21

<210> 356

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 356

ggaggucugg ccuauaaact t 21

<210> 357

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 357

uuuuauaggc cagaccucct t 21

<210> 358

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 358

gaggucuggc cuauaaagct t 21

<210> 359

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 359

ucuuuauagg ccagaccuct t 21

<210> 360

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 360

aggucuggcc uauaaaguct t 21

<210> 361

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 361

uacuuuauag gccagaccut t 21

<210> 362

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 362

ggucuggccu auaaaguact t 21

<210> 363

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 363

uuacuuuaua ggccagacct t 21

<210> 364

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 364

ucuggccuau aaaguaguct t 21

<210> 365

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 365

uacuacuuua uaggccagat t 21

<210> 366

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 366

cuggccuaua aaguagucct t 21

<210> 367

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 367

ugacuacuuu auaggccagt t 21

<210> 368

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 368

uggccuauaa aguagucgct t 21

<210> 369

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 369

ucgacuacuu uauaggccat t 21

<210> 370

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 370

ggccuauaaa guagucgcct t 21

<210> 371

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 371

ugcgacuacu uuauaggcct t 21

<210> 372

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 372

gccuauaaag uagucgcgct t 21

<210> 373

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 373

ucgcgacuac uuuauaggct t 21

<210> 374

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 374

ccuauaaagu agucgcggct t 21

<210> 375

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 375

uccgcgacua cuuuauaggt t 21

<210> 376

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 376

gucguagucu ccugcagcct t 21

<210> 377

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 377

ugcugcagga gacuacgact t 21

<210> 378

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 378

cguagucucc ugcagcguct t 21

<210> 379

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 379

uacgcugcag gagacuacgt t 21

<210> 380

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 380

guagucuccu gcagcgucct t 21

<210> 381

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 381

ugacgcugca ggagacuact t 21

<210> 382

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 382

uagucuccug cagcgucuct t 21

<210> 383

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 383

uagacgcugc aggagacuat t 21

<210> 384

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 384

auggcgacga aggccgugct t 21

<210> 385

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 385

ucacggccuu cgucgccaut t 21

<210> 386

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 386

cgacgaaggc cgugugcgct t 21

<210> 387

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 387

ucgcacacgg ccuucgucgt t 21

<210> 388

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 388

gaaggccgug ugcgugcuct t 21

<210> 389

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 389

uagcacgcac acggccuuct t 21

<210> 390

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 390

ggccgugugc gugcugaact t 21

<210> 391

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 391

uuucagcacg cacacggcct t 21

<210> 392

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 392

agggcgacgg cccagugcct t 21

<210> 393

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 393

ugcacugggc cgucgcccut t 21

<210> 394

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 394

ugcagggcau caucaauuct t 21

<210> 395

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 395

uaauugauga ugcccugcat t 21

<210> 396

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 396

gcagggcauc aucaauuuct t 21

<210> 397

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 397

uaaauugaug augcccugct t 21

<210> 398

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 398

agggcaucau caauuucgct t 21

<210> 399

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 399

ucgaaauuga ugaugcccut t 21

<210> 400

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 400

gggcaucauc aauuucgact t 21

<210> 401

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 401

uucgaaauug augaugccct t 21

<210> 402

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 402

ggcaucauca auuucgagct t 21

<210> 403

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 403

ucucgaaauu gaugaugcct t 21

<210> 404

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 404

gcaucaucaa uuucgagcct t 21

<210> 405

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 405

ugcucgaaau ugaugaugct t 21

<210> 406

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 406

caucaucaau uucgagcact t 21

<210> 407

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 407

uugcucgaaa uugaugaugt t 21

<210> 408

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 408

aauuucgagc agaaggaact t 21

<210> 409

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 409

uuuccuucug cucgaaauut t 21

<210> 410

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 410

uucgagcaga aggaaaguct t 21

<210> 411

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 411

uacuuuccuu cugcucgaat t 21

<210> 412

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 412

ucgagcagaa ggaaaguact t 21

<210> 413

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 413

uuacuuuccu ucugcucgat t 21

<210> 414

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 414

aagguguggg gaagcauuct t 21

<210> 415

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 415

uaaugcuucc ccacaccuut t 21

<210> 416

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 416

ggugugggga agcauuaact t 21

<210> 417

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 417

uuuaaugcuu ccccacacct t 21

<210> 418

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 418

gacugacuga aggccugcct t 21

<210> 419

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 419

ugcaggccuu cagucaguct t 21

<210> 420

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 420

cugacugaag gccugcauct t 21

<210> 421

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 421

uaugcaggcc uucagucagt t 21

<210> 422

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 422

ugacugaagg ccugcaugct t 21

<210> 423

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 423

ucaugcaggc cuucagucat t 21

<210> 424

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 424

ugaaggccug cauggauuct t 21

<210> 425

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 425

uaauccaugc aggccuucat t 21

<210> 426

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 426

gaaggccugc auggauucct t 21

<210> 427

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 427

ugaauccaug caggccuuct t 21

<210> 428

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 428

ugcauggauu ccauguucct t 21

<210> 429

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 429

ugaacaugga auccaugcat t 21

<210> 430

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 430

cauggauucc auguucauct t 21

<210> 431

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 431

uaugaacaug gaauccaugt t 21

<210> 432

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 432

ggauuccaug uucaugagct t 21

<210> 433

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 433

ucucaugaac auggaaucct t 21

<210> 434

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 434

uuccauguuc augaguuuct t 21

<210> 435

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 435

uaaacucaug aacauggaat t 21

<210> 436

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 436

guucaugagu uuggagauct t 21

<210> 437

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 437

uaucuccaaa cucaugaact t 21

<210> 438

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 438

uucaugaguu uggagauact t 21

<210> 439

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 439

uuaucuccaa acucaugaat t 21

<210> 440

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 440

ugaguuugga gauaauacct t 21

<210> 441

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 441

uguauuaucu ccaaacucat t 21

<210> 442

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 442

gaguuuggag auaauacact t 21

<210> 443

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 443

uuguauuauc uccaaacuct t 21

<210> 444

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 444

aggcuguacc agugcaggct t 21

<210> 445

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 445

uccugcacug guacagccut t 21

<210> 446

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 446

ggcuguacca gugcagguct t 21

<210> 447

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 447

uaccugcacu gguacagcct t 21

<210> 448

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 448

gcagguccuc acuuuaauct t 21

<210> 449

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 449

uauuaaagug aggaccugct t 21

<210> 450

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 450

cagguccuca cuuuaaucct t 21

<210> 451

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 451

ugauuaaagu gaggaccugt t 21

<210> 452

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 452

ucacuuuaau ccucuaucct t 21

<210> 453

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 453

ugauagagga uuaaagugat t 21

<210> 454

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 454

cuauccagaa aacacgguct t 21

<210> 455

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 455

uaccguguuu ucuggauagt t 21

<210> 456

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 456

uauccagaaa acacggugct t 21

<210> 457

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 457

ucaccguguu uucuggauat t 21

<210> 458

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 458

auccagaaaa cacgguggct t 21

<210> 459

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 459

uccaccgugu uuucuggaut t 21

<210> 460

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 460

ccagaaaaca cggugggcct t 21

<210> 461

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 461

ugcccaccgu guuuucuggt t 21

<210> 462

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 462

gaaaacacgg ugggccaact t 21

<210> 463

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 463

uuuggcccac cguguuuuct t 21

<210> 464

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 464

aaaacacggu gggccaaact t 21

<210> 465

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 465

uuuuggccca ccguguuuut t 21

<210> 466

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 466

cggugggcca aaggaugact t 21

<210> 467

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 467

uucauccuuu ggcccaccgt t 21

<210> 468

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 468

aggaugaaga gaggcaugct t 21

<210> 469

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 469

ucaugccucu cuucauccut t 21

<210> 470

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 470

augaagagag gcauguugct t 21

<210> 471

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 471

ucaacaugcc ucucuucaut t 21

<210> 472

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 472

gagaggcaug uuggagacct t 21

<210> 473

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 473

ugucuccaac augccucuct t 21

<210> 474

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 474

agaggcaugu uggagacuct t 21

<210> 475

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 475

uagucuccaa caugccucut t 21

<210> 476

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 476

auguuggaga cuugggcact t 21

<210> 477

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 477

uugcccaagu cuccaacaut t 21

<210> 478

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 478

guuggagacu ugggcaauct t 21

<210> 479

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 479

uauugcccaa gucuccaact t 21

<210> 480

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 480

ggagacuugg gcaaugugct t 21

<210> 481

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 481

ucacauugcc caagucucct t 21

<210> 482

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 482

ggcaauguga cugcugacct t 21

<210> 483

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 483

ugucagcagu cacauugcct t 21

<210> 484

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 484

caaugugacu gcugacaact t 21

<210> 485

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 485

uuugucagca gucacauugt t 21

<210> 486

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 486

cugacaaaga ugguguggct t 21

<210> 487

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 487

uccacaccau cuuugucagt t 21

<210> 488

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 488

ugacaaagau gguguggcct t 21

<210> 489

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 489

ugccacacca ucuuugucat t 21

<210> 490

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 490

cucaggagac cauugcauct t 21

<210> 491

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 491

uaugcaaugg ucuccugagt t 21

<210> 492

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 492

ucaggagacc auugcaucct t 21

<210> 493

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 493

ugaugcaaug gucuccugat t 21

<210> 494

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 494

agaccauugc aucauuggct t 21

<210> 495

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 495

uccaaugaug caauggucut t 21

<210> 496

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 496

gaccauugca ucauuggcct t 21

<210> 497

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 497

ugccaaugau gcaaugguct t 21

<210> 498

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 498

auugcaucau uggccgcact t 21

<210> 499

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 499

uugcggccaa ugaugcaaut t 21

<210> 500

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 500

cauuggccgc acacugguct t 21

<210> 501

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 501

uaccagugug cggccaaugt t 21

<210> 502

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 502

cgcacacugg ugguccauct t 21

<210> 503

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 503

uauggaccac cagugugcgt t 21

<210> 504

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 504

cacacuggug guccaugact t 21

<210> 505

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 505

uucauggacc accagugugt t 21

<210> 506

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 506

acacuggugg uccaugaact t 21

<210> 507

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 507

uuucauggac caccagugut t 21

<210> 508

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 508

ugguggucca ugaaaaagct t 21

<210> 509

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 509

ucuuuuucau ggaccaccat t 21

<210> 510

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 510

ugguccauga aaaagcagct t 21

<210> 511

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 511

ucugcuuuuu cauggaccat t 21

<210> 512

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 512

aaagcagaug acuugggcct t 21

<210> 513

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 513

ugcccaaguc aucugcuuut t 21

<210> 514

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 514

gcagaugacu ugggcaaact t 21

<210> 515

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 515

uuuugcccaa gucaucugct t 21

<210> 516

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 516

augacuuggg caaaggugct t 21

<210> 517

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 517

ucaccuuugc ccaagucaut t 21

<210> 518

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 518

ugacuugggc aaagguggct t 21

<210> 519

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 519

uccaccuuug cccaagucat t 21

<210> 520

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 520

gacuugggca aagguggact t 21

<210> 521

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 521

uuccaccuuu gcccaaguct t 21

<210> 522

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 522

guacaaagac aggaaacgct t 21

<210> 523

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 523

ucguuuccug ucuuuguact t 21

<210> 524

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 524

acaaagacag gaaacgcuct t 21

<210> 525

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 525

uagcguuucc ugucuuugut t 21

<210> 526

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 526

caaagacagg aaacgcugct t 21

<210> 527

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 527

ucagcguuuc cugucuuugt t 21

<210> 528

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 528

aggaaacgcu ggaagucgct t 21

<210> 529

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 529

ucgacuucca gcguuuccut t 21

<210> 530

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 530

gucguuuggc uuguggugct t 21

<210> 531

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 531

ucaccacaag ccaaacgact t 21

<210> 532

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 532

ucguuuggcu ugugguguct t 21

<210> 533

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 533

uacaccacaa gccaaacgat t 21

<210> 534

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 534

cguuuggcuu gugguguact t 21

<210> 535

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 535

uuacaccaca agccaaacgt t 21

<210> 536

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 536

guuuggcuug ugguguaact t 21

<210> 537

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 537

uuuacaccac aagccaaact t 21

<210> 538

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 538

uuggcuugug guguaauuct t 21

<210> 539

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 539

uaauuacacc acaagccaat t 21

<210> 540

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 540

ggcuuguggu guaauuggct t 21

<210> 541

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 541

uccaauuaca ccacaagcct t 21

<210> 542

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 542

gcuuguggug uaauugggct t 21

<210> 543

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 543

ucccaauuac accacaagct t 21

<210> 544

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 544

cuuguggugu aauugggact t 21

<210> 545

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 545

uucccaauua caccacaagt t 21

<210> 546

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 546

ugugguguaa uugggaucct t 21

<210> 547

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 547

ugaucccaau uacaccacat t 21

<210> 548

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 548

gugguguaau ugggaucgct t 21

<210> 549

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 549

ucgaucccaa uuacaccact t 21

<210> 550

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 550

ugguguaauu gggaucgcct t 21

<210> 551

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 551

ugcgauccca auuacaccat t 21

<210> 552

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 552

guaauuggga ucgcccaact t 21

<210> 553

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 553

uuugggcgau cccaauuact t 21

<210> 554

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 554

uaauugggau cgcccaauct t 21

<210> 555

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 555

uauugggcga ucccaauuat t 21

<210> 556

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 556

aauugggauc gcccaauact t 21

<210> 557

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 557

uuauugggcg aucccaauut t 21

<210> 558

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 558

auugggaucg cccaauaact t 21

<210> 559

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 559

uuuauugggc gaucccaaut t 21

<210> 560

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 560

uugggaucgc ccaauaaact t 21

<210> 561

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 561

uuuuauuggg cgaucccaat t 21

<210> 562

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 562

ugggaucgcc caauaaacct t 21

<210> 563

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 563

uguuuauugg gcgaucccat t 21

<210> 564

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 564

gggaucgccc aauaaacact t 21

<210> 565

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 565

uuguuuauug ggcgauccct t 21

<210> 566

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 566

aucgcccaau aaacauucct t 21

<210> 567

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 567

ugaauguuua uugggcgaut t 21

<210> 568

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 568

ccaauaaaca uucccuugct t 21

<210> 569

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 569

ucaagggaau guuuauuggt t 21

<210> 570

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 570

caauaaacau ucccuuggct t 21

<210> 571

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 571

uccaagggaa uguuuauugt t 21

<210> 572

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 572

aauaaacauu cccuuggact t 21

<210> 573

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 573

uuccaaggga auguuuauut t 21

<210> 574

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 574

auaaacauuc ccuuggauct t 21

<210> 575

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 575

uauccaaggg aauguuuaut t 21

<210> 576

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 576

uaaacauucc cuuggaugct t 21

<210> 577

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 577

ucauccaagg gaauguuuat t 21

<210> 578

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 578

aaacauuccc uuggauguct t 21

<210> 579

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 579

uacauccaag ggaauguuut t 21

<210> 580

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 580

aacauucccu uggauguact t 21

<210> 581

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 581

uuacauccaa gggaauguut t 21

<210> 582

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 582

auucccuugg auguagucct t 21

<210> 583

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 583

ugacuacauc caagggaaut t 21

<210> 584

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 584

cuuggaugua gucugaggct t 21

<210> 585

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 585

uccucagacu acauccaagt t 21

<210> 586

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 586

cugaggcccc uuaacucact t 21

<210> 587

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 587

uugaguuaag gggccucagt t 21

<210> 588

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 588

gaggccccuu aacucaucct t 21

<210> 589

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 589

ugaugaguua aggggccuct t 21

<210> 590

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 590

aggccccuua acucaucuct t 21

<210> 591

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 591

uagaugaguu aaggggccut t 21

<210> 592

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 592

ccccuuaacu caucuguuct t 21

<210> 593

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 593

uaacagauga guuaaggggt t 21

<210> 594

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 594

cccuuaacuc aucuguuact t 21

<210> 595

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 595

uuaacagaug aguuaagggt t 21

<210> 596

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 596

ccuuaacuca ucuguuauct t 21

<210> 597

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 597

uauaacagau gaguuaaggt t 21

<210> 598

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 598

cuuaacucau cuguuaucct t 21

<210> 599

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 599

ugauaacaga ugaguuaagt t 21

<210> 600

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 600

uuaacucauc uguuauccct t 21

<210> 601

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 601

uggauaacag augaguuaat t 21

<210> 602

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 602

uaacucaucu guuauccuct t 21

<210> 603

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 603

uaggauaaca gaugaguuat t 21

<210> 604

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 604

aacucaucug uuauccugct t 21

<210> 605

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 605

ucaggauaac agaugaguut t 21

<210> 606

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 606

guuauccugc uagcuguact t 21

<210> 607

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 607

uuacagcuag caggauaact t 21

<210> 608

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 608

cugcuagcug uagaaaugct t 21

<210> 609

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 609

ucauuucuac agcuagcagt t 21

<210> 610

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 610

ugcuagcugu agaaauguct t 21

<210> 611

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 611

uacauuucua cagcuagcat t 21

<210> 612

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 612

gcuguagaaa uguauccuct t 21

<210> 613

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 613

uaggauacau uucuacagct t 21

<210> 614

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 614

cuguagaaau guauccugct t 21

<210> 615

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 615

ucaggauaca uuucuacagt t 21

<210> 616

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 616

uguagaaaug uauccugact t 21

<210> 617

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 617

uucaggauac auuucuacat t 21

<210> 618

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 618

guagaaaugu auccugauct t 21

<210> 619

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 619

uaucaggaua cauuucuact t 21

<210> 620

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 620

aaauguaucc ugauaaacct t 21

<210> 621

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 621

uguuuaucag gauacauuut t 21

<210> 622

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 622

guauccugau aaacauuact t 21

<210> 623

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 623

uuaauguuua ucaggauact t 21

<210> 624

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 624

uuaaacacug uaaucuuact t 21

<210> 625

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 625

uuaagauuac aguguuuaat t 21

<210> 626

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 626

acuguaaucu uaaaagugct t 21

<210> 627

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 627

ucacuuuuaa gauuacagut t 21

<210> 628

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 628

cuguaaucuu aaaaguguct t 21

<210> 629

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 629

uacacuuuua agauuacagt t 21

<210> 630

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 630

uguaaucuua aaaguguact t 21

<210> 631

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 631

uuacacuuuu aagauuacat t 21

<210> 632

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 632

guaaucuuaa aaguguaact t 21

<210> 633

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 633

uuuacacuuu uaagauuact t 21

<210> 634

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 634

cuuaaaagug uaauugugct t 21

<210> 635

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 635

ucacaauuac acuuuuaagt t 21

<210> 636

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 636

uaccuguagu gagaaacuct t 21

<210> 637

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 637

uaguuucuca cuacagguat t 21

<210> 638

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 638

uuaugaucac uuggaagact t 21

<210> 639

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 639

uucuuccaag ugaucauaat t 21

<210> 640

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 640

augaucacuu ggaagauuct t 21

<210> 641

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 641

uaaucuucca agugaucaut t 21

<210> 642

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 642

aucacuugga agauuuguct t 21

<210> 643

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 643

uacaaaucuu ccaagugaut t 21

<210> 644

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 644

uggaagauuu guauaguuct t 21

<210> 645

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 645

uaacuauaca aaucuuccat t 21

<210> 646

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 646

uauaaaacuc aguuaaaact t 21

<210> 647

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 647

uuuuuaacug aguuuuauat t 21

<210> 648

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 648

aaacucaguu aaaaugucct t 21

<210> 649

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 649

ugacauuuua acugaguuut t 21

<210> 650

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 650

gucuguuuca augaccugct t 21

<210> 651

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 651

ucaggucauu gaaacagact t 21

<210> 652

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 652

augaccugua uuuugccact t 21

<210> 653

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 653

uuggcaaaau acaggucaut t 21

<210> 654

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 654

accuguauuu ugccagacct t 21

<210> 655

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 655

ugucuggcaa aauacaggut t 21

<210> 656

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 656

ccuguauuuu gccagacuct t 21

<210> 657

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 657

uagucuggca aaauacaggt t 21

<210> 658

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 658

uaaaucacag auggguauct t 21

<210> 659

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 659

uauacccauc ugugauuuat t 21

<210> 660

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 660

aucacagaug gguauuaact t 21

<210> 661

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 661

uuuaauaccc aucugugaut t 21

<210> 662

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 662

ucacagaugg guauuaaact t 21

<210> 663

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 663

uuuuaauacc caucugugat t 21

<210> 664

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 664

acagaugggu auuaaacuct t 21

<210> 665

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 665

uaguuuaaua cccaucugut t 21

<210> 666

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 666

cagaugggua uuaaacuuct t 21

<210> 667

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 667

uaaguuuaau acccaucugt t 21

<210> 668

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 668

agauggguau uaaacuugct t 21

<210> 669

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 669

ucaaguuuaa uacccaucut t 21

<210> 670

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 670

auggguauua aacuugucct t 21

<210> 671

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 671

ugacaaguuu aauacccaut t 21

<210> 672

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 672

uaaacuuguc agaauuucct t 21

<210> 673

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 673

ugaaauucug acaaguuuat t 21

<210> 674

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 674

ucauucaagc cugugaauct t 21

<210> 675

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 675

uauucacagg cuugaaugat t 21

<210> 676

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 676

cauucaagcc ugugaauact t 21

<210> 677

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 677

uuauucacag gcuugaaugt t 21

<210> 678

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 678

aauaaaaacc cuguauggct t 21

<210> 679

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 679

uccauacagg guuuuuauut t 21

<210> 680

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 680

auaaaaaccc uguauggcct t 21

<210> 681

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 681

ugccauacag gguuuuuaut t 21

<210> 682

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 682

aacccuguau ggcacuuact t 21

<210> 683

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 683

uuaagugcca uacaggguut t 21

<210> 684

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 684

acccuguaug gcacuuauct t 21

<210> 685

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 685

uauaagugcc auacagggut t 21

<210> 686

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 686

gaggcuauua aaagaaucct t 21

<210> 687

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 687

ugauucuuuu aauagccuct t 21

<210> 688

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 688

aaagaaucca aauucaaact t 21

<210> 689

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 689

uuuugaauuu ggauucuuut t 21

<210> 690

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 690

gaauccaaau ucaaacuact t 21

<210> 691

<211> 21

<212> ДНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<220>

<223> Описание комбинированной молекулы ДНК/РНК: синтетический олигонуклеотид

<400> 691

uuaguuugaa uuuggauuct t 21

<210> 692

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 692

caaugugacu gcugacaacc c 21

<210> 693

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 693

uuugucagca gucacauugu u 21

<210> 694

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 694

caaugugacu gcugacaauc c 21

<210> 695

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 695

caaugugacu gcugacaagc c 21

<210> 696

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 696

caaugugacu gcugacaaac c 21

<210> 697

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 697

caaugugaca gcugacaaac c 21

<210> 698

<211> 20

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 698

caaugugacu gcugacaacc 20

<210> 699

<211> 22

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 699

caaugugacu gcugacaauc cc 22

<210> 700

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 700

caaugugacu gcugacaaca c 21

<210> 701

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 701

uuugucagca gucacauugu c 21

<210> 702

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 702

caaugugacu gcugacaaau c 21

<210> 703

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 703

caaugugacu gcugacaauu c 21

<210> 704

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 704

uuugucagca gucacauuga c 21

<210> 705

<211> 22

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 705

caaugugacu gcugacaauc cc 22

<210> 706

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 706

cgacgaaggc cgugugcgcc c 21

<210> 707

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 707

ucgcacacgg ccuucgucgu u 21

<210> 708

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 708

ugacuugggc aaagguggcc c 21

<210> 709

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 709

uccaccuuug cccaagucau u 21

<210> 710

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 710

aacucaucug uuauccugcc c 21

<210> 711

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 711

ucaggauaac agaugaguuu u 21

<210> 712

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 712

ccccuuaacu caucuguucc c 21

<210> 713

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 713

uaacagauga guuaaggggu u 21

<210> 714

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 714

cccuuaacuc aucuguuacc c 21

<210> 715

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 715

uuaacagaug aguuaagggu u 21

<210> 716

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 716

aacucaucug uuaucuugcc c 21

<210> 717

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 717

gcuguggaaa uguaucuucc c 21

<210> 718

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 718

uaggauacau uucuacagcu u 21

<210> 719

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 719

ugacuugggc aaaggugagc c 21

<210> 720

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 720

ccccuuaacu caucuguugc c 21

<210> 721

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 721

cccuuaacuc aucuguuagc c 21

<210> 722

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 722

aacucaucug uuaucuuagc c 21

<210> 723

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 723

gcuguggaaa uguaucuugc c 21

<210> 724

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 724

ugacuugggc aaagguaggc c 21

<210> 725

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 725

ccccuuaaca caucuguuac c 21

<210> 726

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 726

cccuuaacug aucuguuaac c 21

<210> 727

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 727

aacucaucuc uuaucuugcc c 21

<210> 728

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 728

gcuguggaau uguaucuugc c 21

<210> 729

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 729

ugacuugggg aaaggugagc c 21

<210> 730

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 730

aacucaucug uuaucuuggc c 21

<210> 731

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 731

ccccuuaacu cauuuguucc c 21

<210> 732

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 732

ugacuugggc aaagguagcc c 21

<210> 733

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 733

uuugucagca gucacauugu c 21

<210> 734

<211> 19

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 734

caaugugacu gcugacaaa 19

<210> 735

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 735

gcagguccuc acuuuaaugc c 21

<210> 736

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 736

gauuaaagug aggaccugcu u 21

<210> 737

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 737

ggcaauguga cugcugaccc c 21

<210> 738

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 738

ugucagcagu cacauugccu u 21

<210> 739

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 739

gcagguccuc acuuuaauuc c 21

<210> 740

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 740

ggcaauguga cugcugaugc c 21

<210> 741

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 741

gcagguccuc acuuuaaucc c 21

<210> 742

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 742

ggcaauguga cugcugauac c 21

<210> 743

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 743

gcagguccug acuuuaaucc c 21

<210> 744

<211> 21

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 744

ggcaaugugu cugcugauac c 21

<210> 745

<211> 22

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 745

gauuaaagug aggaccugcu uu 22

<210> 746

<211> 22

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 746

ugucagcagu cacauugccu uu 22

<210> 747

<211> 152

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 747

uuuaugccuc auccucugag ugcugaaggc uugcuguagg cuguaugcug caaugugacu 60

gcugacaacc cugugaccug guuugucagc agucacauug uuaguguaug augccuguua 120

cuagcauuca cauggaacaa auugcugccg ug 152

<210> 748

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 748

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aacccuguga ccugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 749

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 749

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aauccuguga ccugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 750

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 750

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aagccuguga ccugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 751

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 751

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aaaccuguga ccugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 752

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 752

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacagcugac aaaccuguga ccugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 753

<211> 157

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 753

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aaccugugac cugguuuguc agcagucaca uuguucugag gagcgccuug 120

acagcagcca ugggagggcc gcccccuacc ucaguga 157

<210> 754

<211> 159

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 754

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aaucccugug accugguuug ucagcaguca cauuguucug aggagcgccu 120

ugacagcagc caugggaggg ccgcccccua ccucaguga 159

<210> 755

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 755

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aacccuguga uuugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 756

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 756

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aacccuauaa uuugguuugu cagcagucac auuguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 757

<211> 159

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 757

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aacacccuga cccaguuuug ucagcaguca cauuguucug aggagcgccu 120

ugacagcagc caugggaggg ccgcccccua ccucaguga 159

<210> 758

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 758

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aacccuguga ccugguuugu cagcagucac auuguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 759

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 759

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aauccuguga ccugguuugu cagcagucac auuguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 760

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 760

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacagcugac aaaccuguga ccugguuugu cagcagucac auuguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 761

<211> 159

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 761

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aacacccuga cccaguuuug ucagcaguca cauuguucug uggagcgccu 120

ugacagcagc caugggaggg ccgcccccua ccucaguga 159

<210> 762

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 762

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacaaugu 60

gacugcugac aagccuguga ccugguuugu cagcagucac auuguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 763

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 763

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacgacga 60

aggccgugug cgcccuguga ccuggucgca cacggccuuc gucguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 764

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 764

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaugacuu 60

gggcaaaggu ggcccuguga ccugguccac cuuugcccaa gucauucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 765

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 765

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaaacuca 60

ucuguuaucc ugcccuguga ccuggucagg auaacagaug aguuuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 766

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 766

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga caaugugacu gcugacaacc 120

cgucugcacc ugucacuagu uugucagcag ucacauuguu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 767

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 767

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaccccuu 60

aacucaucug uucccuguga ccugguaaca gaugaguuaa gggguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 768

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 768

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacccuua 60

acucaucugu uacccuguga ccugguuaac agaugaguua aggguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 769

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 769

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaaacuca 60

ucuguuaucu ugcccuguga ccuggucagg auaacagaug aguuuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 770

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 770

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcugug 60

gaaauguauc uucccuguga ccugguagga uacauuucua cagcuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 771

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 771

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaugacuu 60

gggcaaaggu gagccuguga ccugguccac cuuugcccaa gucauucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 772

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 772

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaccccuu 60

aacucaucug uugccuguga ccugguaaca gaugaguuaa gggguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 773

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 773

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacccuua 60

acucaucugu uagccuguga ccugguuaac agaugaguua aggguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 774

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 774

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaaacuca 60

ucuguuaucu uagccuguga ccuggucagg auaacagaug aguuuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 775

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 775

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcugug 60

gaaauguauc uugccuguga ccugguagga uacauuucua cagcuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 776

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 776

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaugacuu 60

gggcaaaggu aggccuguga ccugguccac cuuugcccaa gucauucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 777

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 777

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaccccuu 60

aacucaucug uucccuguga uuugguaaca gaugaguuaa gggguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 778

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 778

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacccuua 60

acucaucugu uacccuguga uuugguuaac agaugaguua aggguucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 779

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 779

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaaacuca 60

ucuguuaucu ugcccuguga uuuggucagg auaacagaug aguuuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 780

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 780

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcugug 60

gaaauguauc uucccuguga uuugguagga uacauuucua cagcuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 781

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 781

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaugacuu 60

gggcaaaggu gagccuguga uuugguccac cuuugcccaa gucauucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 782

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 782

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaccccuu 60

aacacaucug uuaccuguga ccugguaaca gaugaguuaa gggguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 783

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 783

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacccuua 60

acugaucugu uaaccuguga ccugguuaac agaugaguua aggguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 784

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 784

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaaacuca 60

ucucuuaucu ugcccuguga ccuggucagg auaacagaug aguuuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 785

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 785

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcugug 60

gaauuguauc uugccuguga ccugguagga uacauuucua cagcuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 786

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 786

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaugacuu 60

ggggaaaggu gagccuguga ccugguccac cuuugcccaa gucauucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 787

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 787

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaccccuu 60

aacucaucug uugccuguga ccugguaaca gaugaguuaa gggguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 788

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 788

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaacccuua 60

acucaucugu uagccuguga ccugguuaac agaugaguua aggguucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 789

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 789

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaaacuca 60

ucuguuaucu uggccuguga ccuggucagg auaacagaug aguuuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 790

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 790

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcugug 60

gaaauguauc uugccuguga ccugguagga uacauuucua cagcuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 791

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 791

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaugacuu 60

gggcaaaggu aggccuguga ccugguccac cuuugcccaa gucauucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 792

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 792

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga ccccuuaacu cauuuguucc 120

cgucugcacc ugucacuagu aacagaugag uuaagggguu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 793

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 793

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga cccuuaacuc aucuguuacc 120

cgucugcacc ugucacuagu uaacagauga guuaaggguu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 794

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 794

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga aacucaucug uuaucuugcc 120

cgucugcacc ugucacuagu caggauaaca gaugaguuuu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 795

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 795

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga gcuguggaaa uguaucuucc 120

cgucugcacc ugucacuagu aggauacauu ucuacagcuu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 796

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 796

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga ugacuugggc aaagguagcc 120

cgucugcacc ugucacuagu ccaccuuugc ccaagucauu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 797

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 797

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc gggauuuguc 60

agcagucaca uugucuguga ccuggcaaug ugacugcuga caaauccuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 798

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 798

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcaggu 60

ccucacuuua augccuguga ccugggauua aagugaggac cugcuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 799

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 799

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaggcaau 60

gugacugcug accccuguga ccugguguca gcagucacau ugccuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 800

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 800

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcaggu 60

ccucacuuua auuccuguga ccugggauua aagugaggac cugcuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 801

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 801

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaggcaau 60

gugacugcug augccuguga ccugguguca gcagucacau ugccuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 802

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 802

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcaggu 60

ccucacuuua aucccuguga uuugggauua aagugaggac cugcuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 803

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 803

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaggcaau 60

gugacugcug auaccuguga uuugguguca gcagucacau ugccuucuga ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 804

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 804

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcaggu 60

ccugacuuua aucccuguga ccugggauua aagugaggac cugcuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 805

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 805

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaggcaau 60

gugucugcug auaccuguga ccugguguca gcagucacau ugccuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 806

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 806

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaagcaggu 60

ccucacuuua aucccuguga ccugggauua aagugaggac cugcuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 807

<211> 158

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 807

gugcugggcg gggggcggcg ggcccucccg cagaacacca ugcgcucuuc ggaaggcaau 60

gugacugcug auaccuguga ccugguguca gcagucacau ugccuucugu ggagcgccuu 120

gacagcagcc augggagggc cgcccccuac cucaguga 158

<210> 808

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 808

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga gcagguccuc acuuuaaucc 120

cgucugcacc ugucacuagg auuaaaguga ggaccugcuu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 809

<211> 260

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический полинуклеотид

<400> 809

gaagcaaaga aggggcagag ggagcccgug agcugagugg gccagggacu gggagaagga 60

gugaggaggc agggccggca ugccucugcu gcuggccaga ggcaauguga cugcugauac 120

cgucugcacc ugucacuagu gucagcaguc acauugccuu uggccgugua gugcuaccca 180

gcgcuggcug ccuccucagc auugcaauuc cucucccauc ugggcaccag ucagcuaccc 240

uggugggaau cuggguagcc 260

<210> 810

<211> 54

<212> РНК

<213> Искусственная последовательность

<220>

<223> Описание искусственной последовательности: синтетический олигонуклеотид

<400> 810

uccugaggag cgccuugaca gcagccaugg gagggccgcc cccuaccuca guga 54

<---

1. Модулирующий полинуклеотид для модулирования экспрессии гена в клетке, где указанный модулирующий полинуклеотид содержит

(a) стебель и петлю, которые образуют структуру «петля на стебле», где последовательность указанной структуры «петля на стебле» содержит в направлении от 5’ до 3’:

(i) 5’-ветвь стебля, где указанная 5’-ветвь стебля содержит сопровождающую цепь и 5’-спейсерную последовательность, расположенную в направлении 5’ по отношению к указанной сопровождающей цепи;

(ii) петлевой участок длиной между 4-20 нуклеотидами; и

(iii) 3’-ветвь стебля, где указанная 3’-ветвь стебля содержит направляющую цепь и 3’-спейсерную последовательность, расположенную в направлении 3’ по отношению к указанной направляющей цепи;

(b) первый фланкирующий участок, расположенный в направлении 5’ по отношению к указанной сопровождающей цепи, где указанный первый фланкирующий участок содержит указанную 5’-спейсерную последовательность и 5’-фланкирующую последовательность, расположенную в направлении 5’ по отношению к указанной 5’-спейсерной последовательности; и

(c) второй фланкирующий участок, расположенный в направлении 3’ по отношению к указанной направляющей цепи, где указанный второй фланкирующий участок содержит указанную 3’-спейсерную последовательность и 3’-фланкирующую последовательность, расположенную в направлении 3’ по отношению к указанной 3’-спейсерной последовательности, и где указанный второй фланкирующий участок содержит нуклеотидную последовательность, которая по меньшей мере на 90% идентична SEQ ID NO: 11.

2. Модулирующий полинуклеотид по п. 1, где второй фланкирующий участок содержит SEQ ID NO: 11.

3. Модулирующий полинуклеотид для модулирования экспрессии гена в клетке, содержащий

(a) стебель и петлю, которые образуют структуру «петля на стебле», где последовательность указанной структуры «петля на стебле» содержит в направлении от 5’ до 3’:

(i) 5’-ветвь стебля, где указанная 5’-ветвь стебля содержит сопровождающую цепь и 5’-спейсерную последовательность, расположенную в направлении 5’ по отношению к указанной сопровождающей цепи;

(ii) петлевой участок длиной между 4-20 нуклеотидами; и

(iii) 3’-ветвь стебля, где указанная 3’-ветвь стебля содержит направляющую цепь и 3’-спейсерную последовательность, расположенную в направлении 3’ по отношению к указанной направляющей цепи;

(b) первый фланкирующий участок, расположенный в направлении 5’ по отношению к указанной сопровождающей цепи, где указанный первый фланкирующий участок содержит указанную 5’-спейсерную последовательность и 5’-фланкирующую последовательность, расположенную в направлении 5’ по отношению к указанной 5’-спейсерной последовательности, и где указанный первый фланкирующий участок содержит нуклеотидную последовательность, которая по меньшей мере на 90% идентична SEQ ID NO: 2; и

(c) второй фланкирующий участок, расположенный в направлении 3’ по отношению к указанной направляющей цепи, где указанный второй фланкирующий участок содержит указанную 3’-спейсерную последовательность и 3’-фланкирующую последовательность, расположенную в направлении 3’ по отношению к указанной 3’-спейсерной последовательности.

4. Модулирующий полинуклеотид по любому из пп. 1-3, где сопровождающая цепь длиной между 15-30 нуклеотидами; где 5’-спейсерная последовательность длиной между 8-20 нуклеотидами; где направляющая последовательность длиной между 15-30 нуклеотидами и где 3’-спейсерная последовательность длиной между 8-20 нуклеотидами.

5. Модулирующий полинуклеотид по любому из пп. 1-4, где первый фланкирующий участок содержит нуклеотидную последовательность, которая по меньшей мере на 95% идентична SEQ ID NO: 2.

6. Модулирующий полинуклеотид по любому из пп. 1-5, где направляющая цепь содержит последовательность затравочного участка микроРНК в положениях 2-7, 2-8 или 2-9.

7. Модулирующий полинуклеотид по любому из пп. 1-6, где сопровождающая цепь по меньшей мере на 70% комплементарна направляющей цепи.

8. Модулирующий полинуклеотид по п. 7, где направляющая цепь длиной 22 нуклеотида.

9. Модулирующий полинуклеотид по п. 7, где направляющая цепь длиной 21 нуклеотид.

10. Модулирующий полинуклеотид по любому из пп. 1-9, где направляющая цепь по меньшей мере на 70% комплементарна кодирующей мРНК млекопитающих.

11. Модулирующий полинуклеотид по п. 10, где кодирующая мРНК экспрессируется в клетке, ткани или органе нервной системы.

12. Искусственная pri-микроРНК для модулирования экспрессии гена в клетке, где указанная pri-микроРНК содержит

(a) стебель и петлю, которые образуют структуру «петля на стебле», где последовательность указанной структуры «петля на стебле» содержит в направлении от 5’ до 3’:

(i) 5’-ветвь стебля, где указанная 5’-ветвь стебля содержит сопровождающую цепь или направляющую цепь и 5’-спейсерную последовательность, где указанная 5’-спейсерная последовательность расположена в направлении 5’ по отношению к указанной сопровождающей цепи или направляющей цепи в 5’-ветви стебля;

(ii) петлевой участок длиной между 4-20 нуклеотидами; и

(iii) 3’-ветвь стебля, где указанная 3’-ветвь стебля содержит направляющую цепь или сопровождающую цепь и 3’-спейсерную последовательность, где указанная 3’-спейсерная последовательность расположена в направлении 3’ по отношению к указанной сопровождающей последовательности или направляющей последовательности в 3’-ветви стебля; и

(b) 3’-фланкирующую область, расположенную в направлении 3’ по отношению к указанной сопровождающей цепи или направляющей цепи в указанной 3’-ветви стебля, где указанная 3’-фланкирующая область содержит указанную 3’-спейсерную область и 3’-фланкирующую последовательность, расположенную в направлении 3’ по отношению к указанной 3’-спейсерной последовательности, и где указанная 3’-фланкирующая область содержит нуклеотидную последовательность, которая по меньшей мере на 90% идентична SEQ ID NO: 11.

13. Искусственная pri-микроРНК по п. 12, где указанная 3’-фланкирующая область содержит SEQ ID NO: 11.

14. Искусственная pri-микроРНК для модулирования экспрессии гена в клетке, где указанная pri-микроРНК содержит

(a) стебель и петлю, которые образуют структуру «петля на стебле», где последовательность указанной структуры «петля на стебле» содержит в направлении от 5’ до 3’:

(i) 5’-ветвь стебля, где указанная 5’-ветвь стебля содержит сопровождающую цепь или направляющую цепь и 5’-спейсерную последовательность, где указанная 5’-спейсерная последовательность расположена в направлении 5’ по отношению к указанной сопровождающей цепи или направляющей цепи в 5’-ветви стебля;

(ii) петлевой участок, содержащий мотив UGUG на 5’-конце указанного петлевого участка;

(iii) 3’-ветвь стебля, содержащую сопровождающую цепь или направляющую цепь и 3’-спейсерную последовательность, где указанная 3’-спейсерная последовательность расположена в направлении 3’ по отношению к указанной сопровождающей цепи или направляющей цепи в 3’-ветви стебля;

(b) 5’-фланкирующую область, расположенную в направлении 5’ по отношению к указанной сопровождающей цепи или направляющей цепи в указанной 5’-ветви стебля, где указанная 5’-фланкирующая область содержит указанную 5’-спейсепную область и 5’-фланкирующую последовательность, расположенную в направлении 5’ по отношению к указанной 5’-спейсерной последовательности, и где указанная 5’-фланкирующая область содержит нуклеотидную последовательность, которая по меньшей мере на 95% идентична SEQ ID NO: 2.

15. Векторный геном аденоассоциированного вируса (AAV) для модулирования экспрессии гена в клетке, где указанный векторный геном AAV кодирует модулирующий полинуклеотид по любому из пп. 1-11 или кодирует искусственную pri-микроРНК по любому из пп. 12-14.

16. Рекомбинантный AAV (rAAV) для модулирования экспрессии гена в клетке, где указанный rAAV содержит векторный геном по п. 15 и капсид AAV.

17. Рекомбинантный AAV по п. 16, где капсид AAV представляет собой капсид AAV1.



 

Похожие патенты:

Изобретение относится к биотехнологии. Предложен рекомбинантный онколитический вирус простого герпеса (oHSV), содержащий не-HSV-лиганд, специфичный к молекуле (белковой, липидной или углеводной детерминанте), присутствующей на поверхности клетки (такой как раковая клетка), и одну или более копий одной или более последовательностей-мишеней микроРНК, встроенных в один или более локусов гена HSV, а предпочтительно, в один или более генов HSV, необходимых для репликации HSV в нормальных (то есть, не-раковых) клетках.

Предложенная группа изобретений относится к области медицины, в частности к биотехнологии и фармацевтике. Предложена генно-инженерная конструкция для стимуляции посттравматической регенерации периферических нервов, представляющая собой вектор со встроенными последовательностями кДНК hBDNF и huPA и регуляторную последовательность, включающую энхансер, внедренный в последовательность цитомегаловирусного промотера, искусственный интрон и сайт внутренней посадки рибосомы вируса гепатита С.

Изобретения относятся к аденоассоциированным вирусным векторам и содержащим их фармацевтическим композициям для лечения лизосомных болезней накопления, и в частности для лечения мукополисахаридозов типа IIIВ (MPSIIIB).

Группа изобретений относится к области медицины, а именно к офтальмологии, и предназначена для лечения миоцилиновой (MYOC) глаукомы у млекопитающего. Способ лечения MYOC-глаукомы включает введение в глаз млекопитающего частицы рекомбинантного аденоассоциированного вируса (rAAV), содержащего вектор, кодирующий RSPO1, RSPO2, RSPO3, RSPO4, усеченный RSPO1, усеченный RSPO2, усеченный RSPO3 или усеченный RSPO4.

Изобретение относится к биотехнологии. С целью экспрессии трансгена исключительно в клетках мышечной ткани для создания аденоассоциированного вируса используют экспрессирующий вектор, содержащий мышцеспецифический промотор С5-12, повторяющиеся последовательности ДНК, комплементарные последовательностям плечей микроРНК mir-142 и mir-499, и упаковочную плазмиду, которая содержит для экспрессии белка VP3 вируса промотор C5-tataless и ген вирусного белка VP3 субтипа 2 человека, который содержит дополнительную аминокислотную последовательность TGASSLNIAGLS.
Изобретение относится к области биотехнологии и молекулярной биологии. Предложен векторный геном на основе аденоассоциированного вируса (AAV) для доставки в клетку нуклеотидной последовательности, кодирующей декарбоксилазу ароматических L-аминокислот (AADC).

Настоящее изобретение относится к биотехнологии. Предложен способ получения цитотоксических Т-лимфоцитов, экспрессирующих химерный рецептор.

Настоящее изобретение относится к биотехнологии. Предложен способ получения цитотоксических Т-лимфоцитов, экспрессирующих химерный рецептор.

Изобретение относится к области биотехнологии. Предложен вектор на основе вируса простого герпеса (ВПГ), который не экспрессирует токсичные гены ВПГ ICP0, ICP4, ICP22, ICP27 и, в случае необходимости, ICP47 в некомплементирующих клетках.

Изобретение относится к области биотехнологии. Предложен вектор на основе вируса простого герпеса (ВПГ), который не экспрессирует токсичные гены ВПГ ICP0, ICP4, ICP22, ICP27 и, в случае необходимости, ICP47 в некомплементирующих клетках.

Изобретение относится к биотехнологии. Описана siRNA для ингибирования экспрессии GST-π, содержащая смысловую цепь и антисмысловую цепь, где цепи образуют дуплексную область, и где антисмысловая цепь представляет собой SEQ ID NO:157, и смысловая цепь представляет собой SEQ ID NO:131, где длина каждой цепи составляет 30 нуклеотидов или менее.

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая одноцепочечную молекулу нуклеиновой кислоты, ингибирующую экспрессию гена проренина или гена рецептора проренина, ингибитор экспрессии гена проренина или гена рецептора проренина, терапевтическое средство для заболевания глаз, содержащее вышеуказанную молекулу нуклеиновой кислоты, способ ингибирования экспрессии гена проренина или гена рецептора проренина, включающий применение вышеуказанной молекулы нуклеиновой кислоты, применение вышеуказанной молекулы нуклеиновой кислоты для выработки ингибитора экспрессии гена проренина или гена рецептора проренина.

Изобретение относится к биотехнологии. Описан олигонуклеотидный ингибитор miR-155, содержащий/состоящий из последовательность/и 5’-lCs.dAs.lCs.dGs.dAs.lTs.lTs.dAs.lGs.dCs.lAs.lTs.lTs.lA-3’ (SEQ ID NO: 25), где l представляет собой замкнутый нуклеотид; d представляет собой дезоксирибонуклеотид; s представляет собой фосфортиоатную связь или олигонуклеотидный ингибитор miR-155, содержащий/состоящий из последовательность/и 5’-lCs.dAs.lCs.dGs.dAs.lTs.lTs.dAs.lGs.lCs.dAs.lTs.lTs.lA-3’ (SEQ ID NO: 53), где l представляет собой замкнутый нуклеотид; d представляет собой дезоксирибонуклеотид; s представляет собой фосфортиоатную связь.

Изобретение относится к биотехнологии. Заявлена импортируемая в митохондрии гидовая РНК с субдоменами транспортной РНК лизина HD и HF.

Группа изобретений относится к биотехнологии, в частности к области стабилизации дезоксирибонуклеиновой кислоты (ДНК) человека и микроорганизмов, присутствующей в сложных биологических образцах, таких как фекалии.

Изобретение относится к биотехнологии. Описаны антисмысловые олигонуклеотиды, состоящие из 10-28 нуклеотидов, и, по меньшей мере, два из 10-28 нуклеотидов представляют LNA, и антисмысловой олигонуклеотид комплементарен участку гена, кодирующего TGF-RII, или участку мРНК, кодирующей TGF-RII.

Настоящее изобретение относится к области биотехнологии, а именно к нуклеотидной последовательности, содержащей оптимизированный для экспрессии в E. coli ген консенсусного гликопротеина вируса бешенства с SEQ ID NO: 1.

Изобретение относится к биотехнологии, в частности к области молекулярного конструирования частиц наноразмерного диапазона, а также к способам получения регулярного распределения таких частиц, и может быть использована в наноэлектронике для создания ячеек памяти высокой плотности.

Изобретение относится к области биотехнологии и молекулярной биологии. Предложен векторный геном на основе аденоассоциированного вируса (AAV) для ингибирования или подавления экспрессии гена супероксиддисмутазы 1 (SOD1) в клетке млекопитающего, а также соответствующая частица, способ ингибирования экспрессии гена, фармацевтическая композиция, способ лечения бокового амиотрофического склероза и дуплекс siРНК.

Настоящее изобретение относится к биотехнологии. Предложена композиция, содержащая один или несколько вирусных векторов, кодирующих систему CRISPR/Cas, для применения в лечении заболевания или расстройства мозга.

Изобретение относится к биотехнологии. Предложен рекомбинантный онколитический вирус простого герпеса (oHSV), содержащий не-HSV-лиганд, специфичный к молекуле (белковой, липидной или углеводной детерминанте), присутствующей на поверхности клетки (такой как раковая клетка), и одну или более копий одной или более последовательностей-мишеней микроРНК, встроенных в один или более локусов гена HSV, а предпочтительно, в один или более генов HSV, необходимых для репликации HSV в нормальных (то есть, не-раковых) клетках.

Изобретение относится к области биотехнологии. Предложен модулирующий полинуклеотид для модулирования экспрессии гена в клетке. Изобретение может быть использовано в медицине. 6 н. и 11 з.п. ф-лы, 13 ил., 19 табл., 19 пр.

Наверх